Open Close
General Information
Symbol
Dmel\AF083514
Species
D. melanogaster
Name
AF083514
FlyBase ID
FBcl0000621
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    AF_cDNA
    • AF cDNA library of D. melanogaster, Canton-S strain, adult brain.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      480
      NCBI
      Partial sequence dataSequence Downloader
      GGTTCTCTAAAGCTCCAGAAGAGGCTCGCAGCCTCCGTGCTGCGATGCGGCAAGAAGAAGGTCTGGTTGGATCCCAATGA
      AATCAACGAGATCGCTAACACAAACTCGCGTCAGAACATTCGCAAGCTTATCAAGGATGGTCTGATCATCAAGAAGCCCG
      TCGTGGTCCACTCCCGTTACCGTGTGCGCAAAAACACCGAGGCCCGCCGCAAGGGACGTCACTGCGGATTCGGAAAGCGT
      AAGGGTACTGCGAACGCCCGCATGCCTACCAAGCTGCTGTGGATGCAGCGCCAGCGCGTTCTGCGCCGCCTGTTGAAGAA
      GTNCCGCGACAGCAAGAAGATTGACAGGCACCTGTACCACGACCTGTACATGAAGTGCAAGGGTNACGTGTTCAAGAACA
      AGCGCGTCCTCATGGAGTACNTCCACAAGAAGAAGCTGAGAAGCAGCGCAGCAAGATGCTGGCTGATCAGGCCGAGGCTC
      
      Library Information (1)
      Library: AF_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from adult brains. The strain used was not the iso-1 sequenced strain.

      Sample preparation

      Tissue was dessicated using the Stratagene HybriZAP system.

      Protocol

      Library constructed from dessicated tissue using the Stratagene HybriZAP system. Library was designed for protein expression, and constructed such that full-length cDNAs containing 5' untranslated regions are unlikely to be present.

      Comment

      GenBank AF083295-AF083548, AF171701-AF171760.

      Reported As
      Symbol Synonyms
      AF
      AF_cDNA
      References (1)
      Research paper (1)
      Posey et al., 2001, Genome Biol. 2(3): RESEARCH0008
      Survey of transcripts in the adult Drosophila brain. [FBrf0135825]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)