Open Close
General Information
Symbol
Dmel\AM02250
Species
D. melanogaster
Name
AM02250
FlyBase ID
FBcl0000937
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    AM_cDNA
    • cDNA sequences of D. melanogaster, iso-1 strain, mixed stages.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      5' Sequence
      Total bases
      240
      NCBI
      5' sequence dataSequence Downloader
      ATCGAAGTCGTTCTTTGCGGAAGCTCCCTCTCCCGACTTTNNNGNTTTCAGGGCTTCGCCAATTTTCTTTAATTTGGTTT
      CAGCTTTAATAGTNNACTTCCTCTTGGCCCGACCAGCATTACTAAAAACGGTTTNNTTACAATCTCCATCCGCATCTTCC
      GGATCTTCAGTGACTTGGGGCGCTATGCGCTTTGGACAAGTCCGTATATGGACCGGAAGTGATAGTTTGGTATAGGAGCG
      
      3' Sequence
      Total bases
      255
      NCBI
      3' sequence dataSequence Downloader
      GGACTTGTCCAAGCGCATAGCGCCCCAAGTCACTGAAGATCCGGAAGATGCGGATGGNNNTTGTAAAGAAACCGTTTTTA
      GTAATGCTGGTCGGGCCAAGAGGAAGTCTACTATTAAAGCTGAAACCAAATTAAAGAAAATTGGCGAAGCCCTGACAACA
      CAAAAGTCGGGAGAGGGAGCTTCCGCAAAGAACGACTTCGATGGCGATTCATCCGACTATGATTTGACCAAGGACAAGGA
      ATCTTCTGAGGAATA
      
      Library Information (1)
      Library: AM_cDNA
      Description

      RT-PCR products amplified with pairs of gene-specific primers from template RNA representing pooled Drosophila stages.

      Sample preparation

      0-24 hr embryo (derived from 4-6 hr subcollections), late third-instar larva (L3), mixed-stage pupa, and mixed-age adult were pooled.

      Protocol

      Poly(A)+ RNA was isolated. RT-PCR products were amplified from template RNA using pairs of gene-specific primers.

      Comment

      This collection of ESTs resulted from direct sequencing of RT-PCR products and were not cloned into a vector are therefore unavailable as reagents.

      Reported As
      Symbol Synonyms
      AM
      AM_cDNA
      References (1)
      Research paper (1)
      Yandell et al., 2005, Proc. Natl. Acad. Sci. U.S.A. 102(5): 1566--1571
      A computational and experimental approach to validating annotations and gene predictions in the Drosophila melanogaster genome. [FBrf0183655]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)