Open Close
General Information
Symbol
Dmel\ESG0112d.B21_E02
Species
D. melanogaster
Name
ESG0112d.B21_E02
FlyBase ID
FBcl0001713
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    ESG01_cDNA
    • ESG cDNA library of D. melanogaster, Oregon-R strain, salivary gland.
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      3' Sequence
      Total bases
      581
      NCBI
      3' sequence dataSequence Downloader
      TTGGTTATGCTTTCACTTTATTTGAATTTAACATTCCAGATATTATATAAAAAAATATATTGAAAATTTGTGTCACAGCC
      GATTTCAATACTGACTTACGTTGCTAAAATTCGATTAATTTACATATGTTCTTTATTTTATATGTACAACTACATTAGTT
      TGATAGTATTTCTTTAAAAATAAATGACATGGGACTTTACTAGCCGGTAATAAACTCAATGCCGTAAAATATCTCCACAT
      TGGCAGATAAGATAACTTAACTGAACAAATTTATAGATACCAAACAGACGCATAAAATTGACCAAATGAAGACGAAAACT
      AGCCAGGCACTGGACTTGAAAGGACTTTTAAAACGATTGACTACGCCGCTTCCCAGGAGCTCTGAGCATGTGCGTCTCGC
      AAAGTAAACCAAGAAAACGGGGATAATGTATTGAATGCCAGTGCCTGCGTAGGTGCCAGTAAATGCCACCAAACTGGATA
      AACTTTCAGTGAAATAGGTGATACAAAAAGGCGGAATTATGGCGAGCAAAGGGAAGCACAGGCGTAGGATAACGCTATAG
      GATTCATATTGCGACATGTCT
      
      Library Information (1)
      Library: ESG01_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from pupal salivary glands. The strain used was not the iso-1 sequenced strain.

      Sample preparation

      500 pairs of hand-dissected salivary glands were collected from mixed stage animals (16, 18, 20, 22, and 24 hrs after puparium formation at 18oC).

      Protocol

      Used to construct an oligo-dT-primed directional cDNA library (Vector: pSPORT1; Site_1: NotI; Site_2: Sal).

      Comment
      Reported As
      Symbol Synonyms
      ESG01_cDNA
      References (1)
      Research paper (1)
      Gorski et al., 2003, Curr. Biol. 13(4): 358--363
      A SAGE approach to discovery of genes involved in autophagic cell death. [FBrf0158811]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)