Open Close
General Information
Symbol
Dmel\UUGC0755
Species
D. melanogaster
Name
UUGC0755
FlyBase ID
FBcl0004263
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    BK_cDNA
    • BK cDNA library of D. melanogaster, iso-1 strain, embryo (8-12 hr).
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      467
      NCBI
      Partial sequence dataSequence Downloader
      TCGCTTTTTACTCGAACATGGGTATTAGCCGCGATAGTGCACACAAACGCCGGGCCACCGGAGGCAAGCGCAAGTCGCTC
      CGCAAGAAGCGCAAGTTCGAGTTGGGACGCCCCGCCGCCAACACCAAGCTTGGCTCCGGCCGCGTGCACAAGGTGCGCAC
      CCGTGGTGGAAACACCAAGCTCCGTGCTCTGCGCCTGGAAACCGGAAACTTCGCCTGGGCCTCCGAGGGAGTGGCGCGCA
      AGACCCGTATCGCCGATGTTGTGTACAACGCCTCCAACAACGAGCTGGTGCGAACCAAGACCTTGGTGAAGAACAGCATC
      GTGGTCATNGATGCCACGCCCTTCCGCCAGTGGTACGAGGCTCACTACGTGCTGCCCCTGGGACGCAAGCGTAACCCCAA
      GCACGCCCAGAAGGAGGACGAGAACGACGTGCTGACCAAGAAGCGCAGCGAAAAGGTTATGAAGAAG
      
      Library Information (1)
      Library: BK_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from stage 12-15 (8-12 hour) embryos. The strain used was not the iso-1 sequenced strain.

      Sample preparation

      Embryos at 8-12 hr AEL were collected.

      Protocol

      RNA was poly(A)+ selected. Directionally cloned into site flanked by SP6 and T7 polymerase promoters.

      Comment

      GenBank AI124249-AI124341.

      GenBank UUGC0001-UUGC1161.

      Reported As
      Symbol Synonyms
      BK_cDNA
      Drosophila 8-12 hr embryonic cDNA library
      NB_cDNA
      References (2)
      Research paper (2)
      Simin et al., 2002, Genome Res. 12(7): 1040--1047
      Profiling patterned transcripts in Drosophila embryos. [FBrf0151338]
      Brown and Kafatos, 1988, J. Mol. Biol. 203: 425--437
      Functional cDNA libraries from Drosophila embryos. [FBrf0048581]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)