Open Close
General Information
Symbol
Dmel\AT29209
Species
D. melanogaster
Name
AT29209
FlyBase ID
FBcl0027525
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
significant strain polymorphisms
FlyBase assessment
  • caution: significant strain polymorphism(s)
Library
AT_cDNA
  • AT cDNA library of D. melanogaster, Oregon-R strain, adult male, testis and seminal vesicle.
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    1,100
    NCBI
    Full Length sequence dataSequence Downloader
    GAACATTGTTCAGTCTACATCAATTTTGAATTGTGAATATTCGGTAAAGATTATTGTGATAAAAATGGAAACCCCAAGCG
    AGTTAACTGAGAAACAGAACCAAGACCAACCTACCCAGGACCAACCTACCTACCAGCCGCGACTGAACGAGGTGGCCCAA
    AAGTTTCTCGCCGATTTGGACGCGGAGCGCAAGCGATTGTCCGCGGAGTTTCCACTTTGCGCACTGCTAATCGACGAATC
    TGTGGACCGTGTCTACTCCACTGGTCGCATTCCCGGCAAGGAGCCCTTCGCAGACGTGTACCAGCAGAAGCCGATGAAGA
    TTATCCAAAAGGTCTTCGTGCCTGTTAATAAGTTTCCCAAGTTCAACTTCACTGGCAAGATCCTGGGGCCCAAGGGCAAC
    TCGCTGCGTCGCCTTCAGGAGGAGACCCACTGCAAGATTGTCATCAAGGGTCGCAACTCGATGCGCGATCGTAACAAAGA
    GGAGGAGCTGCGCAGCTCAGGCGACCCGAGATATGCCCATCTTCACAAGGATCTCTTTTTGGAGGTCAGCGCGGTGGCCC
    CTCCGGCGGAGTGCTATGCACGGATAGCCTACGCCCTGGCCGAGATCCGTAAGTACCTCATTCCAGACGATAACGACGAT
    GTTTGGCACGAGCAGCAGCGCGAGCTGATGGAAATGAATCCCAAGTCGGCCAAGAAAAGTAACGGACTCAATATGGCGCC
    CTACAGATCGAATTTCGACAAGGCGATTGGAGCCATCAGGAATAGGGCTCCCAAGTACAACAACCAGATTAGGCGAGTTA
    CGGAAAATCCGCGCGAAGTCGCCTATATGGAGGAGGTGGAATATGATTATGATGAACATCTTATGTTCTGCTCCCCAGTC
    GTCCGTCTATAGGCTATGAGTATAGCAAACCACCTACATCAATGACAGCGACAAACGCTACGCCATTTAAACGTGGATAT
    CCGTATCCAAGTATAAGCCCAATCCTGCTATGTGGACTGACTGAGTTTATACAATCCAAGGAAGCACATTAAAGAAAGCA
    GCATTTAAAATGATTCTTTTAATTAATAAACAAACATTTATAAAAAAAAAAAAAAAAAAA
    
    Library Information (1)
    Library: AT_cDNA
    Description

    Cloned cDNAs prepared from polyadenylated RNA isolated from adult male testes and seminal vesicles.

    Sample preparation

    Adult male testes and seminal vesicles were hand dissected from 0-3 day old non-isogenic Oregon-R males from a population cage.

    Protocol

    RNA was extracted from dissected testis and poly(A)+ selected twice (kindly provided by J. Pringle and M. Fuller). cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; cDNA size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned directly into EcoRI/XhoI-digested pOTB7 plasmid. cDNAs were transformed into DH5-alpha strain (Gibco/BRL), or for AT121nn clones, into DH5-alpha TonA.

    Comment
    Reported As
    Symbol Synonyms
    References (1)
    Research paper (1)
    Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
    The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
    External Crossreferences and Linkouts ( 2 )
    Crossreferences
    Fly-FISH - A database of Drosophila embryo and larvae mRNA localization patterns
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)