Open Close
General Information
Symbol
Dmel\AT02150
Species
D. melanogaster
Name
AT02150
FlyBase ID
FBcl0027599
Feature type
Computed gene(s)
 
Collection Status
DGC gold BDGP
Known Problems
none
FlyBase assessment
    Library
    AT_cDNA
    • AT cDNA library of D. melanogaster, Oregon-R strain, adult male, testis and seminal vesicle.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      2,867
      NCBI
      Full Length sequence dataSequence Downloader
      CTGTCTTTCAGTTTTTATTTAGTTATTTACGAAGCCACTAAATTACGATCCTGTAAAGTAGAAGATTTTCCGCCGTGCGA
      TATATTTTATTTATTTACCCCGCTCGGGCCACTGTTATGTAAGGAGAGTGTGTGCAGTGTGGTGTTTGTGTTCGACCAAA
      CTCGTTCGGCGGTGTCCGTGATGCAAGTGGGGGTCTACGAAAGTCAAGGTCGCCACCCCCTACACGCACGCCCACAGCCA
      TCCCCTGTTACTGCGCCCAGTTGCCATGAATTCGCGAAGGTCTAATCGGAAATCCAATTGTCGAATCGAGCAGTGAATCG
      AATCAGAAATGGATGACTTTGGCTCGACCGCATCCGACTTGGAAGAGGCCACCTGCCCCATGCAGGCCAATGCCACGTTC
      AGCATCGATTGGCGAGTGACCCTGCTGGACCACTGGTTGGATCTCTATCTTGGCTACATGAACCGCCTACACATGCTGCT
      ATCACTAGCCGGCAGGCTGCATCTTCTAAGCCGGCACATCCTGGGTACTCTCGGCCAGGATCCGATTTTTATGGGTGTGC
      TGCAGGGCAGCCTGTTAATGCTCTTCCTCTTCCTGATGCACCTGCTGCGGCTGTGGAGCTGTGGATACGCAGTTGAGCGG
      CCGCTGAACCCCACTCCGGACGTGGCAAAAGAGCTGAGCTGCGACTTCAACTTCGTCTCCGAGCAAGAGAAGCGAGCTGC
      CCAAGAAGCCGCGACGGAGGCTCTGCTAGAGGTTGAGGAGAAGAAGCGCCGCAAGCGGTTTACAAAGAAGCGCAACTGCG
      TGTCCGCCGGGCCGATCCTTATTGCCTTGCGCCATCAGTCTAAGCGACCAAAGCACCATCGTCACGCTGCTCTACCCTTT
      GAGCCCGTTACCCCCGGGGAAATAATCCTGGATACCTACTTGCCGCCGCGGGAACTGCCGCTCACGATAAGACTGCCTCA
      GTTGGCGGAGCCGGTCAAGGAAGAGGAAGTCGAATATATCGAGCTTAAATCGGAGCCCCGGGGGACCCTCAGTACGACCG
      ACGAAATTTACCCGGATTCGTCCGACAGCAGTCTTTACGTTTCAGACGAGGAGCAGGAAGACGCCTCTCAGTATTGCCGC
      GGTGGATACCATCCAGTAGTCATCGGAGACATATTTGACAACCGGTTTCGAGTGGTCAGAAAACTGGGCTGGGGCCATTT
      TTCCACTGTCTGGCTATGCCGGGATCTCAAAGATGAGAAGTACGTGGCCCTCAAGGTTGTTAAGAGTGCTCCGCATTACA
      TAGAGACGGCAGCGGACGAGATCCGGCTCCTGGAAGCTATCCGTGACGCAGACCCCATGGACGTTAAGCGGGAGAGGATC
      GTGCGACTGATGAACCACTTCACTGTGCGCGGTGTGAATGGAATGCACACCTGCCTGGTTTTCGAGGCCCTGGGCTGCAG
      CTTGTATAAGCTGATAGTGAAGAACAACTACCAGGGTCTGGCCATCGCTCAGGTGCGTAACATAATCCGCCAGGTTTTGG
      AGGGACTGGACTACCTGCACAGCAAGTGTAGCATCATACACACGGACATTAAGCCGGAGAACATCCTGCTGGTGATCGAT
      AATGCCGCCGCGATGAACCAGCAGATCGACGATGAGATCAACAGTCTGCGCGTGAAGGGTGTCGACTTCCCCGACTCGTA
      CATCAGCTCCATCGAGAAGCAGACCAAGTCGCGGGCCAAGTGGCCACTGATCGAGCCAAATGGATCGACCAACACCAACA
      CTAACACTAGCAATAGCACGGCGACCAATTCCAATTCGTCGACTCCGCTGGCCGCCGTGATCATGTCCACGCTGGACAAG
      GAGGACACCACGACAACCACCTCGTCCACGCTCAATTCCAACACCACATCATCGCTGGCCTCCAAGTACTCCAGTCTGTT
      GGGGGACAGCGAGTGCAACGGAGGCCTCGGCGGATCAGCGAACATAAACAACCGCTACCGAACGGAGAAGAAAATCACTG
      CCAAGAACCAGAGTCAGAGTAGCCAGAACAACACCTACACGATCCAGTCGCTCATTGACAACAGCAACGTTCGGGTAAAG
      ATCGCCGACTTGGGGAACGCCTGCTACGACTACCATCACTTTACTGAGGACATTCAGACTCGCCAGTATCGATCAATCGA
      GGTTCTTTTGGGAGCGCCGTACAATTATACCGCCGACATCTGGAGCACAGCCTGTTTGGCCTTCGAGCTGGCCACCGGCG
      ACTACCTGTTCGACCCTCACGCCGGAGAGTCTTACAGTCGGGACGAGGACCACTTGGCGCATATTGTGGAGCTGCTGGGC
      TCCATACCGCAGTCGGTGATCTTCCGCGGTAAGCACGGGCTGAAGTACTTCACCAGCTATGGTAGCCTGAGGAACATCAC
      CAAGCTGAAGCCCTGGAGTCTAATGAACGTGCTGGTGGAGAAGTACGACTGGGACCCGGTGGAGGCCAAGAAGTTCTCCG
      ACTTTCTGCTGCCCATGCTTGAGTACAATCCGGTTATACGGGCGTCGGCAGCGGAGTGCCTGCAGCATCCGTGGTTGGAG
      CAGGAGGAGTTCGTCTAAGAGGCTCATGGAGTGACTAGACAGCCAGAGAGACACAGGCATAGGCACAGCTTAACTTTTAT
      ATGCAAACAATTTGCCATAAAGAGGAGGTAGCAGGAAAATGGGATGAGGAGCTAGCATTAAAGGACTCGATCGAAGCACA
      CACATTTTACACTTACGAAATGCGGACGATGTGGGGGCGTTCCGCGTCGAATTTTTTAAGCTTTTTAATTTTTGTACTTG
      AGAGCTTTAAAATGTAATTACTAAAGAAGCGATTTTACTTTTAACGACAAAAACAAAAAAAAAAAAA
      
      Library Information (1)
      Library: AT_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from adult male testes and seminal vesicles.

      Sample preparation

      Adult male testes and seminal vesicles were hand dissected from 0-3 day old non-isogenic Oregon-R males from a population cage.

      Protocol

      RNA was extracted from dissected testis and poly(A)+ selected twice (kindly provided by J. Pringle and M. Fuller). cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; cDNA size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned directly into EcoRI/XhoI-digested pOTB7 plasmid. cDNAs were transformed into DH5-alpha strain (Gibco/BRL), or for AT121nn clones, into DH5-alpha TonA.

      Comment
      Reported As
      Symbol Synonyms
      References (1)
      Research paper (1)
      Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
      The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
      External Crossreferences and Linkouts ( 2 )
      Crossreferences
      Fly-FISH - A database of Drosophila embryo and larvae mRNA localization patterns
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)