Open Close
General Information
Symbol
Dmel\CK01792
Species
D. melanogaster
Name
CK01792
FlyBase ID
FBcl0058859
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
contains transposon sequences
FlyBase assessment
    Library
    CK_cDNA
    • CK cDNA library of D. melanogaster, Oregon-R strain, embryo (8-16hr), endoplasmic reticulum.
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      581
      NCBI
      5' sequence dataSequence Downloader
      CGAGGTCGACGGTATGGAGGCTTTGAACAATTAAGAGCATTGATTGATAGTGGCTCTCAAAGCACAATTATTTCAGAAGA
      GTCTGCACAGATTCTAAGATTGAAAAAATTTCGGTCTCATACTGAAATAAGTGGAGTATCTTCCACAGGAACGTGCATCT
      CCAAGCACAAAGCGGTTATTTCGATAAGAAATTCTCCGAAAAATTTAGAAATTGAAGCAATTATTCTCCCAAAACTTATG
      AAGGCACTTCCAGTCAACACGATTAATGTTGATCAGAAAAAATGGAAGAACTTTAAATTAGCCGACCCCGATTTTAATAA
      ACCGGGTCGCATTGATTTAATCATTGGAGCAGACGTNTATACTCACATTCTGCAAAATGGAGTTATAAAAATAGACGGTC
      TCCTTGGGCAAAAAACTGATTTCGGGTGGATAGTTTCTGGATGTAAAAAATCCAAAGGAAAAGAAACCATTGTAGCCACA
      ACAATAGAAATAAAAGANTTAGATCGCTACTGGGAAGTGGAAGAAGAAGAAAAAGATGATATCGAGTCTGAAATCTGTGA
      AAATAAATTTATCAAAACGAC
      
      Library Information (1)
      Library: CK_cDNA
      Description
      Cloned cDNAs prepared from polyadenylated RNA isolated from embryonic rough ER, to enrich for mRNAs encoding secreted and transmembrane proteins; also enriched for rare cDNAs.
      Sample preparation
      Rough endoplasmic reticulum (ER) was isolated from 8-16 hr AEL embryos from a non-isogenic Oregon R population cage to enrich for mRNA encoding secreted and membrane-associated proteins.
      Protocol
      RNA from isolated endoplasmic reticulum as poly(A)+ selected twice. Note that only 70% of the cDNAs appear to be from secreted or membrane-associated proteins; the rest are cytoplasmic or nuclear proteins. Oligo(dT) primed with PstI site at end of primer for first strand synthesis; normalized to genomic DNA beads; KS complementary sequence put at 5' end of each cDNA HindIII/XmnI adapter on 5' ends of clones; cDNA directionally cloned into HindIII/PstI-digested pBluescript SK(+) vector.
      Comment
      Reported As
      Symbol Synonyms
      References (1)
      Research paper (1)
      Kopczynski et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95(17): 9973--9978
      A high throughput screen to identify secreted and transmembrane proteins involved in Drosophila embryogenesis. [FBrf0104467]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)