Open Close
General Information
Symbol
Dmel\EC28073
Species
D. melanogaster
Name
EC28073
FlyBase ID
FBcl0069655
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    EC_cDNA
    • Exelexis EC cDNA library of bacterially challenged D. melanogaster, iso-1 strain, larva, fat body.
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      555
      NCBI
      5' sequence dataSequence Downloader
      CCCAAAGGTGGTACATCTTCCCCACCGTTAACCCAGATGGATATCAGTATACCTTCAAGGGCGATCGCATGTGGCGCAAA
      AATCGTGCTCTCTTTGGCATTTGCCGTGGTGTGGATCTCAACCGGAACTTTCCATTCCACTGGAACGTCACCGGAGCCAG
      TGGAGATCCCTGCCGCTATGACTACTCGGGACCATCGGCTGCCAGTGAGGTGGAAACCCAACGGATGATCGAGTTCATAA
      GGCATCGCGTCGAAAGCGAGCGCATACGTACCTTTATATCGCTGCACAGCTACTCCCAGATGATCATGTTTCCCTACGGA
      CACAGTGCCGAACGTGTGGACAACTATCACGATCTGACTGATATTGGTAAGCTGGCGGCCAAGAAGATAAAGGATGTAAG
      CGGCAGGATCTACAAGAGTGGCAGCATCTACGAGACCATCTATCCCTCATCAGGTGGCTCAAAGGATTGGGCACATGGTC
      AGCTCAAGATACCGATTACCTTCTCCTACGAACTGCGTGGACCCGCTGACAGCGAGGATCTGTTCATTTTGTCCG
      
      Library Information (1)
      Library: EC_cDNA
      Description
      Cloned cDNAs prepared from polyadenylated RNA isolated from fat bodies of immunologically challenged third instar larvae. The strain used was not the iso-1 sequenced strain.
      Sample preparation
      The fat body was dissected from third instar larva challenged with gram positive and gram negative bacteria.
      Protocol
      RNA was isolated from fat body from 3rd instar larva challenged with gram+/- bacteria; cDNA was oligo(dT) primed.
      Comment
      The Exelixis ESTs were submitted to GenBank by the BDGP on behalf of Exelixis.
      Reported As
      Symbol Synonyms
      EC
      EC_cDNA
      References (2)
      Personal communication to FlyBase (1)
      Carlson, 2005.9.12, FlyTag EST project.
      FlyTag EST project. [FBrf0188689]
      Unpublished (1)
      Chen et al., 2005, FlyTag ML01 EST Project.
      FlyTag ML01 EST Project. [FBrf0184942]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)