Open Close
General Information
Symbol
Dmel\GH04104
Species
D. melanogaster
Name
GH04104
FlyBase ID
FBcl0130021
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
chimeric clone
FlyBase assessment
  • Caution: This cDNA clone replaced by FI15285
Library
GH_cDNA
  • GH cDNA library of D. melanogaster, iso-1 strain, adult head.
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    5' Sequence
    Total bases
    629
    NCBI
    5' sequence dataSequence Downloader
    TTGAAAAAAAAAACAAACAAAATCAGTTCATTTACCAAACTATGGACAAAATATTGCATTTGATGACAAAACATTAAGTA
    TATTTACCCAGGCGAGCAATGAGCACACACCAATGCCCCAAATATTCGAGTGACGACGACGTCGAGATATTGAAAGATGC
    AATGGAGGAGCTGCAAAAATAAGCTTGAAAAGATCCTAAAAAAACCAAAATGACTTTTGCAAGGTGGAACTGGACTATTT
    TCCCGTGTATGATCCCGACGAGCTTTCCAATCTGGATGCGAATCTTTCAAAGCCGGGCAATAGCACAAAACGCTCATATT
    ATTCACCGCATCCTGAGGCCAGAAGGTCGAATAGAACCGCTGAAAAACAATTTGTCAAAGATGTTCAACTACGATATTCT
    CATGGCTTACAACTGCGACGGTGAGCTCTCAGTCAGCAGTCAGTCATCTCATACAAATATATTAACGAAACTATTTTTGG
    GGTCCTGAAAACAGACATTAAGGCGACGATATCATAAAAGAAACCACGACTTACGGAGGAGGATTAGACAGAACCAAAAG
    TGTGAGCCAGATTCTGATTGGGATTAGCCGATAAGCTGGTATCAATGCTGCATTTCGTTTATTTGCAAC
    
    3' Sequence
    Total bases
    690
    NCBI
    3' sequence dataSequence Downloader
    GGATTTCTCAATTTTCATATATTTTTCCATATTTTTCATGGAAAGTTTTATTATCGTATTAGGAGAAGAATGTGAGTGTG
    CATCGAATCAGCCTTATTGCCTTGCGTGAATATCTTCTGGTTCGCAGAACACTATGAACTAATGTTATGTTTTTTTTTTT
    TTTTGGGAGTATCACTTCTTAGATGCCGGAGTCCCAGTGCTTGGTCCACTGGATGGCCTCCAGGGTGCCCAAGTCCAGTT
    TCCAGATGGCTCCGTTCTGGTTCAGCTCGATAGCCTTGACGAAGTTCTCGGCGCAGGCCAACGAGGGCTGGGTGGGATGA
    GCCAGGAGCTTCTCGGCAACCTGAGGCTCAACATCCAACCAGGAGTTGAACGTGTGCACCAGGGTGGTGCGGGTGATGCC
    GGGGTTCACAGTGTAAGCCGTCACGCCGGTAATGGGGGCCAGTTTCGCCAGGGAGCTGGTGAAGTTGACCACGGCGGCCT
    TGGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTGCATTAAATACATTTTTTTCTTTATTGCGTCAGTTAATTTACAATA
    AGGTTTAAAAAATGACTAATTAGGTGATATCAGAACTTAAAAATCGAATAAATAAATAAATCAGTGATTGCTTTGCAATG
    GAAACAAAGTATGGTAATAATAACATTATTAGAACACTTAAAAGCACATG
    
    Library Information (1)
    Library: GH_cDNA
    Description

    Cloned cDNAs prepared from polyadenylated RNA isolated from adult heads.

    Sample preparation

    Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.

    Protocol

    RNA from adult heads was poly(A)+ selected once. Oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.

    Comment

    The GH library is separate from the HL library. Since many of the HL clones were not full length and others lacked inserts, a new adult head library was made.

    Reported As
    Symbol Synonyms
    References (1)
    Review (1)
    Rubin et al., 2000, Science 287(5461): 2222--2224
    A Drosophila complementary DNA resource. [FBrf0127297]
    External Crossreferences and Linkouts ( 2 )
    Crossreferences
    Fly-FISH - A database of Drosophila embryo and larvae mRNA localization patterns
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)