Open Close
General Information
Symbol
Dmel\GH20192
Species
D. melanogaster
Name
GH20192
FlyBase ID
FBcl0133891
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
  • chimeric clone
Library
GH_cDNA
  • GH cDNA library of D. melanogaster, iso-1 strain, adult head.
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    2,504
    NCBI
    Full Length sequence dataSequence Downloader
    AAAGCGGTAAAGTAGCCAACTGCAGTTAGTTATCCTTTTGCGCCTCCCGAAATATTCGATGAATCTGTCAAGCCTTTTTC
    TTTTGGCCCTCGTGGCATCAGTCGCTATCGGCGCTGGATCTGCCCACAGAATAAACAGGCCCGAACAGGAGCCCCCAAAG
    GAGTCGTGCCAGGTTACCACCACAAGCCCGCCGTGTGAGACGACCACTCCACCATGTGCTAGGGAAACCACGACAACAAC
    GTGTTCCCCTACTACCACAACAACCACAACGTGTTCCCCAACTACCACGACTACAACAACAACTACCACAACAACAACAA
    CCACCACAACTACGACAACAACAACTACCACCACAACTACGACAACAACGACATGTTCCCCGACAACAACCACCACCACA
    ACAACAACAACGACGACGACGACAACAACTACTACTACGACAACCACGACGACGACAACAACAACCACCACCACGACGAC
    AACGTGTACTCCAACGACGACCACCACCACAACAACTACTACTACGACAACCACGACAACAACAACCACCACGACGACAA
    CAACAACCACGACGACAACAACAACAACCACAACAACGACGACGACAACAACAACAGCATCCTGCGAAACAACAACGACT
    GAGTCTCCAGAACAACCCCCCTGTGAGCCCAACGAGCCGTCAACTCCTACTCCAGCCCCACCCTCTCCCTCTGAACCCAA
    CGACCCGTTAACGCCCACTCCATCACCACCCTCTCCCTGTGAGCCCAACGAGCCGTCAACTCCCACTCCATCCCCACCCT
    CCCCCTCTGAGCCCAACGAGCCATCAACTCCTTCTCCAGCCCCACCTTCACCATGTGAGCCTAACGAAACGACAACTCCG
    CCACCTTCACCTTGTGAGACGACCACCACTACGACAACAACCACAACAACGACGACCACCACGACCTCGTGCCGAATTCG
    GCACGAGCTTGAGCGGCGCACAACTCAACGGTATCAAGTGAAATCCGCGAATCAAAGATGATCATTAAAGCCCTAGCGAT
    CGTTTCGCTGTGCCTGGCCAGCATTCAGGCCTCCAAGGTGGGAGCTCCGCAGTTGCCCAAGAAGCACCTGGTCTGCTACT
    ACGATTCCGCCAGTTTCGTCAAGGAAGGTCTGGGCAAGCTGGTAATCGATGAACTGGAACCGGCTCTGCAATTCTGCGAC
    TATCTGGTCTACGGCTATGCCGGAATCGAGCGCGATTCGCACAAGGCGGTGAGTCTGAACCAGCAGTTGGATTTGGATTT
    GGGCAAGGGACTTTACCGCACGGTGACCCGCTTGAAGCGCAAGTATCCCAATGTCAAGATCCTGCTGAGTGTGGGTGGTG
    ACAAGGACATTGAGCTGGACAAGGATGCCAAGGAGCTGCCCAACAAGTATCTCGAACTGCTCGAGAGCCCCACAGGTCGC
    ACTCGTTTCGTGAATACCGTCTACTCGCTGGTAAAGACCTACGGATTCGATGGCTTGGATGTCGCCTGGCAGTTCCCCAA
    GAATAAGCCGAAGAAGGTGCACAGTGGAATTGGCAGCCTGTGGAAGGGCTTCAAGAAGGTCTTCTCCGGCGACTCGATCG
    TCGATGAGAAGTCCGAGGAGCACAAGGAGCAGTTCACCGCTCTACTCCGTGATGTTAAGAACGCCTTCCGTCCGGACAAC
    CTGCTGCTCTCCACCACTGTTCTGCCCAATGTGAACTCATCCCTGTTCTACGACATTCCCGCTGTGGTCAACTATTTAGA
    CTTTGTGAATCTGGGTACCTTCGATTTCTTTACACCCCAGCGTAATCCCGAAGTTGCCGACTATGCCGCACCCATTTATG
    AACTGAGCGAACGCAATCCCGAGTTCAATGTGGCTGCTCAGGTGAAGTACTGGTTGCGCAACAACTGTCCCGCCAGCAAG
    ATCAATGTGGGCGTGGCCACCTACGGTCGCCCATGGAAACTGACCGATGACTCTGGCGACACTGGTGTTCCGCCGGTGAA
    GGACGTCAAGGACGAGGCTCCAGTGGGTGGTAACACTCAGGTGCCTGGCATTTACAGCTGGCCGGAGGTCTGCGCCCTGC
    TGCCCAACCAGAACAACGCCTATTTGAAGGGCGCCAATGCTCCGCTGATCAAGGTTCAGGATCCTGCCAAGCGTTTCGGC
    TCTTATGCCTACAGGGCAGCCGATAAAAAGGGCGACAATGGCATCTGGGTGAGCTTCGAGGATCCCGATACTGCCGCCGA
    TAAGGCCGGCTATGTGCGCACTGAAAATCTGGGTGGAGTCGCGCTATTCGACCTGTCCTACGATGATTTCCGAGGACTCT
    GCACCAACGAGAAGTACCCCATCCTGAGGGCCATTAAGTATCGTCTGACCAACTAAAGTGGGAGTCCAATTTGATTTATG
    TATAGCTGACCATGTGAAGAAAATGCTTGATCAAGAAATATATTTGTCCCATTTATATTTGTAATGTCATAAAGTGCCTC
    AGAAAAAAAAAAAAAAAAAAAAAA
    
    Library Information (1)
    Library: GH_cDNA
    Description

    Cloned cDNAs prepared from polyadenylated RNA isolated from adult heads.

    Sample preparation

    Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.

    Protocol

    RNA from adult heads was poly(A)+ selected once. Oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.

    Comment

    The GH library is separate from the HL library. Since many of the HL clones were not full length and others lacked inserts, a new adult head library was made.

    Reported As
    Symbol Synonyms
    References (1)
    Review (1)
    Rubin et al., 2000, Science 287(5461): 2222--2224
    A Drosophila complementary DNA resource. [FBrf0127297]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)