Open Close
General Information
Symbol
Dmel\GM05045
Species
D. melanogaster
Name
GM05045
FlyBase ID
FBcl0141998
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
contains transposon sequences
FlyBase assessment
    Library
    GM_pBS_cDNA
    • GM cDNA library of D. melanogaster, Oregon-R strain, adult female, ovary, pBS vector.
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      416
      NCBI
      5' sequence dataSequence Downloader
      TTATCCCACACGATTTTCATTTAGTAGATAAAAACTTTCCAATACCGTGTGATGGAATAATCGGAATAGATTTCATAAAA
      AAATATAATTGCCAAATCGATTTAAACCAAGAAGAAGATTGGTTTATAATTAGACCAAACAATTTGAAATTTCCAATTAT
      ATTCCCATAGCATACAGCTCTGGTATTAACACAACGTTATTACCAGCAAGATCCCAAGTTGTCCGAAGATTAATAGTATC
      ATCAAAAGATGATAACATTTTAATTCCAAACCAGGAAATTCAAACTGGTATTTATGTTGCAAATACAATCGCAACATCAA
      GTAATACATTTGTCCGAATTTTAAATACAACCGATTCCGACCAATTAGTCAATATGGACACTCTAAAATATGAGCCACTT
      TCGAACTACAATGTAG
      
      Library Information (1)
      Library: GM_pBS_cDNA
      Description
      Cloned cDNAs prepared from polyadenylated RNA isolated from stage S1-S6 ovaries.
      Sample preparation
      Ovaries at stage 1-6 of oogenesis were collected from a non-isogenic Oregon R strain P2 population cage.
      Protocol
      RNA from ovaries was poly(A)+ selected once (provided by A. Spradling). cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones GM01001-GM11496, cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.
      Comment
      Reported As
      Symbol Synonyms
      References (1)
      Review (1)
      Rubin et al., 2000, Science 287(5461): 2222--2224
      A Drosophila complementary DNA resource. [FBrf0127297]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)