Open Close
General Information
Symbol
Dmel\GM14490
Species
D. melanogaster
Name
GM14490
FlyBase ID
FBcl0147493
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
  • Caution: This cDNA clone replaced by FI19812
Library
GM_pOT2_cDNA
  • GM cDNA library of D. melanogaster, Oregon-R strain, adult female, ovary, pOT2 vector.
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    1,444
    NCBI
    Full Length sequence dataSequence Downloader
    ATCCAGGAAGATGAACTACAATCCAAATCCGGGTATGCGGAACCGTAAGTGGGAGAACTCCTCAGCTGCCGGTCGCCCAA
    GGCCGCCGAAGCGTGTGAGTGATGTTAACGCCATGGGACCCTCGGCTCCGATGATGGGCGGTGGCGCCACCTTCATGGCC
    CCGCCCACCGGCCCCGGAATACTAGATCCCAATATGTACGGAGCACCTGCTCCGGCCCCGGTCAACAGCTATGGCTTCGA
    CCCCAATCTCGGCCAGCCCTCGCAGCACATTCAGCAGCCACCACAACAGCAGCCCGGATACGGATATGGAGCACCACCTC
    CCCAACAGGCGGCTGGGCCACCCACCTACGGAATAGGAGCACCTCAGCCTGTAGCTCCACCCACTGGACAGTACCCACAG
    TTCGCCATGTTCCAGCAGCCCATCGTGCAAGACATGGCCATGCAGTACGGTCAGAAACTAGCGGATCAGGGCAAGCAGAT
    CATGGAGAATCAGTTCGAGAAGTGGGTGCCCGTAGCCAAGCTCAAGTACTACTTCGCAGTGGACAACGCCTACGTGGGCA
    GGAAGTTGCGCCTTCTGTTTTTCCCCTATATGCATAAGGATTGGTCCCTGCGCTACGACCAAGAGCACCCAGTGCAACCA
    CGATATGATGTTAATGCGCCAGATCTCTATCTGCCCACCATGGGCTACATCACATACGTGATCGTAGCGGGTTTGCTTCT
    GGGCATGCAGAAGCGATTTTCGCCGGAGCAGCTCGGCATTCAGGCCTCCAGCGCCATGGCATATAGCATTTTCGAATTGG
    TCATTTACTCCCTAGCCCTGTACGTAATGAATGTGAAGACGAGCCTGAAAACGCTTGATCTGCTGGCATTCACTGGTTAT
    AAGTACGTTAATATAGTTGTCTGCCTGATGGTTAGCACGCTGTTCTTTAAGTCTGGATATTATATAGCACTGGCGTATAC
    CAGTTTCTCCTTCGGTTTCTTCATGCTCCGCACGTTGCGGACGAAACTGCTGCAGGACAACTCCCCGGCTGCGCCCAGTG
    GAGCCATCAACTACGATCCGTATGGCAATCCACAGCAATTTGACTATAGCGGCGGGAAAAAGCGCAAACTCTACTTCCTG
    TTCATGATCGTCGCGGGACAGGCGCTGTTTGCCTTCCTGCTCTCCAAGCACCTGTATCTGCCCGAGGCGGAGGTGCTGAC
    GGCGCCCAAGACCTTCTAACCCACAGGCTTGATAGGTTAATTTGCATACTCCTTGAGTTAATCGTGGCCAGGGTGGCCAC
    TCACATGTCGAACGATTCCACAGAGCCTAGGCATTGTGTTTTCCAGCATGAAGTTTGTGGTTGTCTCATTTGAGACTCGA
    GCGAGAGAAGCATATTTTTGTTAGAAACAAACACATTTTATAAATAAATACCAGCTATGAAAACTAAAAAAAAAAAAAAA
    AAAA
    
    Library Information (1)
    Library: GM_pOT2_cDNA
    Description

    Cloned cDNAs prepared from polyadenylated RNA isolated from stage S1-S6 ovaries.

    Sample preparation

    Ovaries at stage 1-6 of oogenesis were collected from a non-isogenic Oregon R strain P2 population cage.

    Protocol

    RNA from ovaries was poly(A)+ selected once (provided by A. Spradling). cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones GM12101 and higher, cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid.

    Comment
    Reported As
    Symbol Synonyms
    GM_pOT2_cDNA
    References (1)
    Review (1)
    Rubin et al., 2000, Science 287(5461): 2222--2224
    A Drosophila complementary DNA resource. [FBrf0127297]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)