Open Close
General Information
Symbol
Dmel\LD18215
Species
D. melanogaster
Name
LD18215
FlyBase ID
FBcl0161955
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
  • Caution: This cDNA clone replaced by FI04003
Library
LD_pBS_cDNA
  • LD cDNA library of D. melanogaster, iso-1 strain, embryo (0-22 hr), pBS vector.
Strain
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    3,852
    NCBI
    Full Length sequence dataSequence Downloader
    TCAAAATGAGGTTTTTTTCCGGCGTTTTCGTAATTTTATTAATTAAACTTTTCCAAAATGCCAACGCCGGCGAGGTGGAA
    GTCGTCGGCTGCGGTGGATTCATCAAGAGCCACGCCGAGATTGACTTTTCCCGGGTGGAGATCAAACTGCTGACCAAGCA
    GGGATCCCTGAAGGACAAGACGGACTGCTCACCCTCTAACGGATATTACTTCCTGCCGATTTATGATAAGGGCGACTACC
    TGCTCAGCATTTCTCCGCCACCGGGTTGGAGCTTCGAGCCGGAACAGGTGGAGTTGAACTTCGATGGCAAGACCGACGTT
    TGCAGCCAGGGTCGCGATGTGAACTTTGTGTTCAAGGGCTTTGGCATCACCGGTCAGGTGGCTCTCGCCGCCGGCGGCGG
    TGCCCGAGGCGTAGACGTGGAGCTGCGATCTGAACAGGGCGAAGTCCGGCGCACAAAGAGCGATGCGAACGGAGTGTTCT
    CATTTACGCCCATTATTCCCGGTAACTACGTGGTCAAGGCATCGCACGCAAGGTGGCACTTCTCCAAGGCGGAGCACAAG
    GTGGTTGTGGTTAGCGGCAACACCGAGCTGCCGGCGAACTCTTTGGTAGTCTCAGGATTCGATGTGGTTGGTCGCTTTGA
    TTCCAGCTCGCCGCTTCCTGGAAATCTGGGTGTGGCTCTTTACAAGAAGAAAGGACAATCTTTAGTGCCAAAATGTGAGA
    CATCCTCCCCAGCGCCGCCTAATAGTGTTAATAGCGCATACGAATCCGCATCCTCCTGCTTCTCCCAGTTGGACAAATCG
    GGAGAGTATATTTTCAAGAACGTGCCATCTGGAAAGTACCTGTTGCAAGCTATCAACCTAGATTCCAAGTTGAAGCTGCA
    CTTGAGTCCTGAGCTGTTGGAACTAGAAGTGGGCAAGGATACGCTGCAAATCAAGGACGAATTTAAGATCACAGGCTTCA
    CCGTTTCTGGTCGAGTTCTGACCTCCGCCGGAGGGGAACCGCTAAAGTCAGCTGTTATTAAAGTTAATGGAAAGAAGGTG
    GCCGAGACTGATGCCCAGGGCTCATATACGTTGGAAAACTTAAAGGCAGGCACAGTCAACATCGAAGTGGAGTCCTCCCA
    GCTGCAGTTTTCTCCCCTGCAAGTCAAGGCTCAGATCAACACAGCTTCCCTGCCCACCATTGTGCCATCTGCTTATGAGG
    TGTGCGGAAAAGTAGTGTCGCCGAAATCACATAATGTGGGACTTACCAAGATCGGCTCCACCTTCCACTCGTCGGCTTCC
    ACAAACGCGGAGACCGGAAACTGGTGCGCCTTTCTTCCTGTTGGCAAATATACCATTGAAGTGCTGACGACGGATGCTGA
    CAAGGCCGCTGGAGTGCAGTTCTTCCCTGTTCAGCAGCAGACGGAGGTTCGCGATGCACCCGTCAATGGCATAACCTTTT
    CCCAGCTGCGCGCAAAGATTCGCGGCGAACTGCAGTGTCTGCCTGATGCTACCGCCACCTGCACTTCCGCTGAGGTCACC
    CTGCAGGCCTTAGATGCCACCGGTCAGCCCACGGAGAACAAGTGGAAGGCCAGGGCACATCGTGGCAAATACGTTTTTAA
    GGATATGCTTCCCGGTCCCTATGAACTTACAATTCCCCAGGGAAATCTCTGCTACGAATCGACCCGCGTGTTCCTGAACG
    TTGCTTCTGCTGAAGAAGATGCTCCCCCATTTGTACACAAGGGCTACGAGGTGTCCATTATCTCTAGCCATCGGGCACTG
    ATGAAATACACCCACGTCACTGGACCTTCTGAGCCAAAGGCACCTACTGAATCGCTGAAGATTGCGTCAGGAGTGAATAC
    CTTTTGCGTGAAGAAGTATGGTAGCTACGATTTTAAGCTAGAGGGCTGCCACACGTATGATGAATCGTTACCCAGCAAAT
    TCATTACACCAGAACCAGATCAGTTGCAAACACTAATCATTAATGCAGTGGCCCACAAGACTGGCGTTCGAGTTCTGTCT
    ACCGAACCCACTGCTGATTCCATTAAGCTTGTGCTCGAATCTGAATCGCTGGGTCAGGAGGTGATCACACCTGTTGCTGA
    GTCCCACAAAGTAGATGGCAAGTTCGCCTACCGCTATGACACGTATTTGAAACCGGAACAGGTACTTCGTATTACACCAG
    TGAGCGATGTCCTACTGTTTGCGCCCCAGCAACACGAAATTGTTGGCAGCAGCGATTGTGTAGATATTGCCTTCAACTTT
    GTGGCTACCAAAGGATTGATTCTACGCGGAAAGGTTGTTCCTGCCATTAAGGATGCAAAGATCACACTGTCTTTCCCTGA
    TCAGCCTGAGTTGGAGAGCCTGGAAGTACTCACGTCCGTCACCGGAGAATTTAAGTTTGGCCCAATTGAAGAGTCTCTTG
    CTTTTGACCTTAAGGCCGAAAAGGAGTCGTACGTTTTCAGCGACTACAACCGCCAGACAGCTTCGTTTAGTGCTCACAAA
    CTCTGCGAGATTTCGGTGGTTGTCAAGGATGAGGCTGGTCAGACATTGGGCGGAGTCCTCCTTTCGCTGAGCGGTGGGGA
    GAGCTATCGCAAGAACCTCGTCACCGGCGATAATGGAGCTATTAACTTCCACTCCCTTTCGCCATCGCAGTACTACCTGC
    GACCCATGATGAAGGAGTACAAATTCGAGCCCAACTCAAAAATGATTGACATTAAGGATGGCGAGACTGTTTCTGTTACC
    CTTGTTGGCAAGCGTTTCGCTTACTCGATCTTTGGCACAGTGAGCTCCCTAAACGGCGATCCCTTCGCCGGCGTTAATGT
    TCAGGCCACAGCCGATAATTCGTGCCCCCAGCAGCCGGAGGAGGCCACCAGCGAGGCGAATGGACAGTATCGCATCCGAG
    GTTTGCAACCTGGCTGTAGTTACTCCGTTCGCGTCGTTCCCGACAAGGAAATCGTAGAGCGATCTATTCCTGCCCAGCAC
    ACGGTTAAGGTGGCCAACGAGGATGTGCGTGACATAAATCTGGTGGCTATTAGCCCCTTGAAGATTGTAGACATCACTGC
    TAGGGTGACGGCCACACTCAATGAACACTACAAGACGCTGCGCATTGTGATGTACCGCAAAGGAAACTCGGATTCTCCTG
    TGTTCTCGCAACGTGTGGGCACCCCGGTGAATCCTAAAGCAAGACTGAACCCTGGTATCACCGTCTTCTTCCCTCGCATT
    CCTCTGGACGGCAAGAGCTACGTGGTAGAACTGCAGTCCACCCTCTCCGATAAAACATATACCTACAAGCTGCCATCGAC
    TACGTTTGTGGCTGACAGGGGTTCCGTGTTCGTTGAGTTGGAGTTCAAGCCGGAGGTGCGCGCCGCCGAAGCGGATCTCA
    ACCAGAATTCGATTTCGGCTCTGGTGCTCATCGCCTTGGTGGCCATTGCCTTCTTTAAGCAGGATCTGGCCACCAGTTTC
    CTCAGCTTCGTGTGGAGCAAGCTTAACGATGTCGCCGCCGATCTCGCCCAGCGACAGAAAAGCAAGACACAGGTGCGCAA
    GAACGAGCCAATCAACCAGCGCGAGATTGAACAGATGGCCGACCAGATAAATGCCATCAAGAAGAAAAAGACCAAGAAGA
    TTTAGTTCCGACTGATAGTCGCATTAGTTGTTCAATTTAGTCACATTTCGAGGTATTCGCGGTAGGTATTCATTTGGTTT
    TTGTTTCTGTGAGATTTTGTTTAACCCTTTTTAATTTGAATTGCATTTAAGAAAACGTTGTAATTTTTCACTTTCCATAC
    ATAGATTGAGGCAAGTTTATTTGTGTTCGTTATCCACTCTTATAGCTAAAATAAATAAATACAATTAAATAGATAAAAAA
    AAAAAAAAAAAA
    
    Library Information (1)
    Library: LD_pBS_cDNA
    Description

    Cloned cDNAs prepared from polyadenylated RNA isolated from 0-22-hour embryos.

    Sample preparation

    Embryos at 0-22 hr AEL were collected from an isogenic y; cn bw sp (iso-1) strain.

    Protocol

    RNA was poly(A)+ selected twice. cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones LD01001-LD21096, cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.

    Comment
    Reported As
    Symbol Synonyms
    References (1)
    Review (1)
    Rubin et al., 2000, Science 287(5461): 2222--2224
    A Drosophila complementary DNA resource. [FBrf0127297]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)