Open Close
General Information
Symbol
Dmel\LD16457
Species
D. melanogaster
Name
LD16457
FlyBase ID
FBcl0162073
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
    Library
    LD_pBS_cDNA
    • LD cDNA library of D. melanogaster, iso-1 strain, embryo (0-22 hr), pBS vector.
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      3' Sequence
      Total bases
      634
      NCBI
      3' sequence dataSequence Downloader
      AAAACAAAAGTGCAGGCCGTCTAAATTGATGGCGAAGTTTCGTGTGCCGCCTGCATTTCATTTATAAATATATTTTCGGC
      CTTAATTCTGTGCTTCCTGTGAATTAACGAGGAAACTGAAGAGTGCGCGAGCGAGACAGCCGATCACAAATCAACAAGTG
      GAAACGAAGAAACTTTCTTCGCAAAAGCCGGCTGATCGCAACAACAAGAAGAAAAGAGAGCGATTCTCTGCGACTGGAAC
      CATAACATTTACATCGACCCTGGAATTTCTTCACTTTTCGTCCAACATGGCTCCCAACGCCTGGCTGATTGAGTTTTCCG
      TGGCGGCTGTTGATCAGGAAAGCCGCCTGGATGCGTTTCTGCTTTGATCGGCTGTGCTTCGCAACCAAGCGGCCAGCCCA
      AAACTCCAACAGCAATGCACCACACAGCAGCACCACAGTAGATGCACCACCACGTCCAGCGGATGTAGATGTAGCCACTG
      TACCAGTAGCAACACCAGCACCACCACCACAACAGCCAGTTAGTAATCTGTTCTATGCCGACTACCAGAAGCTGCAGCCG
      GCGATAATCGATCGGGACTGGGAGCGGGACAGAGATACAGATACAGATACCAGGAGCCAGGCCAAGCCACCGGA
      
      5' Sequence
      Total bases
      541
      NCBI
      5' sequence dataSequence Downloader
      TTTTTTTATCGGATCAATTTGTTTATTCAATTTCTAGCTGATTTACTTAAAAAAGACAATTAAAAGGGCATGTTATTCGT
      AAATATAATAGACATGATCGCTAAGACTAATGAAAGACAGTAGAGAGGCCACATAGAATTTTAAGAAATGTGTGACGGAA
      GATCTTGGTCAAATGTTGCTTTCAAATGTTCTCTTACAGACTATAAGGCAACCCGATTTGTATGCTTTAACAATGATGTG
      TAATAATTATGTTAAAAATATTTAATAGATACAAATAGCTGAATTTATACAATGCACATGGCTAACAGAGCTCTGAAACA
      GAGTCACAGACCTACTTACAATTTACATCAATTCCAAGCGAACTAGACACATATATCCTCATTATAAAATAATAGTTATA
      AACTCGTTAATAAATTCATTGCGTTGCACATCATGGTTATAACATCACGGAGACGTATCTATAAATCTCAAATGGAGCTA
      CGACGATGGATGATTGTGCTTTTGTGTCGGCCCTTGACCTTGCGACTGCTACGTTTCTTTG
      
      Library Information (1)
      Library: LD_pBS_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from 0-22-hour embryos.

      Sample preparation

      Embryos at 0-22 hr AEL were collected from an isogenic y; cn bw sp (iso-1) strain.

      Protocol

      RNA was poly(A)+ selected twice. cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones LD01001-LD21096, cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.

      Comment
      Reported As
      Symbol Synonyms
      References (1)
      Review (1)
      Rubin et al., 2000, Science 287(5461): 2222--2224
      A Drosophila complementary DNA resource. [FBrf0127297]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)