Open Close
General Information
Symbol
Dmel\LP07188
Species
D. melanogaster
Name
LP07188
FlyBase ID
FBcl0189572
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
chimeric clone
FlyBase assessment
    Library
    LP_cDNA
    • LP cDNA library of D. melanogaster, iso-1 strain, larva and pupa.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      663
      NCBI
      5' sequence dataSequence Downloader
      TCATTCTAATTTTTTTTTATCGAAATACCAAACCCAATATCTCGTAATAATAAATTCGTTTCATTTCGCTTTCAGCTGCG
      TAAAGAACAACGAAAAGCATACAAGAAAAATAGCGAGAACCGGAACGGATTCAACGCCAACGGCATGCAAAGCGTGTGAT
      TGCAGATAATATGATGGAAGCATTGGATCAGCAACAAGCCAAGCTAACGTCTAACCGAGATGATGGAGAAGCGGGAAGAG
      GATCGGAAACGGGATCGGAAGAGGGCACCGGGGCAGGTGCAGCTGCTGGCGAAGAAGACGACATCGAAGAACTTCATTAT
      GTGCTGGACCAGGCGAAGGAGGAAAACGAGAGCCACCAACATGGACAGAACAACAACGCTAAGGGAAATGAAGATGGGAA
      GCCGAAAAAGAACGATGACGTGATAGATGTAACCATGGCAAATGGCCAGGGTTTCAAAGACACACCTGAAGAAGAGACGA
      CCGGAACGGAAGAGACAGCCGAAACGGAGGAGACAGCCGAAACGGAAGAGGCAGAGCAGGCAGAGGAATCTCTTCTTAAT
      TCACGAAAAAGCACGGATACACCAGTCGATTTAGGAGCAAATTGCTTGACAACTGGCTCTCCCTCTAAAGATCTCGTAAA
      GCAAGAGCTTGTCGAAGACAAAT
      
      3' Sequence
      Total bases
      525
      NCBI
      3' sequence dataSequence Downloader
      ACATTTACTGCGATCCTTCGAGCGTGATTGCAATATAGGCATAAGGAGTACACAGATTTTAAGCACAAACGCACAAAATC
      CACCACTTGAAAACCGGTCCGAGAGGACGATCAAGTTGCAGATCCACCNGTGTGGGTGTCGGGTCCAGCTACCATAATGC
      CATCGGCGGGTGGAAGCGGCTGAATGGCAAGCGGTTCGTCAGCAGTTTGTGTATCCTGCGAAGGTGGGGCTGGCTCCAGA
      GTTTCCTTCTGGGCCTCCGTAAAGTCCCTACTACCTTCCATCTCTGGTGCATTCAAACTATCATCCATGTCCATGCAATC
      GCTGCCGAGGCTGTTGCGACGCACTGCATCGGGCTGACCTTGAAATTCCGTAATTAAAGCTGGCGGAGGTTCTGGAAGAT
      TGACGTGATTGTTGTGGGGCGACGCAGGTGGCGTTAGTGACCAACGACGCTGTTCCTCCTGCTGTGGCTGCANGTGCTGA
      GGAGGATCTACAACCTGTGGCACAACGTTTTCCACATGTGCATTG
      
      Library Information (1)
      Library: LP_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from larvae and early pupae.

      Sample preparation

      Larvae and early pupae at various stages of development were collected from an isogenic y; cn bw sp (iso-1) strain.

      Protocol

      RNA was poly(A)+ selected once. Oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid. ~500,000 colonies were plated out and a mass plasmid DNA prep was done using Qiagen Plasmids containing the cDNA inserts were size selected on Sephacryl S-500 column in order to exclude plasmids with no insert. Early elutions were collected and transformed into DH5 alpha strain (Gibco/BRL).

      Comment
      Reported As
      Symbol Synonyms
      References (1)
      Review (1)
      Rubin et al., 2000, Science 287(5461): 2222--2224
      A Drosophila complementary DNA resource. [FBrf0127297]
      External Crossreferences and Linkouts ( 2 )
      Crossreferences
      Fly-FISH - A database of Drosophila embryo and larvae mRNA localization patterns
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)