Open Close
General Information
Symbol
Dmel\RE07536
Species
D. melanogaster
Name
RE07536
FlyBase ID
FBcl0201561
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
  • Caution: This cDNA clone replaced by FI02011
Library
RE_cDNA
  • RE cap-trapped cDNA library of D. melanogaster, iso-1 strain, embryo (0-22 hr).
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    1,773
    NCBI
    Full Length sequence dataSequence Downloader
    AGGTACTACCTATATATCAACAGATTGTAAACGCGGTTAGGTTTCAAAAGTTATAGTAGTTGTAGTTGTTATGAAAAGCA
    ACTATGTACCTAATAATCATCGCCCTGCTTGCAAGTGTATCCGCTTTAGGCCGCCCAGACTTGGAGGACTACTGCAATGA
    TTCCTATTGCCATTTACTTGGTCGGAGCCGGACGTTTAGCGATAAGAAGGCTACCAAACTAACCGAGTTCCACATGGACT
    CCTGCGAAAAGAAGGTACTCAAACTTATGCCCAATCTGCGCACCCTGGAGCTGGAGAACTGCGACAGTCCGGACTTCACC
    ATGAACGACCTGAATCAACTGCCGTACCTAACAAGCCTTCAATTGCGACGTGGAAATCTTTTGGGGCTGCACGACGAGCA
    CTTCTCGAAGTGGCCAAACATGAAGATCCTTATGCTGGGGGGGAACAACATAACGAGACTATCCAATGAATGCTTTAAAG
    GCCTAGCTCAGCTCTGGCTGCTGTCTCTGCCGGGGAATGGTATTCAAGGTTTGCCATGGGATGTATTTCAAAACCTACCA
    GAACTTCTGCATCTCGACCTAAGTGGCAATAGAATCGAAACTCTTCACGAAAACATTTTTACAGGCGTTCCCAAGCTAGA
    GATGCTGCTACTCAATGGGAATCCCTTGACATGGATAGCGCCTACGTCTCTAAAATCTCTAAGTAACCTACGCCTTTTGG
    ACATGAGCAACTGTGGACCGCTGCCGGATCTTTCATTGCCCGGTGCACATACCTTGATCCTCGACAACAGCGGTGTGCAG
    CGCCTGGACATTTTGGGCAGTGTCCATAAACTCCAGGCGAGGAAAAACCATATAACCGAGATTAAATTACCCGACAAAAG
    CTCTGTTATCGAACTGGATTTGCATAGCAATTTACTGACCGCTACCGATATTCCCAAACTTCTAACGGGCATGTGGCGAC
    TGCAACGACTGGATCTATCCGAGAATATCATAGGGATATACGCAGCCGCCGGAAGCGACAATACGAGCGAGCTCTTCATA
    CTTCCCAATCTTATGTATATGAACCTATCGGCAAATCGCCTGACGCGTCTGCACTTCGATTCGCCAATTCCATGGGAAAG
    GCTTACTCATTTGGACGCTTCGTACAATAGAATATATGCTCCCGCAAAGGTTGGCATTGACGAAGCTTTCAATCTTCAAA
    GTTTGCATTTGGAGGGAAGTTATATTAACAATTTTGAACTTACACCCTGGAAACCTCATCCAAGTCTGAAAGAGGTTGCT
    CTGTACGATAATAAATTCCAGCCTAAGGGCTATAAAAATATTACAAAGTTCTTCAATGAAATTGGAGTAAACGTCTTAGA
    GAAAACGCAATACAGTCAATCAAACAACACGACTCCAACTTGTAAGCCGTGCATACCAGATGCCAGAGATTTTCCTACGA
    GTATAAGCGCCGACACAAACCAAACCATAGATACCAAAGTTAATCCTTTAAGCAACGACACTTATCAATGGAATGTATGG
    AACGTACTGATGCTAGTTTCCCTGATTGTTTCCTTGTTCGTAAACTCTTTTCTAATCGTGAAACTCATTCGTTTGAGAGG
    AAGAAACCAGTTCACGCAATCATCATCGGTACCTGCCATAATCGAAATGTTTTCAAACGAATCTGATGATGAAATTATCC
    TGTAATATAATCATTCTACTTAACATGTATATATTTAAACTTTTCCTTAAATAATAATAAAGAATCTCTTGAGTTTTAAA
    AAAAAAAAAAAAA
    
    Library Information (1)
    Library: RE_cDNA
    Description
    Cloned cDNAs prepared from polyadenylated RNA isolated from 0-22-hr embryos.
    Sample preparation
    For the RE cDNA library, embryos at 0-22 hr AEL were collected from an isogenic y; cn bw sp (iso-1) strain.
    Protocol
    RNA was polyA+ selected twice (RNA made by L. Hong). cDNA was synthesized by priming with the oligo(dT) primer adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95(2): 520-524; Carninci, P. et al. 1999. Methods Enzymol. 303: 19-44). Full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al. 1996. Genomics 37(3): 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al. 2001. Biotechniques 30(6): 1250-1254). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al. 2000. Genome Res. 10(10): 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, the cDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al. 2001. Genomics 77(1-2): 79-90). cDNAs were transformed into DH5-alpha TonA strain.
    Comment
    Reported As
    Symbol Synonyms
    RE_cDNA
    Riken embryo library
    References (3)
    Research paper (2)
    Hoskins et al., 2011, Genome Res. 21(2): 182--192
    Genome-wide analysis of promoter architecture in Drosophila melanogaster. [FBrf0213090]
    Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
    The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
    Supplementary material (1)
    Hoskins et al., 2011, Genome Res. 21(2):
    Supplemental Material. [FBrf0213251]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)