Open Close
General Information
Symbol
Dmel\RH33996
Species
D. melanogaster
Name
RH33996
FlyBase ID
FBcl0245444
Feature type
Computed gene(s)
 
Collection Status
DGC gold BDGP
Known Problems
none
FlyBase assessment
  • genomic DNA
Library
RH_cDNA
  • RH cap-trapped cDNA library of D. melanogaster, iso-1 strain, adult head.
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    2,586
    NCBI
    Full Length sequence dataSequence Downloader
    GTTTCCGCTTCACACTTCGCAAGTGGCGGATCGCAGGGCCGGGGATTCCGGAGTCCGGACTCCCAGATGCGGTTTATGTG
    ACATGCGGGCCAGGGAAACTCAAGAAACTAAAGAAGCGGCAGCGGCAGCAGGCACTAAACAAACGAATGCTGGCAGGTGA
    GTGGCAGCAGAGGTGGAGTTTCAGGGGGTTAAAGGGGGGCTTCTCAGAGGCCATCAGGGGGTTTCCGGGGACTCCAGGGG
    ACAGGGTGTGGCTGGCTGGTACCAGAAGTCATACAAACGCAAGACAAAACGAGGCGACAGACAATACAAGACTTCGAACT
    TGTCATACAAAACGCTGGCGCGACAATCAATGGAATTTATGGTCGCAGCAGGTTCAGTGCCAGTGCCAAACCCAAGCCGA
    ATCCCAATCCCAAGCCCTCAGACAGAATCCAACCCAGGCCCAAGTGAAAACCATTCCCAAAGCTGCCCGGACTGACTGAC
    ATGTGCACTTGCAGAAATGTCCTTAACATGTCCCAGTATTTTCAGCACAAGTACTTATAGGACTTAACTTCATATTTCTC
    TATCCTAAAAACGTTTAACCACATTTCTAGCTCCATATCAAATGTCATTAAATTGCTTACTCTCTTTTTCGGACAGAGAA
    ATTCTTTTGTGTGTCGAAAATATTTCTTGAAGTGCTAACTTGTCTTAGTGTACTTAAGCATTTTTAACGCCATTTGATGC
    CTTTTCACACATTCGACAAAGCGGAGAACAAACACCACCAGAACCCCAGACCTTAACCGAACCGAAAAAAAATAAAACTC
    AAGGAACACTTAGTCAGCCCATCATCGTCCTTCGTCCTGCCCCTCCCCAACCACCAGCAGGGCTCATCCTTTTTACTGCC
    GTTTGGGATTCAGGAGCAGGATTCAGTACTGTATTATGCGGCTTGTGTTTACACTAACAGACCCAGAGTCCTGAAAATGT
    ATAGAAAGGGGAGGAGCCCAGCTACTGTATTGAATTTCACGCATCATTTGGCCAAGGTTCATTCGGTTCTTGCTTTTGGT
    TTTAGGTTTTCGGACCCCAGGGCGTGGGTGCCACTTTCTGACTCTGCGGTTAGCTTAAAATTAAAACAAATATCGGAAAA
    CAGGCAAGTGGTGTTGCGAAGGTGTTGGAGTCGGCATTTAATTTCAGACAGGTGGAAGAATTTCGAGTTGGCCGAGGAAA
    TGTAATATGCTCTGCGCGCCCATTTAGCCAAGGAGGAGCTCTTTTCTGTTGTGGTTGTCCAAAGTGAAGTGAAGTGCTAG
    TGGGGGAAATATGCCAGGAATGTGTTGGCTAAAGGGTTCGGAAATTCGGGGAAATTGAGGGTTGCCAGCGAGTGTGTTGA
    AAGCGGCATTCCAATGTGTAGGATATCAATAGGTAGTCGCAAGTTAACGAAACTGAAACAGGATAGAGGGGAGACCTAAA
    ACTAATTTGCGATGTTTGTAGGAACTCGACTACTGGCAACGCAATTAAAGCATAGCTTGGATTTGAGAGTATAACAAAAA
    GGAAGACAAAGTTGAGACTACATGTACAACATGTAAATTAAGCCTTGTAAAATAGAAAAATTTTCATAGTAAGCCCTTTT
    AATGAATGCTTTTAAATGTTTGTTTCTACTAATGATTCCAGTGCTTCGCTTAATTGAAACCGCTTTTATAATTAAAACTT
    TAGTTGGCTGTATAACCGGAGAACACAATTCCAATCCCAGGAACAACCGTGAAACCGCAAAACATATATTGTGTAATTCC
    GGACAAAGCGTAAAACAGAAAATACAATATATAAACCTGAATAAATTTATTTTCGCCGCCATTGGTCTGCCCCAATGCTG
    ATTAATGTGGATTGCCCGACAAATGTGTGCACATTAGCATTAAAATATATGTACATCTATGGATGCTTCACTCGTTTTGT
    GTCCAACTTTTATTAGACCAATTAAATTGCGGTTGGCACTGAAGAGTTGAAAAGCTACGAATATATAGAAAACTTCGATG
    TCTCCCCTTTGTCTGCGTTGCCATTTAATGTGCAGCAATTTTCACCCAACAAAGGCAGTCAATTAGGGGGGTTCCCCACC
    CCTGATAAAAGACAATACTATTGTTGTTCTAGCCGGCGAACTAAGACATCATCATATGATAGATATTTTAGTATCGAAGA
    GAGAGGGGCTACTAATTAGCCATCATCAGCAGCGGCGGCTACACAATTTCCACCATCAAACAACAAAACACTAAACTGCA
    CTGGCCAGTTAACCGCAGGTACATGAGGGTTTTTGGGTATTTCGGGCCTGTGTTCTTGTTATTTTTTTCTTCTTCTGTTT
    TTTGGGAAGCGTTAGTAACTAAATTAGCGGCCTCTGTTATTTTTTTTTTCAGTTTTGTTCCCTCTTTGTGTGGTGTTTTT
    TCGGGTTTCAGCCGCCAGACTGCAGCCACAAATTATTGGGCCCAGTGTTTTAGTTGTGTTGGCTCCTCTTTGCTTTGTTG
    AGTCGACTGCTGTCTGTTGCCTAATTTCCAGTTGCATTTGCCTGGCTAATACAGACATCTCACTAAAGATGGCAGGGGTG
    AAAAGAAAACCCAAAAAAAAAAAAAA
    
    Library Information (1)
    Library: RH_cDNA
    Description

    Cloned cDNAs prepared from polyadenylated RNA isolated from adult heads.

    Sample preparation

    For the RH cDNA library, adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.

    Protocol

    RNA was polyA+ selected twice (RNA made by L. Hong). cDNA was synthesized by priming with the oligo(dT) primer adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95(2): 520-524; Carninci, P. et al. 1999. Methods Enzymol. 303: 19-44). Full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al., Genomics 37: 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al., Biotechniques, in press). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al., Genome Res. 10: 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, thecDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al., Genomics, 2001, 77:79-90 ). cDNAs were transformed into DH5-alpha TonA strain.

    Comment
    Reported As
    Symbol Synonyms
    RH
    RH_cDNA
    Riken head library
    References (1)
    Research paper (1)
    Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
    The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)