Open Close
General Information
Symbol
Dmel\RH22363
Species
D. melanogaster
Name
RH22363
FlyBase ID
FBcl0271341
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
    Library
    RH_cDNA
    • RH cap-trapped cDNA library of D. melanogaster, iso-1 strain, adult head.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      507
      NCBI
      5' sequence dataSequence Downloader
      GATTCTGGCTTGTGTTGATCCGCCGAGCAGTTTGCTTTAGTTTAAATACGTTTTTATTACTTTAAATACACTTAAGTTAA
      AATGCTCTGCCGACTGGTGGGAAACAGGAGTTTGGGTGCACGATATACCGCCTCCATCAAGGCTATTGCGTGCTACTCCA
      CGTCGGGAAAACAGCGGAACGGCAAGATCTACGAGTCGGCCATAGATGCTGTGGCCGATGTGCAGGATGGTGCCCAGATC
      CTGTTCGGCGGATTCGGAATCTGCGGCATTCCGGAGAAGATGATCAACGCGCTCAAGCAGAAAGGAGTCAAGAACATCAC
      TGGCGTTTCCAACAATGGAGGTGTGGACGACACTGGTCTGGGTGTCCTGATCAAGCAGAAGCAGGTGTCCAAGGTAATTG
      GCTCCTATGTCGGCGAAAACACGGAGTTGGTGCGTCAATATCTGGAAGGAGAACTGGCCGTGGAACTGACTCCCCAGGCA
      CCCTAGCGGAAAGATCCGCGCTGGGAG
      
      Library Information (1)
      Library: RH_cDNA
      Description
      Cloned cDNAs prepared from polyadenylated RNA isolated from adult heads.
      Sample preparation
      For the RH cDNA library, adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.
      Protocol
      RNA was polyA+ selected twice (RNA made by L. Hong). cDNA was synthesized by priming with the oligo(dT) primer adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95(2): 520-524; Carninci, P. et al. 1999. Methods Enzymol. 303: 19-44). Full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al., Genomics 37: 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al., Biotechniques, in press). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al., Genome Res. 10: 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, thecDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al., Genomics, 2001, 77:79-90 ). cDNAs were transformed into DH5-alpha TonA strain.
      Comment
      Reported As
      Symbol Synonyms
      RH
      RH_cDNA
      Riken head library
      References (1)
      Research paper (1)
      Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
      The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)