Open Close
General Information
Symbol
Dmel\SD02228
Species
D. melanogaster
Name
SD02228
FlyBase ID
FBcl0286791
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
    Library
    SD_cDNA
    • SD cDNA library of D. melanogaster, Schneider's Line-2 cells.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      3,721
      NCBI
      Full Length sequence dataSequence Downloader
      CGTAACTGGCGCGTAATTAACACACAAAAACGCGCTAAACAAAAAAAACAAACAAACCAAAAGCAGCAGTGAGGCGAATT
      TGTTTGCCAAAAGTGTTTCTTTCATGTGCGTGAATGGAAAACAGTGCCTGCATGAGACACTGAGTGCGGAAATGGAAATG
      GCCTAGGGCCGCTCCCGATTCACAAGCAACCGACATACACACACACACACACCGCCCAGCGGCGACAGCAGCAGCAACAT
      GGCAGGTGAAGTGCCAGCAGAAACATCGCCAGTAGGATGCAACACCAGCAACAGCCAGGAGAGCAGTCCCCATCCCGATC
      CCATCCAGCAACAGCAGCTGAACTCCAGCGTGGACAGCGGAATTGCGGTGCTCGAGGCGGAGTCGCCGACCTTGAGGAGA
      CGCCAGCGACTGCACCAGTGCCAACGGATCCTCCAGGTGTTGCAGCGGGATCAACTCACCCACCAGCAGCTGCGCGATAG
      ATTAAGCAAACTAGCCAATAAGAAGTGGAGGAAGGAGGAGTCCAGCAGCGAGGATCACGCCTGCAACGTCTGCTGTGCGG
      ACCTGGATCTGAGCAGTGCCAAAAACTACGTGACATGTTGCACCTGCGGAAAATCGGTTTGCCGCGGGCCTAAATGCGCC
      GACTGGCGGCCCAAGGACGCCAAGTGGGAGTGCCAGCTGTGCCAGAGCTCCAAGGAGTCGCTGGCCCACACCTCCTCGTG
      GGTGGCCGAGCAAATGTCCTTCAACCAGCATAAGTTTGTCTATCCGATGAGGGCCAGGAGCGAGGTGTATATACCGATTG
      TGGGCGATGGCAACGACAGCAGCATGCAATTCGAGAGCGTTAGCCAGATTGGACAAAACGCCCACATGGACGAACGGGCC
      AAGATCCGCGAGTACGTCGAGGAGATTGTGGCCGAAATGCTGGGCGGCAATTTGGACCACGTCAAAGTGGGGCAGCTGTC
      CAAGAGTGAGAACTATCTGCCGGCCATCGTAAATGGCCATACCAACAATAGTAATAATAATAATAACAACAACCATGCGG
      ACTCCGAGCTGGCCGACCTCTCGCAGACCCGACTGCGCAGTCTCATCGAGACCATCATAGCGGAGACCCTGCGGAGCTCC
      ACCCTCAGCGCCAGCGGAGCCGTCTCGGAGATCAGCCTGGACACCAGGTCTCACGTCTCCGATCTGGCCAATGGAAACGG
      GCTGAAGCGGCACCATCGCACCGAGCACTACTTCGAGCCGAAGATCTACCAGGATCTGTTGGCCACAGCGGTGCTAAATA
      AGATTGCGGATAAGGAAGGGAATACAAGGCTGGCGGCGGAGAGTACGCCGGACTTGAGTGGTCGCCACATTGACGAGAAT
      TTCAATGCCGAAGCGCTGAGCACCACGTCCGGAAGCTCCATTGAACCACGGAGTGATTGCAGCCTCACCGATCATGAAAT
      CGGACTGGATAATGGCAAATCCCAATCCCTGCAAACGGACTTGGAAAGGGAATCCGTGCTTAGTGACTATATAGCCGCAC
      ACATGGTGCCACTGCCGGACTTTTCAGCATCCGTCACCGAATCCGAGGATGATATTGGATCCATCTCCTCGGGCATGATC
      GGAGATGGAAACTGGGAGGACAACTGGCTGTTCAAGAAGAAACGCAGCTCGGCCACTCCGAGCAGCATTGGCATGCTGGT
      GCCGGCACCAAGGGAGAATGTACGTGCCCAGATTGGGGATAAGACCACCGACGAGGTGAGCGATCTCTCCGAGATTGGTT
      CGGACATCGAGGAGAGCTCTCTGGATCTGCTGCGATGCAACGATCTCAACGATCGTCTGCTCAGCAAGCACCTTATTGGT
      GGGCAAAACACTAAGATGGTCCTCGACGAGCTCGTAGATCGCACCAGTCTCACGTCCCACACATTGCCGGAGGAGAATGA
      GCCCGCATTCACAGAGACAACCAATGAGTTTGTTGTATCCCCGATGGCCATGCCTTCTGATATAAAGGCGCCTTCTCCGA
      CGCCACCTCCGCCACCAATGATATTCCAGGATGACTTGTTGAACGAGGAACCAGACCACACTCCCATCGCAGGTTCCATT
      GCGGAACGCGAGGTGAAGAAGTGGTACAACGCCGTTGAAATGCCAAATAATCCGTACTCCCCGGAGGCCCTGAAGCAGCG
      CATCAGCGGCACCCAGGAGCGCTACATGGATGTGCCCAACATCAGTCCGAGTGCTGAGCAAAAGGCACTGGCTTCGGCGC
      TGACGGAAAATCCGGATCCGCCAGCGCCCAAAGCGGATTATAAGCGCTATAGCCGCGACTACTACATCAACAATGCTCCC
      ACATCCACTGACAGCACGGGGGGTGGAAAGGCCGCCACAACCAGCGCAGGCGAGGATGTGGAGGACATCGTGATCAACGA
      GGCTCGAAAGGCAAGCCAAACTGCCACTGAACAGAATCCGCCGCAGGAATCGATATCGGTATACAAAGCCACGCCCGTCC
      AAGTCCTGGATGAGTCCCTGGATTCGCAATCGAATCCCTCGCTGTACTCCCTGCAAACCACGACCACAAACACAAGCGAT
      GAATCCGATACGGTTCGCATTTACGACTTTAACAAGCAGGAAACGACGGTTATCAGGGCTGCTCCAGCGGAGCAGCAGCC
      CAGCGAGTCCACCACTTCATCCATGGAGTCCGCCCAGGGTGCTCCACCATCGGTTTCATCATCCATCGACTCATCAGTGT
      CCCAGAAGCGGGAGCGCCCTGTGGTTCTTCAGTTCGGCCCAGGCGATTCGGTGCCAACAATAGGATCGCCTGCTAGTACG
      CCCACGCGGGGATCCACTCCTCCTGCTTTTAGATTCCTGCAGCCCAAACGTCGCCTTATCGATCCCAGTCAGGTGCTATC
      CGTCGACGAGGATGATGTGCCTGAACCCACAACTCCTGCGGCTGAGAAGCCCGTCATCGAAGATGAGGTGGCCCATTCCA
      TGCCATCTGTTAAGGCTCTGGCGCAGGCATTCCTCCTGACCAGCAAGCACACACAACCCCAACGAAGATGGCGGGCCAAG
      GTTAGAATAGCAGCCCCGCCAGACACTCCAGATAAGCCGAACACGTCACTGGCCAAGCGGCACAAACTGGAGCACGCCGT
      CTCCATGGCAGAAGTAGCCGATGAGTCTACGATCGCCTCGGACTTATCATCACTCGAAACGGATCCTTCTATACATTCGG
      AGGCCACTCCACCTATAGCCTCACCGGCGAGTCCTGTGCCCGTGCGCCACGGATTCCTCCGGAGCAATATTGCTTTCTTT
      GAGAATTTAAAGTTCAAGTGAATATGCGAATACAGTCTTGTTGGGTGCGACCCTTAGTTGATCTTCCCGGAGGGGAAAAT
      TTACGACAATGGCAAAGCACCAATCCGGCCATAATCCAAACCAAATCTTCGCCAAATACCATGTGCCATGGCCTCCATTT
      CCCAGTCGAAACATCACGGAAAAAAAGTACTTAAGTTCAGTTGGCCGTTAGCATGCGCCATTGTTAATTGTAGTTCGTAT
      TTACTATTACATAATTCTTATATCCATGGATACTATTTATTTAGCTCTAAGATATGTATTACGTACTTTTTTGGCGTAAG
      AGAAACTATCCCAACTTCAGCTGAATAATGTTACACCTTACCCGTACTATTGTAGTTTAAATGTTACATAATTGTACTCA
      ATAAAACATATAGAAAAGCAAAAAAAAAAAAAAAAAAAAAA
      
      Library Information (1)
      Library: SD_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from cultured cells; cell line used was not derived the iso-1 sequenced strain.

      Sample preparation

      For the SD cDNA library, Schneider L2 cells were collected.

      Protocol

      RNA was poly(A)+ selected once. oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid. ~300,000 colonies were plated out and a mass plasmid DNA prep was done using Qiagen Plasmids containing the cDNA inserts were size selected on Sephacryl S-500 column in order to exclude plasmids with no insert. Early elutions were collected and transformed into DH5 alpha strain (Gibco/BRL).

      Comment
      Reported As
      Symbol Synonyms
      SD
      SD_cDNA
      References (1)
      Review (1)
      Rubin et al., 2000, Science 287(5461): 2222--2224
      A Drosophila complementary DNA resource. [FBrf0127297]
      External Crossreferences and Linkouts ( 2 )
      Crossreferences
      Fly-FISH - A database of Drosophila embryo and larvae mRNA localization patterns
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)