Open Close
General Information
Symbol
Dmel\UT01660
Species
D. melanogaster
Name
UT01660
FlyBase ID
FBcl0292684
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
contains transposon sequences
FlyBase assessment
    Library
    UT_cDNA
    • UT cDNA library of D. melanogaster, adult male, testis enriched for germ cells by prd overexpression.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      573
      NCBI
      5' sequence dataSequence Downloader
      ATTCCTCGGAGCTGTTATAAAAGCAGTGGCGCTGGGTAGACCTGACATCTTCAGTTTCGGCAGGTGTTCCCCAAGTATCG
      GTACTTGGACCAATCCTATGGAACATTATGTACGATAGGATCTTGGGCAGCAACAGGCCCGTAGGAGTAGAGCTGCACTG
      TTTTGCTGACGATGTGGCAATCACAGCTGTCTCGAAAACAATCGCAGGGTTGGAAGACAAATGCAACTCTACGATCGGTG
      CTGCCATCCTCTGGCTCGAGAAAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGTCCCTAAAGT
      ACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGAAAACGCGAGCTACGCCAGCAAGAAGGCAGCAGTCACAGCC
      TCTTCGTTGGCGAGGCTTATGCCCAACGTCGGAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAGGC
      TTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAATGAGCTCGTTCGGTGCTAC
      GGTCAATGGCCCT
      
      Library Information (1)
      Library: UT_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from adult male testis. The strain used was not the iso-1 sequenced strain.

      Sample preparation

      As a source for stem cell-enriched tissue, testis were dissected from adult males 0-3 days old that overexpressed upd (P{UAS-os.C}) in germ cells from the nos-VP16 GAL4 driver (P{GAL4::VP16-nos.UTR}).

      Protocol

      RNA isolated from dissected testis overexpressing upd to enrich for stem cells was kindly provided by M. Fuller. cDNA directionally cloned directly into EcoRI/XhoI-digested pOTB7 plasmid. cDNAs were transformed into DH5-alpha TonA.

      Comment
      Reported As
      Symbol Synonyms
      UT
      UT_cDNA
      References (1)
      Unpublished (1)
      Stapleton et al., 2003, BDGP/HHMI UT Drosophila EST Project.
      BDGP/HHMI UT Drosophila EST Project. [FBrf0186645]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)