Open Close
General Information
Symbol
Dmel\BACR12O13
Species
D. melanogaster
Name
BACR12O13
FlyBase ID
FBcl0297751
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    RPCI-98_BAC
    • BAC genomic clone collection for D. melanogaster, iso-1 strain, adult, 163kb inserts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Genomic Location
      2R:21,116,521..21,293,859 [+]
      Total bases
      177,339
      NCBI
      Full Length sequence dataSequence Downloader
      GAATTCTACACTTGAAAAGAAAACTTTAAGAAGAAACATCCTAAAGTTTAAATGGGGATCGAAGGGTAGATAAAGTTTGT
      TAAATAATCCAGTTGTTTTCAAATCAACATTGATTTTAAGTTTTCATGTATATACATAGATTGTTCTGCAACCCAAATTC
      CAATGAAATTTGTCAATGTTCGTTTGTGTTTTTGTTGGCTGTCGGCTTTTTGGCATGCGGAAGCTGACTTGAGCCGCTGT
      AATACGTGCATATAATCCTTTATGCCAAAACACATCAGCAGCCAGCCAGCAGCGAGTCCTTGCCAACTTGAGAGCTGTAT
      GATGCCGATGAGATGGGCGGGGCGGGGTATTAAGGGGTTGATTTGCTTGTCCTGGCTGTTCTGGTATTTGCAAAAAACAA
      ACAAACAAACAAACAAGGGGCGGGCGACAACAGAAAAAAGCCACAATGTTCGTATGGCTTGTTGGCGCTCTCAATTTCCT
      TTCGCTGCGCACGGGGCGTATGAGTAATCATTTTATTACGCGAACCCCAAAATTATGCTACACACCGAATATCAGCTGCC
      AACACAGATGTTGACCTTCTGTAATGTATAAGTGTGTGTTGTTGTAAGTGTGTGAGTGTGTGGGTGTGTGTGGGTGGGTG
      GGTGCTCTTTGTGCTCGTGCCTTTTATTGCGAGCAAGACCCCTTCATTACGTATACGCAAATTTGTCTGGCCCTTAAATT
      AAAATAAATGCGCTAAGCACGCCCAAAAAGTTGCTGAGAAACATTTGCACATTTTCTCATATATTATCGTTAATTCAGCT
      TCCCGCACAAAATGCCTTTTGTGTGCGAAATTGAAAAATAATAAAACCATGTGAGTATGCATTAAGCGAAGGATTACGGC
      TCAAGAATATAAGTTTTAGGCCAATGCATTTGAGTTTATAAGCTGCAGAGATTTGTGGCGAATATTAATTATACGCAATA
      ATTAATATTAAATTTTAGTTAGCTCATGCATCTCCAAGAAAGTTATCTAAGTCTATATAGCTAAGTTAAATCTTATGCCT
      TGCCTCATTGACTGCCCCATCAGCCAGAAGCGAAACTTTATGCATTCGCTGTTTTATAGTTGTTATTTATGTCAAATCGT
      TAACGAACCCCTGCAACGAGTTTGTGTTCTACGCTGCTCCACTTTGCGTTTCCAAGTTTTTTTGCCCCATCAGCCCAGCG
      GATTCGCCCAAGGCGACGTCACTCGTTTTTTTACCAGCTCCGCATTTCCCCTCACGGTTTTCCGCATTCTGTTTAGTACG
      TGCTCACGGCTTCAGTTCTGTTTTTTTTTCTGCCAGCCAACTGATTTCAAATTTTCACACAATCGCGTTTTTTTTTTTCA
      CATAAAAAAAGTGTAAACATGTCACGGAGGATAGTTAGCTTTGAGAATGGAACTTGGTGCATTCCGAATATTGTTATTAT
      TTGCGAACTGGAATAGAGAATATAAATCCAAACAATGCAATACTCTTAATTGAGCGCAGCGGATGAATTACACGGACGTT
      GACAAACTTTCACCATGTGAATTGCTCGACTGGGGGTCAGCCACCACATAAGGGGAGATCTGTGGCTTAGTTTATGGTTT
      GTGGTCTCCATATGTAGCTATTCCATGCCATGCCACCCCATCCGAAAACCCAATTCCAATCCCACCCACTGAAGGTGAAG
      CTTTTGCGCAACACTCGAAATCAAATTCATTTAAACTGGCACCGCTGATGATGATGACGTGGACGCCACCCCAAAGCTTT
      CGCATCTAAGTCCGTAGCTGTATCTGTGAATGAATCCGTAGCTGTAGCTGTATCTGTATCTGTATATGTATCTGTATCGG
      TAAGTGCACGAGTTTTAGGCACACGTGCATGAACAGAACGGGTTTGACCGCCGGCCCGACGAGACGGATTTCCCTATCGC
      GCCGTGACTTCGATATCACGGAACCTTATCAACTCGGGTACTCGAAGATGTGGCCACTGCCATAAATCTCGTCACAGTGA
      TTCCAGTGCCAGGAGAGGTGGTGGTCAGACGCCTTAGCACCAAAAAAACCAGAACACAGTTCCAATTCGTGCGCCGTCGA
      GGGCAGACATGTCGGTGTCCTGGTCGAAGACTTTCGCGGCATTCACCGTCGCCTGGCTCAGTGCCCTGTGCCTGCTGCCC
      GTGGAGACATTCTGTGACACCTCCTACTACGAGAAGTACTACGCGGCGCGGCGCTATGTGCCCCTCAAGCGAAATGCTCC
      GCTGGTCTTCAACTTTACCCTAACGCTGCCGGATGCGGATCAACTGGCGTCCTTCGAGCGGCCCGCCCTGGTGGGCAATC
      TGCCAGTGCTGGGCGCCTGGCAAGCGGGACGCGCTGTGCTCCTCAACCGCACTGCAATCCTGAATGTTTGGAGCGCCTCC
      GTGGAGATACCGCAAAACAGCAGCGTTGAGTATCGCTACTTTGCCGCCGCCGTTGGCCAGAGTGGAGCCGTGCAGATTCG
      CCGCTGGGAGTCGCATGTCCAGGCAAGGACCTTTAATACCACCAAGTTCAGTGGCAATCGCAGCGATGAGTTCGGACTCA
      TTGGCAATGAGCGCCAGTTGTCGCGTGGCTGGCTTCAGGACTCGGGCAACATTCTGCAGTTGAAGCTCTTCCGCGAGGCT
      CTGAGCTTGGAGGAGCAACCGGAGGTGGGGCAGGAGAAGCTGCGTCTGCGTTTGCAACCAGTAGATCCAAAGACTCTAGC
      GCCCATCCTAAGTTCGGCACGTGCCAATGTGGAGTACGTGCGAATGGCGTACGGTGACAGTAAGCTGCGGGTGCAGCCGG
      AGTACGGAGTGCCCTACGCCACCGGTGACATCCTCATGTTCCATGTGAACCTGGAACAGCTGGATCGAGTGGCCTATCTG
      GTGGAAGTTTATGCCGAACAACCGGATGAGGACCTGGTCCGTCTCCTAGGATACTCGCACCTGCTGCACACCTCGTTCTC
      CGGCACTGAAGGCGATGTGTCCATCGACCTTATTTCGCCGCTCTGGCAGCGCGTGGTGGGTCAACTGCGTATTGAGTACC
      TGCACATTCGGCCCATGGAGAAGGATGGCTTCGATCTGCGCACCAGCTTCGCCAACTACTGGCGCTCCAATTGGACAGCC
      CTGGAGATTGGCCATCGGGGATTGGGAAAATCTCTTACGGTCACCACGAATGCGGCTCCGCTTATCGAGAACACGGTGGC
      CACCATGCTGGCCTCCTCTGAATTGGGCGCTGATCTCGTGGAGTTTGATGTGCAGCTGACCAGCGACCTGGTGCCCATCA
      TCCACCATGATTTTTCCATTCGCGTCTGCATTGACTCGAAGACCCCAACGAGCAAAGATGATTTGACCGAGGTGCTGCTA
      AAGGACATATCCTATGAGCAGCTCAAGGATCTGAAAACCTACCAGATCGTGGGCAACAAGATTGTCGAGTATCCGGCGCA
      CAACAACGTGGAACCGCCGGAGCAGCGACTTTTCCCCACACTGCAGGACTTCTTTGAGCGGGTGAACCTGTCCACCGGAT
      TCGACATCGAGATCAAGTGGCCACAGCAGAGGGCCGATGGACTGTTTGAGAGCGAACAGACGCTGGACAAGAACCTGTTC
      GCGGATCGCATTCTGGCTGTGGTGCGACGACATGGCTGCGGTCGACTCAATGTGATCAAGAGCTTCGACGCGGACTTATG
      CTCCCTGCTGCGCTTCAAGCAGCACATGTACCCGGTGCTCTTCCTCTCCAGCAGCAAGGAGAACGTCTTCAACGATCCCC
      GCACCAGCACCGTGGAGCAGAGCGTCAACTTTGCCCAGGCCTTCGATCTGGGCGGCGTGTCACCCAACGCCGTGTTCGTC
      AAGGCGGATCCGGGTTTGGTGCAACGGGCAAAGGCACAGGTGCCCATTGTCCTGCTCTGGGGCTCGGACCTCAAGGATCG
      GGAGTCCATCGACTGGTTCCTGCAGCAGGGACCCACTGGAGTCATCTACGATCGACTCGACCTCTGGCTGGGCGCCAACA
      GGACGAGTGCGTTCGAGGCGGAGCAGGATCTGCCGGGCTACTTCCAGCTACAGTGCGATCCGGCGCCCAAGGAGCGCGAG
      GTGAACTCCACCATCGAAAGCATACTGAGTAATGTTAACTTCCTGTAGTGAATTCTGTAGAGCCACCAGAGATATATACA
      TCATGCAATAAAATAACTAAAAAGGATATCTATTGAAAGTTTATATTTAATATTTAATATGGATTCTTTTTTGGCTATAG
      AAATTGGAAAATACTAAATTTTATTTTTGATTACCCTTTTAATCATAGACAAAACGACATTTCAAAGTGACTAGCTTACG
      AGTATTTGAATAATTGAAATATCGATTGCTCGTTTTATGGCAAGCAAAAGGGCACATTTCTTTATTAAATATTAAAAACA
      TGATTTAAATATAAATGATTTTGGGTATTACATCCTTTTCTTCGTCCTGAGAAGCAGGCGAAAAAAAGAAAAGCCATTAA
      GCTCGGGATACTTCGCTTGATTTATATGCGCAATTTCAGCGCAACTTTTGACAGATACGGATTTTGTTTTCCCTGCTGAT
      AAACGTGAACGTGAACTTGAAATTTAAATCTTTAATGAAATCATTGCCATCACAACATCAACCGCTGTCCCACATGTCGT
      TTCACTTCCACCTCCATTTGCATTCGGATTCGCACATGGATAGTACACACTGCGGTGGTGCTGATGGATCTGCTTGGTGC
      TCTCTGTTTTTGTTACCCCTTCGGGATGCTGGGCCAATTACCTGCTGAGCGATTTGCATTTTTTCCGGAGGGGATTAGGG
      GTATCCATGCATATGCAAATATTATGGCATTTACTGCGGTTATTTATCCGCTCCGTGGGTGTAAATTTAGTTTCAGCAAT
      TTGTTGCAACTCGAAACTGTGCCGCCTAATTGGGTTTACAGAAAATCAAAAATAATTGCCATCATGCCAGCAAAACATTC
      TACTGGCTCCTATCAGTCAGTGCACTTGAAATCGCAATTATTTGATTTATTATCTTATTACCTTAGGTGGTTCGTTATCT
      TAGTAATCCTTGAGCGAATTGCGATTAGAGCTTGAAGTAAACAATATTTTTGATTTAACTGCTTTGCAGCGCCAGCTGAT
      GGAGGCCTACATCCGGCAGAAGAGAGCCTCGCCGGGAATGGTCCAGGCCAGCGATTTGCAGATCAATCGACCCATGTCCG
      GGATGCGCAGCAACAGCCGGGAGCTGCACGCCTACGACGGACCCATGCAGTTCATCAGTTCGCCCCAAAATCCGGACCAG
      ATACTCACCAACGGCAGTCCCGGCGGCATCAATCCGGTTGCCATGAACACGAGTCGCAATCACTCGAATAACATGCGCAG
      CCTAAGCACCATCAACCAGGAGGGTAAGTGGTCGTACACTCCAAGAAAAGGTAGTTAGGCTTCCATATATAATCAGAAAC
      TTAGCAGTAGTTATAACCATGGAACTATTTTGCTTTTCAGCTGATCTCATAGAGGAGATCTCATCGCACGAGTTGGAGGA
      CGAGGAGAGCAGTCCGGTGACGGTGATTGAGCAGCACCAGCAGTCAGCCTCGCACAGCGCCAACTCGACGCAATCGCAGA
      AACCACGTGCCCGCCAGCATTCCTTTAGCGACAATCTGGACGAGGATGACTACACCAATCGCAATGTGGCCGGTGCTGCT
      CCAGTGCGTCCCGCCGGCATGGCCTCATCGCCGTACAAGGACGCAACGCTGGACGGCAGCAGCAACGGGACGGGGAACGG
      AACTGGCGGCGAGTCCGAGGGAGATGTCATCGGCAATATCGACCAGTTCGTGATGCAACCAGCGCCACAGGGAGTGCTCT
      ACAAGTGCCGCATTACGCGGGACAGGAAGGGCATGGACCGCGGCCTCTTTCCCATCTACTACTTGCATCTGGAACGTGAC
      TACGGCAAGAAGATATTTCTGCTGGGAGGTGGGTTATTGATAGTGATCCTCTAAAGAGCTGTCTAAAATTTGATACGCTT
      ATCAGGTCGCAAACGCAAGAAGAGCAAGACATCCAACTACATTGTCAGCTGCGATCCCACGGATTTGTCTCGCAATGCCG
      ATGGCTTCTGTGGCAAACTGCGCTCTAATGTCTTTGGCACATCCTTCACGGTCTTTGACAACGGCAACAAGGAGAGCACA
      GAGAGTCCTCGACTCGACTTGGCCGTCATCATTTATGTAAGTTCACAAAGTCAGTGCAAAGGATAACTATCTTAATATCT
      AACTTATTCACAGGACACCAACATTTTGGGATTCAAGGGGCCACGCAACATGACTGTTATACTGCCCGGCATGACTGAGG
      ACGATCAGCGTGTCAAGATCAGTTCGGCGGATCCCAAACAGCAGGGCATCCTTGACCTATGGAAAATGAAGGTAGGCAGC
      ATAGGATATTCAAAAAAAAACCACCTACTAATTTTCGAATTTTTAATAGAACATGGACAACATCGTGGAGCTGCACAATA
      AGACGCCAGTGTGGAACGATGAAACCCAATCGTATGTGCTCAACTTTCATGGGCGCGTCACCCAGGCGTCGGTGAAGAAC
      TTTCAGTTGGTCCACGACTCCGATCCGGAGTACATAGTAATGCAGTTCGGCCGCACCTCGGAGGACGTCTTCACCATGGA
      CTATCGCTATCCCCTGTGCGCCATGCAGGCATTCGCCATTGCCCTCAGTAGTTTCGATGGCAAAATAGCCTGCGAGTGAG
      CTGGCTGGGATCCTCGGGTTGGCCCGTTGCCTTATGTACAGCTGATTATCTGGAGTGCGGATCAAGTCGCTCCGGGCGGA
      TCATTGTTGAAATTATTATCGGAAATCTAGTCACTCGAAGTCGGGTTTTGGTAGACCATCGTTGAAATGAGTAATGTAGT
      TAGTAGCTACTCGTATCGCGTATCATTGTATAACGTATATTCAGAATGTGCTCACCGATTTTATAAGAAATTATTTAGGA
      CAGGTCCTACAACTTTGTAAATCTAAATGTGCCCCTTTTAGCGATAAGTTCACTTGTAAGCGATTCGAAGTCAAGGTCAT
      TTAAAGTAATATCAGTTTTATAATCAGCATATAGCAACAAATCAAGGACTAATGTAAACTATTTAAAATGCCACTACTAT
      TAGTCGGTAAGAGAGCACTACTAACTTGTACTAAGCTCTAAATAAATACAAACAGCTATTGATCAAAAAATGAAACTTTG
      TTGAAAATTCGTTTCTTGTTTTATACGTATCATTTATTTTAGTACACGTCCTAACGTTATTTAAATAAATGCAAGACCGT
      CAGGCCTTCATATATAAATTACGTAATCTATTTACAAAAAGAATATCAGATCTCACAATACGAATGGCATGGTACCTGAA
      ATCCAATCCACACACAAAAATTGTATAAATATCTTCAAAACGAGTATATGATCAAAGAATTACGTTAATAACTAATAAGT
      ACAACGGAATTGTGTGGAATGGACCACATATCTTCACTTTGTGTTATTTTTATCAGACTCCGTATGTCTCACAGAATGTG
      GGAACCTTGCGTTCCACTAACTCAACTCTTGTCTTTTTACATGCTCATAACTGCTATTTGATTTACGCTAGCTTCTGCTA
      CGATCGTTTACGCGATTTATGCGTTGGTCGATCCTGGGGCAGTTTAAACTCAAGCGGATCGTAGTCCTCATACGCGAGCT
      TGCGCTCTGGCGCCGACTCAGGTAACTTGTTGATTTTCTGCAGTCGTGCAAGGACAATCTGCAAATGCCGACCGATATAG
      TCCTCGGCGGGTGCCAAGCGTTGCGCGTACTGCAGGCATGCAGCTGCCTTGGCCAGCCGCTTACGTTCCACGAACACCAC
      ACAGAGATTGTGCAAGCCCTGAGTGTTGTGGGGATCGTAGTGAAGTATGCTGCGATAGCACTTCTCCGCCTCATCCAGAT
      CCTTCATGTGATTAATGTAGATGTCGCCCAGCAGGATCAGTCCTTTAACATGCGACGGATGATGTCGAATCAGTTGATTC
      AGAAATGGCACTGCATCCAAGGGCCGTTTTGTATCGGCCAGTAGCAGAGCCAGATTAAAAAGTGCACTACGAAAGTCTGC
      CTTTAGGTGTATAGCTCTCTTGAAAAACTGCTCAGCCTCGTCGAAGCTTGACTCGTCCATGGCCAGCATACCCAGGTTGA
      AGTACACCTTTTCGTTCTGATCATCGTTCTCCAGAACTTTGTACAGCCGAGAGCGTGACACCCGGCGGGCCTCCTCGCCA
      CCGAGTTCCTGCAGCAGAATAGCCGAGTTCAGCAATGCCTGTTCGTGCTCCGGATACAATTCGATTGCCTTATTAAAATA
      CACCTGCGCCTGCTGGCTCTTGCCCTGCTCTAGGAAAACTACGCCCAGATTGTAGTAGATGTCTGCATTTTCATTATCAT
      AAAGCAGTGCCTGCTCATAGACCTCCTGCGCCTGAGCTGTGCGATTCAACTTCATAAGAATGTCGCCACGATTGATGTAA
      GCCTGCAAAATAAAGTTTTGTAAATATGAGCAGCACTAGAAAAATCAAACTACAGGCCTTACTTGAACATAGTCACTCCT
      CATGCTGATAGCCTGGCGATAGAGATGATCAGCCTCCTCCAGACGCGTTTGATTTTTAGCTATGAGATTCGCCAGGTTGA
      TAAACACATTCAAGTGATTGGGAGCGATGCGCGCATGATAGCTGACACCCGGCTTAGCTTGTGGAAACAGAGCCTTAGCC
      TGAACATAGGCTTGTTCCGCCTCTGCATACCGCTTGAGATTATTGAACGTGCGACCCACATTGATGTGTGCCCCGATGTC
      ATCGGTCTGAATGCGCACGGCCTGCTGGAAATAGAGCAATGCCTCTTCGAACTTCCCTTCGTTCTCCAAAGCGTGTCCCA
      CGTTATTGTACAGCTTGGCGTTGCGCTGATTTACATGCACACCAGACATGAACAGGGAGTATTCTGTACGCCAATCTAAA
      TTGCGTTGATGCGTTTTCAGCGCGTGCGTGAGGAGCAGGATAGCGAGAGCAGCTTGTGAAAAACGTTGCCAGCTTAGGCT
      TCCACGGCGCTGAAGCTGCTCAAAGCCATAAGCCACCAGCAAGCAGTACCCCATGGATGGCATGTACAAAATGCGTTCTG
      CCACCACAAATCCAACGGGGAAGAACAGATTAGAGGCTGGGAGAAAGGGCAGCACCATCCAGCCCAGGCACATTATAAGT
      GTCCGCGACAGGGCCAGATTGCGGGTAAAGCAGGTCTTGGCGACCATAGCCCCCAATGCCAGAAAGGTAAGCAAAGTGGT
      TATGTTGCGGGAATCCGTGAATCCCTGCAGCAACGGAACAGTGCCTAAATATAGAGTTTACTTGATTACATTGAGCTTCT
      TTTATACTTTATGGACATTACTCACCCATTGTCCAGTCGCAGCAGAGCAGCGATGGGCATAACAGCAGCCAGCAGTTCAG
      GTAAATGAGGTAGCCGTAGGTAAGTTGTCTCTCAGGAGTATCCGCAGCAGAGGCTGGATTATCAAACCGCGTAAAGATGG
      GTAACTGTGAACCCATCACGTATACACGTCCCACCAGGAGGGTCAACGTGATGCCAACCAGGAAGCTCAAACGTTTCCAC
      AGCGTCGACGATGACCAGCGTCGAATTCCCGAAGGATTCGCCAGCTTTGGCGACTGCTGCTCGGTCCGCTCGTCAAACAG
      GCGCAGCACAAAATGGCAAAGGTGCAGTGGCCGTAGTTGATGGACTACGAACAACTCATAGACCACGCATATGCCGGCAA
      TGGTGATGCCTTGCTCCTTGCACAGCATGGAGGCCAACAGGCAACTGCCAAAGCAGCCAAAAAGCGTCAGCCAATTGGTG
      CGTCGCGGACAACCCGAGTCGCCGACGGACTTCGCGTAGCTAAGAAAGGCGGCCAGGAAGCAAATTGAAGAGAGCAATTC
      AGCACGCCCGACGACGCCAGTAACGGCCTCTGTGTGAACTGGATGCACGGCGAAGAGCAGCGAGGCCACGAAAGCGCATG
      TGTTGAGCTGGGAGACGGATGACGAGGATGGTGCCGAGATGGCATTACTGCCCGATGCGGCACACTGACGCAGCAGCAAC
      CGGCAGACCCGACGCCACAAAAGGCAGACCGACAAGTGCAGCAGCAGGTTGACGAGGTGGTATCCAAACGGCTCAAGTGC
      ATGCAGCAAGTAGTTGAAGCGGAACGTCAGCACGGTGAGTGGGCGATAAGACTTGTGGGACTGCTCCTTGCGCATCGGCG
      TCCCCCAGAAGTCGTTCAGGAAAACGTTGATCAGCGGAGTGTGCGGCCTCAGATCCTTGTTGTCCCTGATTGCGCTGATG
      TCATCGAAAACAAGCCCGCACTGAGTACTGTTGTAATAGCAGACTATGCAGGCTACGCATATACACAGGAACTCGAGCAG
      GTTGCGCTGCGGCGAGTTTGTGGCTCCTTCCCGCTCCCGTTCCCTCGGCAAAGTGGAGGGTGCATACTGATGGATTCCGG
      GGTTGGGGTTCGTTGACATGTTGATTTCGCGTTACTTCGTGAAAGGCGTCATGTACCCACAATTGTTCGTTCAGGCGGCG
      AAATGTTGCATGTAGGGCTTTACCCAGCCACGGTCGGCAGGTCCCTAGATGGCCTGGAAAAAAATGAGAAAGTGGGAAAA
      CCATTAGTTTAAGTTAACTGGAAACTAATTAAGTATACAAGTCCACCAATTTAAGTATAGACACTTCCTATTAGTGAGAA
      AGCCCCTAAATGTAGGCAACATACATATCTATATATTTTTTTTGAAAGGGGATTCCCCCGAGCAACAAAATTGTGCAGTA
      ATGTATATGTAAGCCCTCGCATCTTTTCTGGATACACACCCAAATCCTCTTACTTTCCATAGTCCTTCATCCGCAACTTA
      CCGATTTTCCCCCAAGTCAAAGTCTTTTTAAAGACAAACTTTCTACCGCTTTTTATGAGCACTTGAAGTTATACAAAGAA
      GCAAAAACTGATTGCGGAAAAAATCAATTAATACGCAACAAAGTAACTCCTTCCCGGTTACTGTCCTGGTTACCGACTGC
      ACACACAAAAGCCCGAAGTTAACAAAGTTGTAACCCGGGCGGACCGACAGAGCTCCGGATCCGGACTTTGGGTACGCACA
      AGTACAAGTATGCGGACGGAGAGCGCTTTTAGAGAGGCGAAGAGCGCGTGAGAGATTTGTTTGCATAAACTGTTGTAAAT
      GTTGCGGGACCTGGAGCATTACTAGGCGGGGCACATCGGTGGGCAGATGGGCGGATGCCACAATGTTGCACTCAATGCCA
      TCGATTTTCCGGGCGTTCAGTCAAAACAAACCACCACAAGCGAAGTAAGCGCTCGTAAAGAGCGAAAAAAGGGGCCTAGC
      TTCAACGGGAGCTGGAGAGGATTGCATCTCAGCTGAGCGCAACTTTGTTGCACGACCGACTTTTCCCGAAGGACGACCGG
      GCGGGCACGTGCTCCGTTTACCCTTATTCCATTTTCCCGCCAAGAGCGACACATGCGCGGTCCCGCATCCTTGCACTTTC
      ACTTGCCAGGACGTGCGCTCTCCGTGCTCATGGCTCTCCCGCTCGCCGAGCGCAAATTAATGGCCGTGTGTGTTTTTGTA
      AAATTACTTTGACCGAGATACGGGGCACTGGAGAAGGATAAGGACATGGCGATGGCTATGGGCGCTGGAACCGGAGAGCC
      AGCCGCATGTCCTCTCCCATTTTAGTGACATGGACGCCATTACAACGGCGATGGCCTCGCACACGCACACAATCACACGG
      CCGCAAACAAACCCGATTTGCCAACTTTGTTTCAATTCGCCAATAATTACAATGTTGCCCAGCGAGTTTCGAGCACCGTT
      TAACAGATGGGTTCTCACACACCGCCCTGTCGTTCACATACTTGTTGAGGTAGTTCCATGGCATCCAAAACTGAATTACA
      TTTTAATAAAAATCAGTGCCAAATGCGCGACTTGTACGTGGATTATTGTTGTGTTATCGATACGCCGATAGGCTGGCTTC
      TCTTCCTCATCCCTGCCAGCCATTCGCAGCGAACACTTATCGATACGCGGTGATAGTTATTCCGTGTGTTTTCCCATCTC
      TAACGCGTTGTAGTAAAGGAAAAAGAGTGGGAAACCAAAAATTGATATTTTTCTGAAAGTCTTTCAAAGTTACGCTTTAA
      ACTAGAAGCAATCATGTCCACGGAGGACTTTTACCTACGCTACTACGTCGGACACAAGGGCAAGTTCGGGCACGAATTCT
      TGGAGTTCGAGTTCCGGCCGGATGGCAAGCTGCGGTACGCCAACAACTCCAACTACAAGAACGACACCATGATCCGCAAG
      GAGGCCTTCGTCCACCAGTCCGTGATGGAAGAACTGAAGCGAATCATCATCGACTCGGAGATCATGCAGGAGGACGATCT
      GCCCTGGCCGCCACCAGATCGCGTGGGTCGACAGGTCGGTTTGCCGCACTCCGTAACTAGAGCTCAACTAAACAACCATG
      TGTCTTTTTCAGGAACTGGAGATCGTCATCGGAGACGAGCACATCTCGTTCACCACCTCGAAAACGGGATCATTGGTGGA
      CGTGAACCGGTCAAAAGATCCCGAGGGCCTGCGATGCTTTTACTACCTGGTGCAGGATCTCAAGTGCCTGGTCTTCTCAC
      TCATCGGCCTGCATTTCAAGATCAAGCCCATATAAGCCGTAGCCACCACCTCAAGCATAGCCTATTTATCGGACGGACAC
      ATCGTATTTTATAATGGAACTTCTACGATACTTGTAATTGTATAAGCTATACCTTTGTACTTTTTGGTACAGTTTGCAGT
      GAATAAAAAAGGATTGGAAGATACTTTGTTTTCAAAGTCTTGTGTACAGTCTAGATTGTGCTATAGAAGTAAATAGCAAA
      TCTTCGATGTAGTAGCAGACAACAAGTTTAACAATAATAGCAAACACAATAGTAAACCATTTAACTTTTGATGTTATAAT
      GTGTAGGTATATTTGAAAAATACAATTTAATATCTATTGTGTTTGAATAATATACATACTCGAGATAAAAATTTAAAGTC
      CTTTACATTTGTACAATTCGTATATGTCTAAAACAGCTTAAGCTAAGTGATTAATATCTCACAAACTGGCAAATTGTCTT
      AACGTTTAAGTACAAGCAGTAACTTAGCCTAAGATAATGATCGGTATCTTAAGAAACTGGAATAAAATACGCACTCACAT
      ACGGTTTTGAGACTTGCAAAGGGTTTGGCTTACATATGCTACTAAATTCAGTCTTTGGGGTGAGTACTTTGCTAACGAAA
      GTACAAACTAAGGGCCTGCAGGCGATGCAACACTATAGAAAGCTCTTATAGAGCCGAATGCGTAGGTCTCAGAGTCATAA
      TTGTGGCTGCTGATGCAGCGCCAAAGTGGCTGAGATATTGTTACTGGGTCGCTCCAAATAGCTGCCATGTCCTGGCACGG
      GCATTGACATTGGCATCTCAAGATGCTGGTGGTGGTGATTCAGCTGCGCTTGCTGTAGATGCTGCTGCGGAAGTTGCTGC
      TGGTGGGAGAGTTGTGCCTTCAGGAGACTGGGAGATGCCTGCAGCGGAGTGTTGCTGGACACACCGACGCTACTGCCGCC
      AGGACTGGGACCACCCTCCTTCAGCGGAACGCCGATAGTGAGACGCACATGAAGACCAGACTCCTTGATGAGATTCACTA
      CATCGCCGTGCGACATGCCAGCTATCTCGATGCGGTTTACTGCCACTATGCGATCGCCCACCTTGAGCTCTCCACAACGA
      TCCGCCGGACTGCCGGGTATTAGTTTCCCTTAATACGTTGATATGTTAGATGAATTGAAACAAAGTCTAAAGTCAGTGGC
      ATACCTATTGTCGAGCCGTAATAGTGGTTCGATGATGATATGATAACAAATCCGAAGCCCTCGTTTTCATGCCGGCTGAC
      AATCACATCATAAGGATAACGACGCAGTTGTGTGCTGACTGGCGCCTGCTGCAAAAGCGGAGTTCGACGACGGCGAAGGA
      TCATGGTAACCTGCCCGCGTAGCGCCGATTCTCCCACCAAAGAAACAACTTTGTGATGCGACGAATTAAGCTGAATTAAA
      CACAGAAGTTAGCCATAATTTAACTAATGTGTGCATAAGTTAACGTACCACGTTGATGCCATCGATGCTCAGGATTTCAT
      CACCCGTATTAATGCGCTGATCCTGATCAGCGGCGCCACCAGGCACTATGTGGCCCACAGTAACCTGAGAACCTTCCTCG
      GTGCCGCCGACTATGCGAAAGCCGAAACCCAAAGCCTGGCGCTCAAGAGTGACCTCAGTTAACTCGCACTGGTCCGCGTC
      CTCGGAGACATCCAGCAAGGCTCCGTTTCGCCAGCTTGGCGAATGCTGCATCTGCTGCGGAGGATCCAGGTTGGCGAAGC
      CCACACGCCTGCGATCGCTAAGCAGCTCGTTGACGCGTCGTTGGATTCGTTCGTTTTGCAGATGCGCAGTCTGCAGCGGC
      GAGTACTGACCAGTGGTTCCCGACATGGCAGCCTGCTGGGCCTGGACAAAGTATCCAGGGCGGTAGCGCTGCGCCTGGCA
      GTCGTAGCAGTAGCAAGACTCGTGATGAGCCAGCGGTAGGGGTAGGGGCTGCATACTGGGCGGCATGCCGTAAATGCCAC
      CATTAGCATCTCCCTGAAGCGTCACCTCCGCCAGACGCTCGCTCAGGCGACTAATCTTGGGATATGGATCCATATAGGGA
      ATGTCGTCCAGCTCCTGCAAACTGCTGTTCGACTTTCCTTGGGTCTGCAGCTGAAGCGGTTTCCTCTCCGCGGCAGCAGC
      ACCGTCACCCTCGTCGTCCACCTCGTTGTTCGGCGATTGAATTTGAACCCGTGACCGTCGCGTGTCCACTAGTGGTGTCT
      TTGGGCGCATGGGTAGCACCTCCTTCACCTGGGTGCTGTACAGGTCCGCCGTGGGCGTCTTGCTGCGAAACAGGCCGCTG
      CCCACAAAGTTCTTTCGCAGCTTGGCCACATTACCCACCTGGTTAAGTTGGGCGAGCGTGTTGTTGGCCGGCGGATCCGG
      CGGCGTTCGCTGAATCTTCACAGCTGTGGGCGTTGTCTGGCTGCACTCTTTAAGAAGCTCTACCACGTAGAAGTGCGGCT
      TGTTGCGCACGTTTAAGCCATTGATTTCCAGAAGAACGTCACCTTCCATCAGCTGAGTGCAGCAGTTGCGATCCAGGATC
      TTCTTTACGATCTGACCACAGGCGGAATCGGCAATGGTGAAGCCGAAACCCATCGAGCCCTTCATGATCGAAAAGGTATA
      GATCTCGGGTTTCTTCATTAGAATGAAACCACTGCCGGAACCGCTGGTTTTCTTCGCTCCCTCGCCGGACAAATCCAAGA
      AGTTGTAATTGCCGTCCATGTTGAGGCGTCGCTGCTTGTCCGACTCGCGCCCATCCACCGCCATGGTGGTCACTACCTCG
      GTGTTGGGATCATTCGGATCAAAGGGCAGCGGATATCCACGGCAAACTTCAAGGGCGGCCCTCTCGCCAGGCAGAATCGA
      CTGAAAGATATTGACCATGTCGTGGTGCGTGTAGCCCAGCACACAGGTGTCATTCACATAGACCAGAACATCTCCCGTTT
      GCAGCTGGCCATCCAGCCAGGCAGGTCCGTTTGGCACCACTGTCTTGATCTGGAGAAACTCCTCCACATCCCCACCAGCG
      CTCCCGTCACTTCCCACAATCGTAAAACCCAGACCGCGGGATGACTTCAGCAGCGTAGTGTTGATACGCTGGCCCTGCAG
      CTCGGCGGGATTGCGGGTGAACTTGTACGGCAGCTTCATTGGGCTCTCATCCTCCTCCTGTTCGTGCGCTTCTGCCGCCT
      CTGTGGGCATTGTTTCTGACAACGCAGTGGGTGTCTTGGAGCGCTGTTCCTGCATCTGCTGTTGTTGCTGTTGCATCTGC
      TGTTGCTGTTGGCTCTGCTCGGCCGCCCGTCGCTTGGCCTCCAGCACTGGGTTCTCGTACTGCGTCCGCCGGTTTACATG
      ATCGATAAAGTACATTCCATACATGGAGTCCTCGATCTTCTCCCATCCGTAAGGCAGCTCGTCCTCGCAGCAATCCTCCA
      GTGACTTTTTCTGGTACTTGGAGAGCCGCGGATCCAGCCAGTGAGAGGTGCCCGTGTTGTGACTGTACGATATAGTGTAT
      AAGGTCAATATATATGTTTCTAGCTTCTTACCATGTATTATACTCACTCGATGAAGTAGAGCTCGCCGCGTTCAGTGTAT
      GCTGTTTCCCATTTGGGCGGAAGTGGTCCCAATCCGTCGCCCGGATCATCGTGACTCTCGTGGTTCTGATGCTGGACATC
      TCCAACTCCGCACTCGCTACCAAGGCTGCTGTCCCCCGTCTCGCCGTTGTAGTAGGTGTTCTGCAGCAGGTTCTCTGTGG
      AATATATGTAACATATTACTTGATTATTTACTGTACGAACAGTGCAGTTTATGCCAGTTAATCAGTATAGAAAATCAATC
      ACCAAACCCAAATCGTTCAATGAACCCCTTTTACAGGTGGCATTTTGAGCTGGTGAAGTTTTGATGCTCAGCCAGCCGAA
      AATAGTTGGTGTGGTCTTTTGAAATTGAAGCACATAGACAACGAACCCCAATCCCTAGTCCGCATCTCGCAGCCCATTGC
      CCAGCCCAATCCCCGCCAGCTCTATTGGGAGTCCGGTGAAGCGTGAAGCGTTTTCGATTGGGGCAAGCCAGAATAATAAT
      TATTATTAGCAGTTGCCAGTTGGTGGCAGACAGGCTCTGGTTAGACTGTGACCTACTTTGCTGGCCCACGAGATGGCCAG
      TGGCCACTACGAGTAAGCACTCACTCACTCATAGTCCCCAATCAAGTCGGATGAGTAATGGGGAAATGTTAATTATGGCC
      AAGCGAAAGAAGTAAATGAGTGGCCTATGCTTTTAGCCAAGTTGCCCTTGGTGATTTCGCTTGGCAAGCCGCTAAGAGAT
      GATCAGAAGGTAAGCTTCAACTATGAAGTAACCATTGAAGAACTGAATATTATCAAAGTTGGATTAACATATGCTGAAAT
      ATGCATCGTTGCTCATTAAAAGAGTGAATGTAAAGTTGTCGTTAGACTTTTTTTTTTAGACCATGCGTCGTTAACCCCTT
      TCGAGGTGCATGCTCCAACCCAGTTATACATATGTACATATATAAACACATCCAGAGATAAAGCCATGCGAATAGGGCTA
      ATCGAATGTCGGGAGCGCCGGAGAGCCAACAGCCCCAGCGGAGCATCATTCAAAACGTATTGCGAATGATTTGCATAGAA
      AGATGAATATTTATGCCAGACACTTTCAACTGGAACATGGAAGTGGAGTATGTAGATGGGGCTGGGCAGGTGACACGTCT
      TTAAACGGTAAAAGCGCCATCGCTCCCTGTTTGCATTGGCTCCAAAAGAGTGGGACACAAATGGAGAGAAGCTCGTTTGA
      ATAACCACACTGAGTGAAAAGAAGTTTGAACTAATATTGAATACAGTGAATACTATATATTGAAGTATCATTAAGATTTA
      TACTAAAAAATTATTAAAACCAAATACTAATTTTATTGATTTTGATTTTTCCCTTTAATATTTATAAAAAATAAAAAAGA
      TTGAACTATTTTTTTCGTGTGCATTTCATAAGTTTATGTTGGTCTAGTCTGCAGAATTCATAGAGTGTTGCAAAGCAGAT
      TTCTGATGGGGAAAACGCTGCTGGCTAAACGAAATCGAGTCAGTTTTTCCAGCACGGAAGTTGTTGGCGGCACAGTTTGC
      CTTGGACTCCCAAACCATCCCATGATCCAGCACCCACCACCCACTTCGTTTTCCTTCGCCGCTTCGTTCGCAACTTCATT
      CGACTGCATTGTGTAAATATTTGTAGAATGCGAGGCGAGGCGAGAACGAGAGGGTATTTGATCAGCAGATGTGGCACAGA
      AATAATGCTCACCGCTGTATATACATACATATATGGAATGTACCAGGGCTTCTCTAGAATCCAAACTAAATGCTGTTTAC
      CTTTCATCCCTACCCAGTTTGGACAACCAGTCCCGAGCTCTACTTGCCGTGTATCTCCTGCTCTTGGACACATATATATG
      AAGGCAAATATGTGCCACACGCTGCTCCAAATATGCTGAACATGTTTTCTTATCTGCACCTACCAGATAAGCTAAGCAAA
      TGTGTGTTCTCTTCTATGAAAACAGAACGTAAGATCGCTAAATGTTGGGATTGCAAAGTTTTTTGTGATTTTCCCTTGTA
      CATAAGTTTCAAAATCTGAGCAGATTATAGAGCACTAAAAGATCTTCCATTGTAGCTACGCCGCTACTTAATCTATAAAA
      ATTGCTCACTCGCCCAAAAAGATCGCATATCATGCAGGCCAGCGCCAGCAGGCAATCCAAGTGACTCATCTGCTGGGAAT
      GTTGGCTCGAATGGATCTTGAAATTGAAAAGATCGAGTCGAAGAAGAGAAGCAAGACTTTGTGCTACACAAAGCGTGTCC
      ATTACTCATAACAACAGGGATTGCCGTAGTCCGTGTGTCGTTGTTGATAATGATTGACATACGATTATTTGCCAAGATTG
      TGGCTAATTGCACACGCGGGTTTCGGAGAAACCGTTTAGCCCAGATCCTATCAAGACAGCTCAATCTGAACGCCAAACGG
      CGATGCATTAATGCTTCGGTAAATGTCTAAAAATAATTAAAACAAAACACAAAGCACGAGCCGCAGAGCATGGAACTCTT
      GGCCAACATGTGGTACAACAATTGTAGCAGACACAAATACAAAAATCACCGAGTTACGTGAAGTTGTACACAAAATATGC
      GCCGTCAGTTCATTGACTTTGACCCAAATGGAAAACAAAAGTCGAAACGGAAAGCTACGCACGCGTCTTCTGTGGGTCCA
      CCAGGGTCACGGGGGGCGTGGCAGGTCACGGGTGGAGCCCTAGGGGGCGTGACGGCAAACGGCGCGAGCTGCCTAAGTAC
      CACCAGTTATTATTTCGCCTGCCCAAAAAGCGTTTGTAGTTGCTGCTTCAACTAACATTACAATTAGCTAATTGCCGATT
      TTAGTCATAGTGATTTTAGCTAATTTAGCTAAATAGTAGTATGAATTATTAGCATTCACTTTTAACTACTTATTCCTAAC
      TGTCCATCACTGATCTAATAAAAGTTAATTTATGTGCATTTGAAACTCAACTTTGTAAGTTGTCTTCTCAAATCGTGTCA
      CTTGGCACGATTTTTTTCGACAAGTTGAGAATTCAAGGAAATCGTTTGCTTAACTGAAATAACAGAGAAAGTCGGGACCT
      TCTACTTTAGCTGTCTGTATTTTTTTTTACCAATTTCATTTAGCACTGAGTTATGTATAAATCTGTTTTAAGTGCTATAT
      TTTCCCTGCACAGTTTATAACCGGAACTTTCTCGATTTCTTTGTAATATAAAGAAACTTTTAATTGGCAAGGTGAGTGCC
      TCATGTCGCTGCTAACTTTAATTTGTGTAATTCCGTCGTAACGTCAACATAAATTAGCCAGTAATGAGATGCTTGTTCCG
      CCGCTTTCTTGCCCGCTAGATTCATTCTGCTGTCCAGTGCAATTTCCCGAGTTACGCAATGAGCCAGCCATGGGATGCCC
      CTCAATTAGTTGTCCAACTGAATGCACGAAACCATGGCAATTACTTCGCCCGCATTGCAGGCATGCAGAATGACTCCTGG
      CCGAAGTACTGCGGTCAAAGTCCAGGCCACTCAATTGATGTCATCGAGTCTACGCGACCCACTTGGAATGGGGAAGTTAA
      GTCAACGTCTTTGTTCTGGCAGGGAATGATGGGTGTGCCCCCCTGTGTCAGCTGTGACGACTCCTTCACGAACTCCTTGC
      CTGCTCCGCCTGATGATAGCATCTAATTGGCATTGCTGCTTCGTTAACTTGGCTCACATGGCATGCCATAAACTAGAGTT
      ACCCTTCCGCTGTCGCAATCAAGAAATTAATAATCGCAACACATGATGTGCAGGGGACAGTGGAACAGTGGAGCAACTCG
      AGGCTTCAATGCGACCGGAGTTGGTTCTCGCCACATCTGCTAATTGCCACTGACGTGAGGCGTGAATGATAAGCAAGATA
      CAATGTGCGGCTGCTCCAGGTGGGTGAGTCTAAAGTCGACGACGAGTGCGAGTTCGTTGCCACCACTTGAGACTTGATTG
      AAACTCCTGGGATTCCGGGCTTCAAATAACAACCCTTTGGCATTCATCTAATAAAATCACACCTTTCCCACTAATTGAGT
      TGCTTAACGCAGACGGCCAACCCAAAATGAGAGGAGCTTACCACTTAACAATGGGACAGGAATGACAGAGGGAAACAGAT
      GATTCAGTTTGAGATACATACTAACCAGCTGGCTTGCCCAACTTCCGAAAGCGATTTCCCATCTACACCTAGATGGTGTT
      GTCCAAAATATACATACGTATACTTGATGAGTGGGTTGTGTGTTTTTTAAATGGCAGATGATGTGAAAAACTTGATGAGT
      GCTTAGAAAGACTAACAAGTTAATATTCGACTGAGACTTTTGCACTTATAAGGTTATGAAATTCTTAATATTCATTTATA
      CTCGCATGTTTTAGGCGCTAGTTAGTCAAATTCAAGTATGGATATCTTGTGCTTAAAACGTTCAACTAATGGTTTGTTCG
      AACATTTTAACCTAATAGCACCAATCACACCTACAAGCTTAACGACGATCGAATATATATACTATTAAATTCCCACATCA
      TCTAGACCGGCAATTATTAACCCCTCCGAACACACATGCTCCAAAATCGAGGTCGCTTTGAAAATAAACCAGCTTTCTGG
      GTTTCATTCATGAATGTTCGCGAGACAATGCAGCTAGTCTGGGTTAGATGCCAAGTGGATCGACCAGGTTCATGGGGCTT
      CAACCACGTTGGTAAAGTGATGACAGGTGTGGATTAAATGAAACGGGAGTAGCATAGCCGACAGTTGAATGGATAAATAA
      GACAAGAAGGTGAAACCGAGTGTATTATTGAAAGTGCAGCACTTAGTCCTCCAAGAACTGGCTAAGAACGAAGACCCACA
      ACCAACTCTCGAGCTAAGTTAGCGGGTTAACAAGAAAGTGAGTTTTGGTTTACCAATGGTAGCAATGATATCACACCATT
      CCAGGCACGTGGCCATCCAAACTTCCACCCTGATGTTTGCTTACTTTTTTTGTTTATTTTGATCCCAACTCCCCGCCGTG
      AGTAGACTAATTTCGTTGGCACTACAAGTGCATTTCGAGTTGAAACCCAAACCAACCAAACCAAAATGTGTAATTGAAAC
      TGAAACGAAAGTGGAAGTGGGAGTGGAATCATAGCCATTGGCCATGTGTGGGCGGAAATGAGTCACTTGAGACGAACGCC
      CTAAATTAGGTTCAAGAGCTGCTCCGTTGCAAATTAATTTTAATATTTTATTGGGCGAAACGAAAATGGAAATTCGATTT
      GGAGCACCGGCGCGGCAAACCACACAAACAAGCCATCTACATAATTGATAGCATCATGCGACGGTTAAATTTGTTTTAAC
      ATGCTTAATGTATTTTACTTATTTAGACCGTATTAATTATAATTAAGTAAAAACACTTTATGGCATTCATTTATAATGAA
      TACAATTCACTTTTCATTACCTCAGATTCAGATTGCACTTAGATTAGAAATTCTTGCTCAAATTAAAGTTTATTTAAATA
      TGATTTCTTGAGGAATTTGCCTTACCTTTGCTACCCTTGAGAATGCTGTTGGGTGGACCGCCTCGTCCGGTGGCTGCTCC
      TCCGTGCACTCCGTTGCTGCCAATGCCATTGCTTGGCAATCCGGAGATGAACTGATTATGCACCGACATCTGGCTGTTTA
      GCGAGGAGGTGCCACTCAACGAGGCAACATCCTCGCGTGAAGCTGAATTTCCAATCACTGCTGAGGCGGATTTCTTAAGT
      GCCGGCGGCGGTGGCGGACGTAGATGGTGGCCACCTGGTGGCGCTAAACCGCCAGACTTCTCCCCGTTCCCAGTTACAGT
      TCCATTGCCATGCCCGCTCCCGTTACCAACCACATCTGTGCCAGCCGAGGACAGTGTCTGGGAAGCGGCTGCCATTTCGC
      CGGCATCGCCACCATCGTCCACATTGTCACGACTGCAATTGAATTTTCTGCTGCTTCCGTTGGCAAGGCTAGAATTTAGA
      TTCGAGTTTCCGTTAAATGTTGCAAAACTGGTCGCGGCGGCAACAGGATGTGGATGTGGATGTGGATGGGAGTGCTGGTG
      TTGGTGGGAAGCATTCAGAGGCGCCAACTGTTGCGGCTGTTGTTGCTGATAGAAGTGATTGCTGTTGAAATGCTGCTGTT
      GCTGCTGCTGCTGCTGCTGTTGCTGCTGCAGCATTAGGTAATCGGTGGGAGACTTGGCGGTGGCCACGCCCCTGGCCGCC
      ACACCTGCTCCTCCGCCGGCTGTCGACGTTGTCGTGGCCGTGATTATTGGCATTTTAAGCCGGCTGACTGCCTGGTTTTT
      AGCTGTCTTTAGCTGCGATCGCAATCTCTCACACAGTTGAATTGTTTTCAGGCACTAGCGCTATTTGGCTCCATTGCATT
      TGAGTTTCGTTATTTAATACTTTTGTCGATTGTCTCGATTTCGCTTTGTTTCGCTTGTCTGCGTGAATGTTTTTAGATAA
      ACTTTGAACGCTTCTTCATTTTGCCGTTTAAATAATTGTTATGTCATTGAGCTGTCATTCCGGTTCGTGAAGCTGCAAAA
      CAGAACAATCAAAAGAGAAACCATTAATTAGCAGTATGCAAAGTAATATAAACAATTACCATGTGTATGCATACAATAAT
      CGTAAAGCAATAAAGAACGCTTCAGTTCGATTTGGCATGATGCTCATTTTTATTTTAAGATGCAAATATGTGCGACCTCT
      TTTAATATTTGCTAAAATGTATTTAAAACTGGTGTTTTAAAGCAATATATTTAGCAACCCAATAGAAACAGCTGAGTTCC
      ATTAACTGGAATCTCAAGAGATTGGGAACTCTTGCTTGAAGATTTACAACACTTTATTATTATGAAATTCCTTAATACCC
      GCAACTTAAACTGCATGGCATGAAAATCATCGCCACATACTTTGAATATCCAACATTGCTGGGTGGTACCAGCTCGCTCT
      CCACCTCCAAACCTCCAAACCAAGTCCCAGAGCCAACTATCCAGTTAGACAGCTCCCGGCCAGACAAGCGCATTGTTCGA
      TGGCTTGGTCCAGACTGCAGTTGCAAGTGGGGCCAATCAGTAGATTGTTCAGTTAGGCTAGTCAGTATCCATGGCAACCA
      TAGCCGCAGAAAAAAAAACCCCTCCATTGTTGACATTGCAATTTAACGGCGAGCTGCTTCGACTTTCCCATGCCAGACGC
      ATAGTTATAATTATTTTTGTGTGCATTTCATGGCGAGGTTTATCTTAAATTTTCGCCACTTAAAGCCATTTTTTGCAGTC
      TTCAAGTGCGCTTAAGAAAACCAGCTCGGTTTACTTGGATCCATATATAAAAAAAAAAACAAACTTTCTTTGTTTAATTT
      GGTGCAGTTAAACATTTGAGCCAGCTAGTTTTAAAACAAATTATATTTTCAGAGCAGATTGAGGCAAGTTTGCAACTCTC
      GCTACTTTTGAATATGCATTTATATGTATTTCAAAATAAAAGAGCTAGTTTCCCCGCTGCAAATATGAAAACGTTGACTC
      ACGACACACACACAATTATGAGCGCGGGGTAAGGAATAAGAAAATTAACTGTGCGAAAAAAGGGGCATCAAACACGGCAG
      CAACATAAAGTTCCTCAAGCGAAAAATTTACTCCAATGAGAAAAAAGGCACAACGACGATCGTTGTGTGGATGGAAGCGG
      CATGGAGGTGGCCACAGGGCAGGGGGAGTACTCCGTGAGGCACACAGCGAGCTGCGGGCACCGCCAAGCCAAGAATTCCA
      GAAACGACAAACAAAACAACGGCGGAGAGAAACAAGTTTTTCAGAGTATGCCAGCAGATCGCCAGAAAACCGAAAACTGA
      ACTAAGAACTGAAAACCGAAAAACGAAAACTGAAAACCGAAAGGCAACCCCCACAAGTACACAAAAGAAAACGTATAGAG
      TCCCTTTTGTGGATTACGATTTGATAAGGATTTGGATATTGTCTGTTTTCTGTGTCCCATAATTATAGGGATATTGCTCT
      AAAAGTACCAATTCCACTGCTCGTTTCTTTGAGTGTAGGGACACGTAACAGGAACGATCCGCGATGGTGGTAGCGATGGT
      GGTTGCTCCACTTGCCACACCGAGATCCTTCGCAGACCGCAAATGTATGTGCCCAGCCACCTGTCGTTTGAGCATTTCCC
      ATTAGAGAAAAGCCGCAAAAGGAGCGGCAAGCAAAGTTGGTTGAAGGCAAGGAAGGAAAGGAAAGGAAAAGGAAAAAAAA
      AGATCGGGCCACTTTCGACAAACAGGCGGCGCACGACCAGAAAAAAAATGCCTAGTAACAAATGGCAATCAACAAGGGGA
      GCGGCTATGGAAAAGCAAGTGAAAAGCGAATAGTTAAGGCCACAATTTCACTGCACGGGGAAAATTCATCATCGGCGTTT
      ATGGGCGCCTGAGGTTTACTGTGAAGTGAGTTGCAATCATATCCAAATGTGGTTAGGCCAGCACGTTATCTTCTTATTTT
      TGCACATTTAAGTTGGGATTTGATTGCATGAGGATATAACCTATTATTAGCAAAAGAAAGTCTTAACTGTTAGTACTAGT
      AAGCATTGATAAAAGCATGAACAGTTCTTCAGAAACTAGCAAGTTATGCTCGAAGTAAACAAAATCATCTTTTTTTCATG
      CAAATTGATCAGCAATCATGGAAACTAGCTTTCAACAGTCGAGTGCCAGATACATTTGCAAATATTTATCTTTTCACGCA
      CGCCTCGCTAATTGCCATCGATCAGAGATAAACTTTCTATCGGGTAATGAAGCAAAGTGGTCAATGCCATGGGCAGAAAT
      TGGAAAAATGTCAATGGGGGAGATAAATAACATTTTCAGTCACTTTCAAAATTCGCACCTTGTTTATTTCTGCTGCCGTT
      TTGAGTTGTTTTGCTTATTTATTTGGCTCGAAAACGAGTGTTAAGCGAGGGATCGATGATCAGTTTTGAGCATCCAAGTG
      TCGAACACTTTCCATTTTTATGGTGATTTTCGTTGTTTCTCTTTTTTTTTCTGAAAACGCGTATTTCTGAACACACATGC
      ACATACACTTGTCAACACAACTGAGAGTTGCAGTGGCACTTGTTAACTGTGGTATTATGGCCAAGTTTTTGAACTTGTTG
      TGGGCCAAAAACCTCCTGGAAAACCCGTTGGAATCGCCGAACGACGTTACACACCTGCGACGATATGTGAAACGAGTTGC
      TCGTTTTCCATTTAACGCTGCATTCAATTGCAATTCGATTTTCCCGCAACGCGAACCGCACTCCACGGAATATCGAAAAC
      AAATGAAAACTGAGGTGGCGCGTTGAGTTGAGTTGGAAAACCTGTTGCTGCCAAACGACGCACACAGATGCAAATGCTCA
      GCGACAACAAGCAAATGCAGTCTATTTCGTCCTTTAAAAGGCACTGGAAAGTCTCGAACTTCACTGTTTGGGTAACATGA
      AATCTTTAGCTAAACGATTGTCTCAACTTTAATTGCAAATTAATGGGAAACAAATTAAAAACACGAAACGAAAAACAAAA
      CAGAAAACAAAATAACGCGACGCTCAACACGACTGCTTCGCAGGCAGTTATCGACTGATGCTTATCGGTCGATATTCACC
      ACACCTAGTATGACCACAGGGGCGATACCCTTTGCTTGGCGCCATTATCGATTTCCGATCGTTATTTTCAAATTCGAAAT
      ATAAACAGCAAACCTTTAATAATGCTTCAATCAGAAAACATATAAATCAGGAAAAAATAAATCGTATTTTAAAATTATCA
      GTTTATTTATTAAATTCTAAAGTATATACCCGCGATGGAAGTTGGTGGTAGGCATTACATAAAATGAGCATCGCACCTCC
      GCTTGATATCACTAACCTTTTGTAGTTACCCTAAACAACGAACTCGAGGAAAAGATTTCGGAAGCATTTTGCATATTTGA
      TACTCATGGCGATAAGTATATTGATTCCCGCAATGTCGGCAACGTGCTCCGATTTTTAGGTTGCGCGCCCACCGAAAAAG
      AGGTCGAAGATGTCATTAAAGCCACCGATTCCGTCGACTATCCAGGCGAAGCCCATTTGGTGAAGTTCATGGAACACGTT
      TCCAAACTGCTGATGGATCGACAGTTATTCAATATACTTTAGGTTTGTTTAGCAACTAACGATATTTGTCCACAGAATGG
      AACCAGCCTCGTCGGAAAAGCTTCTCGAGGCCTTTGAGACCCTGGATCCAGAAAATAAAAAATATCTGACCAAGGAGTAC
      TTCGGCAAATTAATGGCGGAGGAAGGAGAACCTTTCTCCGCTGAAGAATTGGATGCTATGTGGCCTGTGGCAATTGATCC
      CATTACTGGACACATTCCCTACACCTTCTACATAAATCAACTCAGGGTAAGATCGCATTTCCCAACTACTTTTGATTGGA
      TTCATCTAAAATTTCCAGCACAAGCCTGATATCTATGAAATTGCCGAGGTTATCAAGGAGGAACTAGCACAAGCCGAAAA
      AGAAAAGGGCAAGAAACCACAACAACCACTGTTTTAGATGCCCCTTTAATCAAGCAATTGCAAATAACGCGGAAAATAAA
      TTTATACATTTTATAACAAATAATTTCCTTTCTCGTTTTTACTGTTCCACATTGAGATATAGACGGTCACACTGCCATGC
      GCAATTCGAGATGGCATAGTCGTTGTTCTATGTTTGGATATTAAAATGAATTGTGTGAAAAATTTAAGGAACTATTTTTT
      GTTTTAAGATATTGCCTGAAATGTTACAATATATTTATTAAATCCAATAAAAAAAAATTTACAATACATTTAAGCGCTTT
      TACAAATCATCGTTGCTCTAAATTAACTGAATTTGTAATCGATAGCCCGATACGTGCTGCTCCATCCCTCATTACCCCAA
      CTCTTCTAGAAAAACACGTCAGCTTTTCACAGCCATTCGGAAAAGAACACGTCAGCAGAAAGGAAAACTGGTCGGTCGAT
      ATTGCAAAGGTGGATGAGAAAATTGCGTGAGACGGAGCCAGAAAAGCCCGAGTCGGCGGCGATGAAGAGATTCAAACCAG
      CAGAGCGTCCGAGAAGCGCAGTCGAAGTTCATGAGACGACCTAAAACAAGCAAAAGTTAAAATACGCTCTTACAATGCAA
      ATCTAAGTGGAAAGTCGCTTTTCACAATTGCACACAGCACACAGCAGTTTATCATTTAGCCCCGAACCAGTTAAACATGG
      CACCCACAGCAAACACAGTGCTAATTACCGTGCCGCGGACAGCAATCACATCGAATAATCTGCCCAAATTGCGGCCCGCC
      CCCCTTACGGCAGCTCTGCTGAAGGTGTCGGCCACGCCCTCCGCCTCGCCCACGCCCTCGAGTTCGGGATACGCATCCTC
      GTCGAACATGGATGACGATAACATGGCTGCATCCCAGCCCAAGGCCAAGAAGCGTCGCCTGGACCATCTAACCTGGGAGG
      AGAAAGTGCAAAGAAAGTAAGTCCACCCAACTTTTAACCAAATTTGAGCGCCTTATTTAACTGTTATTATCGAACAACAG
      GAAGCTAAAGAACCGTGTGGCCGCCCAGACATCGCGTGACCGCAAGAAGGCACGCATGGAGGAGATGGACTACGAGATCA
      AGGAGCTGACAGACAGAACGGAAATACTACAGAACAAGTGCGATAGCCTGCAGGCCATCAACGAGTCACTGCTGGCCAAG
      AACCACAAGCTGGACTCGGAGCTGGAGCTGCTGCGCCAAGAACTCGCCGAACTGAAGCAGCAACAGCAGCACAACACCAG
      ATGCATCAGCCAATCCAACGCCAGCGCAGGCGCTGAGGGCTGTGCGTCCACCAACCTTGGATCTGCAGCATCCAAAGCTG
      ACCCTCTGCCGCAGGGTATACAACAGGTGGACACACAGTCGTCAGCGCGTCTGCTGGCGGAGCAGCTGAAGAGCAGCAAG
      AGCCTGGCCTCACTCTGGAAAGTTGTGGCCCTCTGCCTACTCTACAAGACATGCTTGGCGTCGACGAAGAGTTCGACGTC
      AAGCGCCTCGAAGAGCTGGCCGAAAGTCTGCTCGCAGATATCACAGCAGACCTGGAAACAGGCGCTGGAGCGAGCAGCCC
      AGCTGCTGCCCAAGATGCAGGCAACGCAGAGCGATTGCCTGGACCAATGGTGGGGCCCGCAGCAGAGCGCTTGGAATCCG
      ACGGGCATAGAGCTAATGGCCTGAATGTTGAGCAGGAACAGGAAACCGAGCACAAGGTCAGCCTAAATGTGCAGATGTTG
      AAGATAAATGGAAACCCACAGCATACCACAGCAGCGCCAGCCTCGAGAACAGCCACAATCACAGCGACAGCGGCCGCCTC
      GCAACTACAGGCCACTCCGGACACAGTGTACGGCACGTATGATGCCAAGACGAACTCGATCACCATCGTGATGGACGGGG
      ATGCGGTGCCGGTGAACGAGGCCGTCGAGGAGATCTACTGTGACGGCGTCAGCGCTGGCGACGACTCAACGGACGTGATC
      ATGAAGTGTCCGCCGCCAGCGACGTCTCCGTCACAGGTCTATCTCAACGTGATGAACGCCGTCGACAATTCGGACGACGA
      GGAAAGCTTCGATCCGATCGACCGATTCCTACGTCCGCGCGTTAAGGCGATCTCCCCGTTGGCCAAATCCCCCGCATTGT
      CTCTACACTCGGCCACCTCGGACCATGGATACGAGTCCATACTGGGCTCTCCCACATCCGTGGCTCTCACTCTGCCCGCA
      GATGAGGACGATTTCCCCTGGGAGAGCAACTTTGACGAGCTGTTTCCCAGTTTGATCTGAGTTTTTCAAGCTGAAAACTT
      CGTTCTGTCTCTCTTTTATTGTTAAGTTTGGCCGGCCGCCGTTTGTTTAAGTTTTTTAGTTGATAGGCTGTACATAAATT
      CATAATCGAAGGCTTTATATATGATACTGTAGTTAGAGCGCTAAGTTTAGCTGTAGGTTTCCATTTATATTTAACAATCT
      CTAACCACATAGGCTTATGATTACTCTTATATGTATGTATTGTGCTCAAAGAATTTGAAAAAAAAACATTTGACTAAAAA
      ATATTCAAAATATAAACCAAACCAAACAACAAGCTCTTTGTTTTTGTTTACTCTAGGCGAAACAGAACTTTGAACTGCGT
      ATGATAAATAGTTAATCACGCCACTTCTCTAGCATCACGCCACTTTTTTATGACGCAATTTCTGCGTAGATGATGGGACA
      GTTTTAGGTGTAAGCATATGAGTCATTTTGTTTTTATTAACCAAATATATATATATTACAAAAAGTGAGTTGAACTGACT
      GCAGATAATGCGGATAGGTGAAATAAAACCACAACTATGCTCTGAAATATATGCACCTTATTTATTAGTATATTATTCAT
      TAATAAGACGAAATACAGCTCTGTTTTTCTCCAAACTGAACTAGGATTTAAACAAGATTTTGCTAAGCTCGAAAAATATA
      TTTTTTAAAGAATATAAATAGAGCCACCCTAATGCGCCAGCAAAAGCGAATTTGTTTCGGAACTAGTTCGAAAAAGTTGT
      TTATAGACTTGAACCAGTTTTTGCTTACGAACCACATACCTGTGATTTTGCAGAAAGATAAACAATTTTTAAATGCAATA
      GAGTGTACGGTTAAACAGAAATGACGGAACCAACGAGCAAGACACCGGATGCGGTTCCGGAATCACCCGTATCACTGCCC
      ATCGCCTCCCAATCCATGGATACGGCGACCATTGAAGATTTCGACGAGGACAAACCGGCCAAGGGAAAGAAGAAAGCCAA
      GAATCCAAAGGGTCGCCACTCGGATTCCGACATCGGCTCCGAACTGAAGAAGCTGGCCCAGCGCCGGATCAACGTAGCCG
      GTGCTCCAAAAATGCCACTTAATGGCTACGTCCGCTTCATGAACGATCGACGCGAGGAACTGCGACGGGAGCAGCCACAA
      CGTACTGCCCTGGAGCACACAAGGATCATCGGCGAGGAGTGGCATCAGCTGCCCGAGGAGCGCAAGTTGCCCTACATCGA
      GGCAGCCGCCAAGGACAAGGCCATGTAAGCTCACACTTCGTTTCCAACCCACAAAATCTAAACATATCTTCCCATTTTCG
      TAGATATCAGGAGCAGTTGCAAATGTTTCTCAAGGAACACCCCGAAATTGTGGCCAACGAGTTGGCCAAAGCCAAGAAAG
      CCACAAAACTGGATGGTTCGCCCAAGGAAAAGACGCCGAAGGGTGAATCAGCCTTGGGCAAGGCGAAGAAGACCAAGGCA
      AAGCCGGTTAAGCGGCAGAGCGAGGATCCGGATGATGTGCCTCTGGCCAAGGTGAAGCGTGCCCAGACACCACCGCCTCC
      CACACCGCCAGCGGCTCCAGTACAGCCCCCTCCCAGCAGCGTGCCACCTGCGACACCTGCACCACGACCGCTGCAGCCCG
      GCGAGATACCCATCTACACCAACGAGTTCATCGAACACAATCGCAGCACGGAGAATGAGCTGAGGACGCTGCGCAAGGCC
      AAGACCGATCTGGAGCAGCAGAACGCTGTGCTGGAACAGCACGTAGATAATACGAAAGCCGGGTACGCCAAGGTGATGGG
      CGAGGTAACTGAGCTCATGGAGGAGAACCAACGCCTGGAGACCTATTTGCGCGCCTTGCGCCAGAAACTGGTCGCAGCTC
      TCGGCGGAATCTCGATGCCACCACTGGAGCCAAGTGGTCCCAGCGTTGGCAACATTGACAAGTACATCCGGCACTTAGCC
      GGGCTCGTCACTCAGCCAAGCAACGTCACTTTGATTAAGGCACGAGAGGCGCTGCGTAAAGTGGACACCAGTAGCTTGCT
      AAAACCGTGATTCATAGTACAGTATTCATAGCGTTAATAACTTCACCATAAACAATAGTCATAGTCATAGAACAATAGTT
      ATCAATGCCAAGGATATCAAAAGAGAAAACCGAATAACAATAAAATATCCGCAGCATTTGTATGTAGCCAAGTTTTGGGA
      GCGCCCACTTTTGTATTTGTTAACGTCTGTAAGTTAGGAGACTACTCGTATGTACCCAAGAATATCCTCATTTTTAGTTG
      TCCTTGGGAGCGTCAACGCCGAGAGCGAGGCTGCGATGAGAGGGAAAACGTGGCACTTTACGTGGTCCTGCCGTGATCAG
      TCCGGCATCGCCATCCACGGAACTCTGCAGCCTTGGCGCCTTGGTCCGACGATTCAAACAGTTGCGTAGAATATAGTAGC
      CTCCCAGCATCAGGGGAATCACCATTACCGGGTGACACGCTATCCCAAGCACAAACAGAAATGTGGACATCATCAGGTTG
      ATTAGGGCCTCTGTGGATCGGGTCGTGCCGATTGAGTAAGGCGAACATGGTCGTGAGCGATACACTTACGTTCAATGCTC
      GAAATGGTGGCCACTGTTGTGTAGATCGCATACGAAATGGCTTCAAGCACACTATAAATATAGTAGATCAGCATTTTGGA
      TTTGTTGAATTTCCTGGTGGAACTGAACTGCTAAAGCGATTCGGGCAACTGGGAAAAGTCAAAAAGTACAACTGAAGCAA
      AGGTTCCTACGACTATGAAACAATAAGAAAAACTAAATTAACTAAATTAATCAAAATAGAATTTATACTTGCTTCTCGCA
      GCGAAAGGTTTCTTTATTATTAAACAAAATAGTCGACGTTTCACTTCGCGTAAATAAACTAAAGCGTTTCTCTTAGTTGT
      TTTCGATTTTTTGTTTCTTAGGAACAGCAGAACTAAACAAAAATAAATTAAAACTTAAAAGAAAATCGTTTTTCGTTTGA
      TGTTTGTTTTCAAAAAGTATAGGTTCTAAATTATAGCATACATTTAAGGTTTTATAACAAAAATAATTTAATGAGATAAT
      AAATCAAGGGCGCAGACTTCAAAAATATTCCATTGAATCGTTGGGCAAGAGGCAGAGGTCGTGCAAAACTCCTGGCATCT
      CCCCAAGATCATGGCCATCACTTCGGTTGGTCCAACTCTGTCACAGCGTTTGGTAAAAAATAGAAAACATTTTACATAGG
      ATTTTGGGGGGTACTTCCTTGGCTTTCTTCATGAATTAAAAAATATACGAATCGCCATTTTCATTTTGTTATTATTTTTA
      GAAATTTGTGTTCTGTTCTTATCGCTCTCAAATGTTTCTCGAGTTCTCGAATCATCTTGTTAAAGTAATCATGTACTTTT
      CGTGTTAGAGGGAGTTTACTAAATGTGTATGTGGTGTGTGGTGTGGTGGCGGGCAGCCGATTTAAAACAGTGCTTTAAAT
      GATCTGAGAATATTGAAACGGGCGGTCAGTTATGTAAGGAAATTTCTGTTTGGAATGCCGAATTAATTGAGGAAATTGGA
      TTTGATTGAACAATTTGAATTTTTGGAAGGGGGGGAAATGTTTAGCAGTTTTGAGCTGCATTCATCAGTGCTGCCTGCGC
      TTCTGTGGCGGTGATTAAATTTTAAAGGAAACTGCTTATTTATATTACGGACATTCAGATATTGTATGCAAACATCTTCT
      TGGAACCGGCACCAGGTTACGGCCTGCTCATCGTTTGCTGTGGCGACGGTTGTTTGCGTTTCTTTTCCCTAATTCATATA
      AAGTATAATAATCTCAAACTTGTCGTCGCAGATGCATGTGCGAGGACGACGACGACGATGACGTCAAGGACTGCTGCTGC
      TGCTGCTGCTGCTGTTGGCGTCAGGCATCCGCACCGTTGGGGTTCATGCCCACCGGCGACACCACCATCATGTTGCCATT
      CTTCGGCGTGTAAACGCTAGCATTGGGATCCAGCGTTGAGCCCCCGTTTCCGTTGGCAGCAGCGGCATTGGCTGCAGCAG
      CGGCATTTGCTGCAGCCACCTGGAAGGCAGCTGCCACACTGACCGGCACCATTTGCTGCTGGGACCCAGGCCCACCGCCA
      CCCTGCTGCTGATGCTGCTGGTGTTGTTGGTGCTGCTGATGTTGTTGGTGCTGCTGCTGATGCTGCTGCTGCTGATGTTG
      CTGATGCTGTTGGTGCTGCTGTTGCTGATGCTGCTGATGTTGCTGATGTTGCTGATGCTGTTGGTGCTGTTGGTGTTGCT
      GGTGCTGCTGATGCTGTTGGTACTCCTGCGCAGCGCTCAGACTGAGCATGGGCGAGGACGGTCCGGGACCCGACTGCAAC
      GGCGGCGTGTCGTTCATGCGCAGAATGCTGCTCGACGGCCCATGTGGGCCAGTGTTCATGCACAAGTTGTCTGGCATCAC
      GGCCAAAAGTTGGGCAATCTTTGCCTTGAGATCGATGACCTCATCCTCCTTGGAGCGACGATGGTCTGCGGGAGTGGATA
      TATCAACTAGCTATCAACATTAAAACAAAAGCCAATTTTTCAACTCACTGTCAGATATTTCAATCTGGCGCTTGGCAGCG
      CCCAGAGCCGAGAACAAGTCCAGCTTGACTCTCGTCTCTGCGGATAGATTCTTCTCCAGCGTTGCGTTCTTGTCCTGCAT
      GGCAGCCAGCGCATTTAATAGAATCTCGGGATCAGGCTGGGACGATTCCCGATTGCGCAGCTTCGCCTCCAGCATGCGGT
      ACTAATGACACAATTATGGCACATTGAAGAATTGAAAAAAAGGAAACAGACTCTAACCACTAACCTCTTGTTCCACTTTT
      CTGCCATGCTCGACGGCAAGTTGCTTCGCCTCCTCCGCCTGCTTAAGATCGCTGCGCAGCCGTTTTTGCTCCTCATCCAT
      CTGCTGGCGTCGCTGCTTGCACTGGGAACTGCACTCCGGACGGGCCGCCTTCTCCTCGGCCAACTTGCGAGCCTTCTTCT
      CGTTGGACAGCTGCGAGTCCAGGGATTGCTTCTGGCGGCGCTCCTCGTTTAGTCTTCGCTCCACAGTCTGCAAATTGAGC
      ATATCAGCGTGCCGGGCGTTGTTCAGCTCTTGGATGCGCTTCTCCAGGTCGTCGCACTCCTTCTGCTTGGCCTGCAGCGT
      TGATTTGCTGGTGAGATTGGCGTCCAGCTTTTGCCGCAATTCGTTTTCGATTTGCTTCATATGGCTGATTTCAGCTCGAT
      ACTTTTTCACATCGGCCTCCAGTTTGAGACACGTTTCACAGATCTTGGAGACCACCTTGCTGGCCAGGTTCGCGATGGCA
      TTGCTGGAGGTGGAGCTCGCTGAAGATGATACCGAGCTAGCGTCGTTATTGTTGTTGTTGGCTGTGTTCTCCTTGTCCTT
      TTCCTTTTGTTGCTGAGCCAGCTGCTGCTGATGGCTGTGATTGTCCTTTGCTGCATTATCCTTCTTGCCGCGATTACGTC
      GACCTACAAAATGGCATTATGATTAGGCGTTTAAATCTTCTGTAATAACTCCATGCCCTTACCCTTAGTCGCCTTTTCAA
      CAGGTGGTGTTGGCTCCACACTGGCCGTTTCATCTTCCAGGTGATTGGCATTCCCGTTGGGAACAGCGTTACCAGCCTTT
      TTCTCTGCAAATATAAAACGATATGGGATTAATCCAAAATTCAGATCAATTTTTTAACTGGTACTAAGGAGTACGTTAAA
      TAGCATATATAAGTTAAGAACCCTCTTCTTGCGCTCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCC
      CGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTTGTGTATGTGTGCATTCGGAACAAGTGCCGTTGGTCGCACTC
      AGGGTGAGGGGTCAACGGGGGAAGCGGATATAAAAGCAGCGGGGCGGGAGAAGAGGCCCCAGTGTCGAACGGACACATAA
      CGGAACCGCTAGCAGATCGCGAACTGAATCTTAAAATAAAGCTAATCGTAAACTCGAACCCTCTTAACTATCTTGACTAT
      TATTTGGAGAACCACAGCATGTTGGTTGTCATATCAAGGTGAGGTATGCGGCAGCGAGTGCCGAGAACCCTGATGCAAGT
      GGAACTTGCGTTAACTGGCGCCCGAACAGGGACCGGCAATGTCCGGCCGATAAAAGTGATACGAAAAAATTGTGGAAATT
      TATGCGTAAAAATAGTGGTGGTGTGCATAAGTCAGATTAAGATCTGAAATCCATAAATGAAAAAGAAGTGCTGCGTGAGC
      TGTGTATAAAATGATAAAATAGCAATTACCCGCTGCCGGGGGGAACTACGCCCATCCCGGGGCGCAACAAATATTGCATA
      ATTCAATAAAAGGTGTAAAATTTCTAAAATAAAAATGTAAACCTATGTTGCGCCAAGACCTAATTTAAATTAATAAAACA
      ACGACCCGCTACCGGAGGACGCCACGTCGCCCATGCCGAGCGCAAAAGTTGTACGATACCTATAACATAATTAAAACACG
      ATCAACCCACTGCGGCGGTACGGCTTGTGGGAAAATTTTTTTTTTTTCTCTCCTTGCCAATTCGCGAGTGCAAAAGATTG
      TGTATAATAAACCAATAATTAACCATTGCAGCAGTTTACCTGCGGCAGTACGAGTAATATGAGCGCCCAGAGTGATAAGG
      TGGTGTGTGGCAACTTGTTGGATACGTTAAGTGGTGTGGAATGCACCCAAAAAAAACCGCCCAACAAGTTGTGTGGCGGC
      CGTACCTTAGTAGGCAACCAGCCAAAAGGGATACTACGGAACCACCGTGCCCAGTGCCGAAATAAATTAGAGGTCATCAA
      TAAAAAACTGTAACAGCACGCACGCAAGGAAAAAATATTGCAAAATGGAATAGCGCACAAAAATTGTATAAACACATGCA
      CAACACCACAATTCAAAGGAAAACAAGTATAGTACAATTTCCCCAATTTCCCGAAACGAAATGAATAAAAATTTTCCACA
      AATCTGATCTAAGAAATTGAGACGTGGCTTTCACATTTAAATAAGAAATACAAAAAGAAATACAAAAAAAAACTATAAAA
      AAAAATAATATAAAAAAATACAGATTATAAGAAATAAGAAATAAGAAATATAAAAAAATAAAAATATAAGTACACAAAAT
      GTACCGTACCCCCACACACTACGTAGTCTTAGAACAACTTAGACGACCAGATATTTACGAATTGTCTTTTTGTAAGCGCG
      ATTTCTGCATGCGGCGCAAATCCCGCTCACTGGACTGGCTGGGGTCGGCTTGGAAATGGGTAGCTGGATCTCCAGATGCT
      GCTGATTGGAACGCCGTCTTGGCCGCGCAAGCGACGGCTTCGAGGAACTGCAAAAACTGGAGGAGGCTAGCTGTATCCCT
      CGGCTACTGAAGTAACCAACGAGTGGTTAAGCAAGTCGACGATGGAATGCTCCTCCTGACCAACTTCAACGGAACTCTAA
      GAACGGCTGCAGAGAACTACGACCTGATCGGCTCCTTTATCATCCAATTCGACAATGAGACGATAATGGTCAACGGTCAA
      AACTATTCCAGTTACTCGGTCAGTCATCTAATGGCGATGCCGGCCGTGTTGAGCCACATAACGGCCAGCAACTTTCAACT
      TTCTCTGGAATACGTCCACGACGTGAGCATGAAGAATTTGGAAAAGATGTCCAACATGGCGAGTGAGCTACTAGCCTCTC
      TTCTCACCGAGGCGGCACTCGCAATCTGCATATTCCTAGGCTTTTATTTCCTATGGAAGAAGCTGATGTCCACCAAAGGC
      ATGCCCGATGTCCGCGAGATTGCCGCAAACTTAGAAGCATTGGGCCAAACCGAGCTGAACAAGGCTCACTAATCTGCGGG
      ACGCAGATCTTGAGGGGGGAGGAGTTAAGAACCCTCTTCTTGCGCTCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTG
      TTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTTGTGTATGTGTGCATTCGGAACAAGTGCCGT
      TGGTCGCACTCAGGGTGAGGGGTCAACGGGGGAAGCGGATATAAAAGCAGCGGGGCGGGAGAAGAGGCCCCAGTGTCGAA
      CGGACACATAACGGAACCGCTAGCAGATCGCGAACTGAATCTTAAAATAAAGCTAATCGTAAACTCGAACCCTCTTAACT
      ATCTTGACTATTATTTGGAGAACCACAGCATGTTGGTTGTCATATCAAGGTGAGGTATGCGGCAGCGAGTGCCGAGAACC
      CTGATGCAAGTGGAACTTGCGTTAACTTATATCACTTATTCAGAGGACTGAATGTCCGTCTTTGAGGAAATTAATTAAAT
      AAAAACCACTTAATAACGTTAATTAAGAACTCAATCGATAAGATTAGAAGCTAGTCATATCGGGGGAGAGATCCAACCAC
      TTACCGTGCTTCTCCTTTCCCCCCTGCTGCTGTTGTTGTGGATAGCTTGTGCTACTATCCCAGTCTGACTTCTCCTTATC
      CTTATCCTTACTATTACTTGATGTAGCTGTTACTGTTGCGGTTGCTGTGGCAGCGCTATCGACTTGGTTGTTGCCGCTAT
      TTTTACCACCGTGCCGCGTTCCATTGTTGTGCTCATTATCAGCAGCGTCGCCCTTGTTGCGATGCTTATCCTTGTCCATG
      CTGCGTCGATGGTTCCTTGAACCACCAGCGTGACCATTGGAGGTTGCTAAATGAGTATAATAATAGATAGTTAAATGCAT
      GCTATTTATACACGTCGATATACAACATAATTGTGTTTTTTATTGATTCGTGATGGAATCGATTCAGAGGGCATAACTAT
      TCGTTGGGGCCTGCTATTAGCAATCGAAATTAGATTGGCATTACATAATGATATGAAGAGGTTTCAATTTGTAAGGGCTG
      AGAACTGCCGACTGTGGTTGCTGTGGGTTAGATACCGCGAGGAAGCCTCGCCGGAGGTTACTATATGGATGGGTTCATGG
      ATTACATGCGCATACACAAACAAACAAATGTGTCTGGTACAAATTAGTGGGTTCTGATCTGCTGTTGTGAGGGACAGCAG
      GAAGCAGTTGAATTCATTATTACCACCACAACAACCGTCAGCATCGACACCTTCGGAAGTAGAGGAGGAAGAACGGGCAG
      AAGAAGTAGCCGGGTATGCTGTCGCCACCGACTGATGTTGCTGCTGCTGTGTCGCCAGACTTGCAGCCAAAGCAGAGAAA
      TCTGAGACGGGAGTGGAAGAAGTGGTTGCTGCACCTGTTGTGGCCGCGGATGCCGCAGATGACGACGACTGCTTGCCCGT
      CGACGCCGAAGACGACGATGAGCCGGATGTCGTGGACGCTGATGACGCAGACGCAGCTGCTGCTAATGCTGCTCCTGTTG
      CTGAAGACGCTGTAATGGACGACGCGGCGGCGCCCGATGCACTCTCGCTCGTACTGTTGTCCTTGGCGCCGCCACTGCTA
      CTGTTGCTATTGTGGTTGCTGCCGCTGTTGCCACTACTGTTGTTATGATGGTGGTGATGGTGATGATTACTATTGCTCGA
      GCTGCTGCTGCTGGCGCCGGCGCCGCCGCTGTGATGATGCTCATGATGGTTTTGTGCTTGCGTGGCAGTGGCCAAAACAC
      CGTTCGCCGCAGTTGCTCCTGATGAAGCGACCAAGGCCGGCGTAGTTGCAGACCCGTTGGCCACGACAACGGTGCTGGAT
      GTGGCTGCCTGCCCCGCAGCCGCCTCCTCGGCCGCCTCCTCCGCGGGCAGAGCCTGCTGCAGAAGCTGCATATAGAACTC
      GTTGTCCTTGGCTACCTCGCGCTGCTTGCGCTGGCGCATGCGGTAGCCCACGTAGCTTTTAAAGCCAAATCCAAGCGTGA
      CAACCGGATAGCCAATGCTGAAAGCGAACATGATTGGTTACAAGTAGGTTCAGCTTTAGTCTAGTCCACACATCGATTCT
      TACCAATGCGCTGCGAACGGCCGGCAGAGATCCAAGTGCGGCATGTGGCGACTGTCCTTCCATCTTATGCCCACCTCCAG
      GTAGACAAATAACATCCAGAGTATTATAGTCGGCAAACAGATACCCTTATCTGTAAGAAAACGGACAATAAAGTTAGGAG
      AGGATGTCCATAGAATCTCCCCACTGCCACTACGGATGACGCACCTGTGTGCCAGACGTACTGCACCCACACATAAGTGC
      TCGCTGCAAAGAGCAGCCAGTGAACGGGTATGAAGAATAAACAGACCAGATCCGACGTTATCGCTATGCACACGAACAGT
      ACGGAGAATGCCTGCAAATGAAATTGGACCGTATAGAGTTACAATCACTTTGGCCATCCTCATGCCACTTACCAGTCCCT
      TGTACTTGAAGGAATCGTGCACGGAGCGAAGGAGCAGCCAGAATGGCCACAAGAACTCAAAGCGGAACATAAACATGAAG
      TCGGCAACCATGACGATGGCCCATAGGATCAAAAACTTCATGTACAGAACTGTTGTGCTGCAAGAAAGGAAAAACAAAAG
      AATTGAAGCAAAAACTCACATCAATATAATTTGCACTAATATTAACCAAGTATTACAGTTCCACTTATAAATTTGTTAAC
      TTAATTAGTTGTGTGCCAAAACAGCAATCTCCATTAATAATCGACATTCTCAGTTTGTCACGCGTACTGGTTTCTCCTCT
      TGTCTTCTGTCCCATTAACAAATATAAACAATAAAGGGTCAGCTTTAATAACATGCTATTGGAACCGAAATGGAAACCAG
      CCTCCATCAATCAGGCAGCTAAAATGTTTAATGAGAATGGGAATGAATGGACAGAATGAAGAAATCTGGCGAAACAGAAG
      CGCGAAGAGGCGGGTAGAATGCCAAAAAAAAAAAAGCAAGTGGCGTCCAAATAATACATGCTTAACAATATAAAACAACA
      CTCGGGCGCAATCAAATCAAAAAGTAAACAAACGTATAAATAATAAAAAGTGAGCGCACACATGGGGCACACTCTCGGAA
      TTTTTTGTTGGTGGTTTTTTGCTCTTTTGCTCCTCAAAAATCTGATAATCATCAAGTTGACTGGGGGGCAGTTCGCATGC
      CAATAAATCGGAAAGTATCTTTACTGCCTCAATTGAGAAATGTGAACAATTTAATTACTGGGCTATCATAAAATGGTATC
      GTTTTTGAAAGTTAACAGCTATTTAGGAACTGAATATCACATATGAACAATTGCAGCTATTTTATGTGTCATTTTATTCT
      AAGTAATTGTTTTTAAAAACAAGATAAGCGCATACATTAGAATCGGTTGTTTATCCCAAAAATTCTGTCGTTCTGCTTTC
      AGAAATGACTTTTCAAACTGGCTTTAGTTTATTTTGATATGCAGATCAGTACTATGATTAATTTACTTAAATAATTGTTT
      ATATAACATTTATAAACACTCACCTGCCGTACATTCCCTCTGTGATTTTGTTGCGCTTGATCGGCCGCCGAAGTTTTCCA
      CAATCTGCGTTGCGTCGCTTCATCCTGAATGAGCGCCGTGTGTCCTCCGCCCGAAATGCTCGATGATGTCCTTCCCAGTC
      GTCTGCTGCCCAAGATCAGTTGTCCCGCTGCTCCCTGAATATCCTGACTATCCTGACTATAATGTATCCTATATACTGCT
      ATGTGCTATGTATCGTTTCGAACGGAGTGCTTGCTCTTCACTTGATAATCAGATGCTGATGCGGCTCCTGGTATTTCCGG
      AGGCGATGTCGGCGTGGTTTTGTTTGCTGGTGCTGGTGGTGCCTCTGCTGCCGGCGCGACGGCATCTCATTTACATGTGA
      TGCGTTTGGAAAACGTTGTTCGCCTCCTGCTGAGCCGGCTTTTCTTCGCTTTTCACACTGCAAACAGATGGCAGAGGAGG
      GAGAAAAAAAACAAGGGGAAGCGGTGGATGAGTGAGGGCAAACATCGAGAGCAAAGAGCAGAGAAAACGTGAGAAATCGC
      GAACGACCCACCCGATCCCGTTCCCGATCCCGATCTCGTCTTGGCATTGAATTGTCTGCCGAAATTGAAAAAATGTCACT
      ATACTACTCCCATTTGAAATTATCGAGCATCGTATAATAGGTAAAAGCAAAAATGTTATTTTTAGTCCTGCTATTCTGTC
      GATTGCACTTTCGCTTTGTTGCGAAAAACAAAAGGCACCGAGACAGCACTTTAGTATTTAAAAGATATCCGAATTTAAAT
      GCCCAAATTATCTATTGGCAAAAAATCGGGGATATTGACGAAGTAAAATTCAGCAAAGTGCTAATTGACTCATCCATTTG
      TTATGCTAATTTAGATAATACAATTATTTTGAGCTCGCATTTCGCATTGAAATTTGCATTTTTCTTGTAAATGCCTGAAA
      TATTGTGAAATTAAATGGGTTTAGTAAAGTGAGTGTAGCTTCTCAAAATTGCACATATATGGAGATATGCATGAGCTTCT
      GACGAATTCGAAAAGCGTTAAAAGTTAAAAGCACACCTGTGGGCCAGAGAAAAGTATGATTATGTAGCAATGTGTGCATC
      AGATACGTGCCAAATAAGGCGTTCTGATAATCAGTGGAATCCAAGTAGTGTAGACAACTTTATATTCGATTAAGATATAT
      GCACTAAACTTAAGAATTGTTTACATTTAAAAGTAATTATTAAAATCTTCGCTTCAGGTTATTATAGTAAAAACTTGTCG
      AATTGTAAGTCATCATTAGCTGATGAAAACACCAAAATTATTTTCGAAAAGGACTCGAAAATCACAAGTGCAGACGAAAA
      ACACGCACACTCACTTAGCAACACAAACAAATCAATGCAACGTCGAGTTTTCCGAGTGCGGGATAAGTGTCTTTTGGGGT
      GGACATGGAGTCCGGGAGGCGATAACGATGTGGCGACTACATCTCAACATGTGAATGTGAATGCTACCCGGTAAATTTTG
      GTGGAACGCGATACACACTCTCTGTTGCGCCAATAAAGGATGGATGGATTTGATGGATGTGGATGGTTGGAGCTACGTGT
      ATGTGACGATATGGATTTGGAACGGACATGACAGTGCGACTGCGCCAACTCAATCGGAAGCGGAACTATGCAGATTTCAA
      GGAAGCAGAGCAGAATCAGTGGCCTGGCATCCTTGTGTGTATGTATACGGGCGAAAAGGTTTATAAATAGCATCCAAATG
      TGGAGCGCATCCATCGCAGTGGCCACATGGCAGCAAAAGCAAGAGCAACAGAAGCAGCAGCAGCACGAGAGGCACAGGAC
      GAGGAAGCTTCTCATCTGCCGATGACGTATGTGTGGTGCTGTTGCTCGATTGTCCTGTTCCTGTTTCCGTTTGTGTTTCG
      CTTTCTACCGCTCGTCCTGCGAAATGGACACCTGAATCCTCAGCCTGCTCAGTTTTTGCATCAATCCTGGCTGGCCTATG
      CACGTATCCGCCATTTTGTAACGACTGTCTGCATGTAGATGTAATGTAGATAAATACCAATTGGGCCTAATTTGAATGCC
      AATTGAGCATGAAGTATGATTACTTGTAAGGAATCAAGATTTATGCTTAAAAACTTCGTTTATATGAAACTAGTTTGGAG
      CATTTTGAGCGAGAATAATATAAATACAAATAAATTTCGCACATAACTTGGCATTGACTTTTAAGCTAAACTCATTCTGG
      AGTGAATCAAACTAAACAGTCACCGAGAATTGGCAAGACTTCGGTTTTGAGAAATCAAAAGAACAAGAGTAAACAAAGCA
      TTCCGTTGCCACCAAATGATTAGGCCTTTATAGATGTGATCGTGAATATAACATTTAAATGACCCACAGTTTCCAACGGC
      TCATAAAGTGCACTGATTTCGCTCTCGCCAGTTTTGTTTCTCTCCCCCATTGCCCCATCCTCAAAGAGTGTTCTCTCTCT
      TTTATTTAACACTTTCCCAATTGCATTTCGTTGGCCAAAACGAGATCGCACACTGACACACTCCCACGCACGGTGCACAC
      ATGCACAGATACGGCCACATTGCGCTCGTCGCATTTAGAAAAGCCACAAAAACAAAACGAAAAACGAAAAAGGAAGCAAC
      GAAAACAACAACGTCAGGGCGACAAGATTCGACGCGCAACAAAAGGCTAAAGAACTTTGATAAAATGCGGTAATTTCGTG
      GCTGCTTTTTGCATAACTCGAGGGAATTTGGCGATAATGGGCGCTCCAGTTTTATCGTGGTTTGTTTTTATCGTGGCAGA
      TGGTCTTATCAGATGGGCGTAGCGACTGGATGATAAATAAGGTGAATAAATAACGAGACCCATTGATGCCGGTTAGCCTG
      ATCACCTTGGTTTTTTTTTCCGAAAATAGGTAGAATAAAACAAAACATCTGTGTGTGTGTGGGGGTATGCATGTTTGTGC
      AGGCAGAGAGCAGCAAAAACAAAAACAACAAAAGGGGGAAAAGTGAAAAGTTGCCTCCGTTTGAGCTTTCAAACAGCATC
      CACATGTTAGCCCAGGAAGCATCCTTCTGCCTCTATCTCTTTCTCTCTTCGAACTTATTTCTTTGCCAGGAAGCATCCTT
      TTTGGCCTCTCTGGCTGCTCTGCCAACGTCGACTGCGGTTACGTATGCGTATGTGTGTGTGTGGTTTGTTGGCGGCTGGC
      ACACGTACAGGGACACCTATGTGTACACCTATATATTTCTTTTTCACACTCCTCACCTACACGAACACACCGATATACAC
      AGCCAAAAAGCACTGCAAAATTGCACACGTTTCTTTCAGTACTTTGGGCATGCTTTTGGCATTTTCATTCGCTCACAATT
      TGCCACCGATTATTTCACTCGATTTTCCACTGGCTGTGTTGCTCAACTTATTTACTTTCGAACGGATTTTTGATACAATT
      TGCACATTTCCAACAACTGCGCTGTGTCTGTGAGAGTGTGTATGTTCCTCGGCCTGCGTGTTGCTCTATGTGTGTGCGTG
      TGCATGGATGGATTCTTGAGCACCCGAAAATTTTCCCTCTTCACTTAGACAACTCAGGTGATGCTTACACTGGATTAGCA
      CTGCATTTTTTTACGCGTTTCCGTAACCGTCGTGCACACAATTCCCGGTGATCAGTATCGATTAACTTGCGTTTTGTATA
      TTTTAACACGAAATCGAAACTCGAACGCTTCGAAATTAGAGCTGGGCCAAAGTCGATGCTGATGAGATGCTATCGATGCT
      AGCTGTAATTCGCTGATATCGATATTTTCACGCAATCATCGAATGTTTCGCAATTTTCGCTAAGCTACTTTCATCGACAA
      AATTATCGGACTACGCGCAAAGATTTAGAAATATGAATAATATCTAACCACTAACAAAATGCAAAGCAACAAACAATCAA
      ATCTAAAGTTTTTTGTTCAGTAATTTGCGCGGCTAAATCTGATTGGACACCGACACTATTTCTTCGTAAAGTGTCCTTAA
      ATAAACCAATCGCCGCAAGGTGTAGAAATTTAGTAAAATATGTAACATTTCTAAACTTTTGATCTCCTCTCGGATATTAT
      CAAATTTAATTGACTTAATGTTCCTTGCTGCCTGCCTGAAAAAAATTAATTAACAACGAAAATATTTAATTAAATTTGAA
      CAATAATTTAATGGCACTGGCTGAAAACACAAAAAAGACACTTTCAAAAATAAGATCCTTATTGACCCCGACGTGATTTG
      AACACGCAACCTTCCGATCTGGAGTCGGACGCGCTACCGTTGCGCCACGGAGTCAGATGAGGGGAGGGATATTAGGTACC
      GTTAGTCACCAAATGATCATATCATCAAGAAGAAGATTCTTACTCAATTCTCAGAGCAAAATTGAGATCCTGACGACGAA
      AGCACAAAAGTCCGGAAGACTCCGAAAATCCCTTTTGATCTCTGACAACTAAAAAATGTAAAACTATATCCACAAATTGG
      TGTTTTAAGCCTAACAAATACTAAAAAATCTATTTTGCATCGGCCGGGAATCGAACCCGGGCCGCCCGCGTGGCAGGCGA
      GCATTCTACCACTGAACCACCGATGCTTATGACTCTTTTGAAACAATTCTGCTGAAGATTCTACAGAAGTCTCGTTCTTA
      TGATCATTTGGGAACTAAGAGTATCTGATATCCCTCCCCTCATCTGACTCCGTGGCGCAACGGTAGCGCGTCCGACTCCA
      GATCGGAAGGTTGCGTGTTCAAATCACGTCGGGGTCAATGCATTCGTTTTTTTGTCCACATTTCCGATGGAAACCTAACG
      TTGAATGGTTTGACCTTGACAACAAGTGGGTCTACAAAAAATAAATGTAGTTAAGATATGCATGCGAGAGATGTTTTTCA
      TTTTTTATTTTATAGTATCCGATAATATAGATATATTTGAATTGTACATTAATATGCGTGTACCTAGAATCTGCGCATTA
      GAAACAATTTGAGTGTTAAATATACTCTTAAAACTAAATACATAACAAAATAATAAACATTTCAAGTTTTGCGATTGCTG
      ATTTGTTTATGATTGGGCTTCTACTCCCCCACAAGCTCCCCTGTCAATTTCCTGTCCATACAATCCGTCTCCTTTGCTAA
      TTATTTGCTATAACTGTGTGTATCTGTTGCTCCACGTTTTCGTTGGTAGTTGTGGTTCCTATTGTACGACAATTTAAATC
      ACTCGAATTTAACTGAATCTCTGGTTTTAAAAGCGTCCGGTTCAACCCCCACCCCCCTCGTCAAAAATGCTACGTAATCT
      CAATTTAAAAACGGTAAAATGTTCGCATGTATGGAGTTACACTAAAGTTACTTGATAAGGAAAATCATAAATTACAACTC
      ATCTTGAATTTGCTCAATAATAATAAGTTTGTTTCTCATTTGATCTGTCTGTCGCCTAAGGATCAGCTTCGGCTACGACA
      TCGGCGGAAGCAGCAGGGGCTATGGGTTCCTCCGCGGATGGAGCCTCCGTTTGGAGTTCAGCCGGCGGCGCTGGAACCGA
      TTCCTCATGGGGCGCAGCCTCGGTTTCAATGACTGGCGGCGCCGGCCGGGGCGGAGAACCTTGAGGTTCTTTCGGGGGCT
      GAGTTGGAGTCTGTGGAACTGCTGGCGGTGGCAGCTCGTCATAAAGGGGCGTGCAGGCGGCTGAAGTTTCTGTTTGTGAT
      TTCGCAACCAAAGGATCGCCGGTCACGTCGGCTGGCTTTGCGAAGTTTTCATTCTCCGCCGGCAGCTTTTCTTGCGGAGG
      ACTGTTAGCAGACTGAGATGCTCGTTCGCCTGGCTTCTGGGCCTCCATTCTCGCCTCATAGTCTTGAAGTTCCTGATCCC
      AATCCTCCTCGGTGTCCACTCTAGTGGCCGCAGCCGGCGCACCGGTGTTGGTGCTACCTAATTCGGTTTCAACGTTTTTG
      GGCTTGGGTTCCGTCTCCGAAGCCGCCTTGTTGCCTTCATCCGTCGAACTTATTGAGTGGCGGTTGCTGTCATCTCGCGA
      TCCCCGCCTGTTTCCGAATCCCGGACGTTCACGATCCTCTCGCGGTCCTCCGCGTCCGCCCCGTGAATTGTTGCCACGAC
      GGTCGTCCATCATTTCGCCTCCACGCTCGCCACGGAATCTATTACCGCCTGGCCCACCGGGACCACCACGCCGCTTGAAG
      TTGTTTCCGCCCTCGTCCTCATCGTCGCTCCAACGTCCGCGACCTCCAGGACCGCCACCTCCTCCTCCGCCCACGCCGCG
      AACACCGCCTCCACTTTGACCTCCACGTCCTCGTTGGTTGTCATTGAAGGGATTCCGAGGATTAAAGAAACCTGAAACGA
      ACGTTAGCATAAATTGCACAAATTAGTTTACATAAAATGTTCCTTATATAGTTGCAATAAAAAAAAAATTAATAAAGTTA
      AATTAATTATTATTTATATACACCTGGTAAACATAATATTTACACGCATAAAAAAGATGCCACCAAATTCTATTATCGTT
      TTTTCTTCTTCTTTCGTCTTTGCTTCAAATTCCCACGATTCTCACCTGGTCCCTGCTGACGTCCGCCCGGACCACCGCCG
      CCGGTTCCAGCACCGCCGGGTCCACCACCGCTGGGTCCAGCACCACCTGGCCCACCTCCTTGGTTGCGCATAAACATGGG
      CCCAACGCCGTTGCCACCGTTACCAGCTGGTCCACCCATGCGCTGGTTGAAAGAAGCCGGCGGCGGGATGCGCATCTGCA
      TCAAGCTGGTGGGCTGATTGAACCGATTGTGATTCATGTTGGGCGGGAAAAAGTCGCCTCCGGGGCCTCCACCGTTATGG
      TTTCCACGCGGTCCCATTCCTCGTGGTCCACCCGGTCCACCGCGATTATCAAAGTCTGCAATGCGTTTTAGTTTAGTGAG
      CTGCGAAGATTCGTACCATTTATGTCGACTCACCCATAAAGTCCGGTCTTGGCATACCGTGCTCAATGGGATTAAGGTTC
      AGACGCGCTCGTGCCTCGTTAAAGGCTGCGTTCGGTCCGAGTCCAGATCCCGGACCACCACCACCTCCTCCATTTTCGGC
      GCGCCAGCGTTCTGCCGCTTCAACGACATCATCTCGTCCGCCCCAGCGCGAGTTGCCCGGTCCCCTGGAGCGATCCCTAT
      TATCCCGATCGCGCTCCCTGTCCCGCTGCTGGAACATCTCGTTGGCCATGGCCGCCGGCGATAGGTCCACATTGCTGGGC
      GACGGATTAAAGTTGGCTTGCTGTTGCGGCGGCAGAGGTGGGGCGTCTTCCAGGTCCATTTCAATGTCCATTTGATCATC
      GCTCACGTTGCCACTATTGCTAATCTGCCCACCGCTCGGTATGGGTGGCGGCACAGCTCCAGGCGGAGGAAATGGAGCTC
      CCGGTGGCAAGGCCATAGGATGTGGTGGTCCCCCAATGCCTGCAGGAAAAAAAATTAAAATTAAAGCTTGAAGTTCAATT
      TTACGAGATTATTATCTACCTGGAAAGCCAGGAGGCATCATTGTCGGTGGCATCATCATTGGAGGAGGCATGTTGGTCGT
      TGGCATCATCATCGGTGGCGGCATATTTGTTGGCGGCATCATTATGGGCGGTGGCATATTAATGCCCATGGGTGGGGCCA
      TCGGAAATTGTCCCCTTACCATACCCATGAGCCCCGGAGGTGGGGCTCCCGGACCCGGTGGAGGACCCACTGGGCCGACT
      GGACCAACCGGTGGTGGTTGGGTTGTATCGATACCAAATATCAGATTTGGCGGTGGAACACCAACACTTGGCGCACCAGC
      TGCCTCCGCAATGGATGCACCCTTGTGCTCCTTGGCAGCATTCTTGGCCTGGTTAATCTTCTGCTTCATTTGGATGGGCA
      TAGTATCTTCGTCGAACATACCACCCTCCTCCAGCGCGTCGAAGTCCGTATCCGAACTGAGTTTGGACCAAGGAATGTAA
      GTAACACCCAATTCGAGGTCCCAGTAGTCCTTCCACTCCTTGCTTTTCACACCCTTGCCGGCGGCCCATGAAATGGTGAT
      GGCTCGTCCCTGCAGCTTGTGGTTCTTCAGAGCTTGCATCGCCTTGTGGGCGTCTTGGCGTCGGTTCATTACAATAAAAG
      CGCATCCACGCGGCACAATCTGATCGATGCTCACTATATCGCCATATTCGCCAAAGGTATCGGACAGCTCCTCCTGGTAA
      ACAAGCTTAGACAGGTGGCCCACCCACAGCGTAGTGCTGCATACTGAAAGCAAAAGCATTGGAATGCCGCATTAGTTTTT
      GGTGTCTGAACATGTTGTCAATATGCCCATTTGCCTTGTTGAGGTGTGAGTGCCACTGTTGGGATAGTGTTTAGAATTCC
      TTATCCTTAAGTATATTTACCAAGATTTAAACTATGATCTATGTACTTCATTAAGAAGCCAGTTCTTGGTAATTAAGCTT
      AAGTATATATTAGTGTAGAACACAACGTTTGTTTGCATCCTTATGTATATGTATGTAAATCGGGTCTCAAAAAATATTGC
      TCGAAAACGCATATTATATAGGGGGATATTCTAAGATCAAGAACCACTAAAGCTAAACACACACACGTCAACCGAGCCAA
      AGGAGCTGCAGAGAAAAGGAAGTAAATCTTTAGGATTATCAAAAACAAAAACAAAAAAAAAAAAGAAGGAAAAACAGGAA
      AGCACACAATGCAAATGGATCTTAAGAAGCACCATCTTGTGGCCTTTAAGATCCATTTATCATTCCCGTCATAGTTACCA
      CTGAGATGCTCCTTTTTGATGTCGGGCAATCCCTTCTTGCGCCGCTCACGCTCGTGTTCCCGATCGCGTTCCTTGTCTCG
      ATTGCTACGATCCATGCGATCCCGGTCCCTTGATCCGCGTCGCCGGCTGGACCGTGGTGATCGGCTGCGCGATCGGGAAC
      GAGTGCCACGCCGACGTCGATCGTTGCCCGTGCCTCCTCCGGCGCCACGTCCTCGCGGAGATCTCGTCCGGCTGCGACTG
      TTCCGGCGACTGCGCTTGTAGCGATCACGGTCGGGCGTCGGGCTGCGGGAATCGCCACCATCCAGATTGATCACCTATCG
      GAGATGGGAGTGTTTGCAAGAAATTTGAGAGTGATACGTGATAAAAATTTTGTTAAGAATAAAAAAAAAAAGTTCAGTGG
      GATAGAGAGGATTCGGGATTAGTGGCTGGCCACAGGGCGAATACGTTATTATCGACTCAATAAACTGCATTCTTTGGCGT
      GTGTTGACGTGTGGTTCTGTTTCGCTTTCGACTTTCATTCATCTAGTTATTTCGGACTAATTGGCAATTTGCGTTTTCGA
      GCAACATTTTTATTTACATATTAGGAACTTACCAAACGTTGTTCTAGCATCGGGTAACGAGTTGTTCCGCCGGATATTAT
      GTGGATTTTAAAACCTTACCTTTGGCTTCATTTGCATATTTTTTAAATATTTTACTATTGGTTCGACTTATTCAAATATT
      GGCAATTGTTTTATAGTTCAAATATATGTTGGGGACATATAGATCGACTTATGAAACTGATTTAGGGTTTGCCCAAAAGC
      ATCATCTTTTGATTTTAAACATTTTTTTTACAACAAAATAAAATTTAATTTTAAATGGATTGGGAATTGAATTGTTTGCA
      TATTCAAGATATATAGTATTAAAGTTATTGATTAAATAGTGCAAGACCACCCCGTTACAACTAGTTGAATCAATTTGGAT
      TCGAACACGCTAATATCCCATCAGCTATAACAACATATTGAACACATTTCCAGGATTAACTGCACGTCAGCACAAGGCAA
      ATAGTATCACCCGTTTTACATCTAATATGTTTATACTTTAGACCAAAATTAATGGCGAAGTCTTGGTGAAAAGCATACAC
      AAGTCGGACCCCAGGAACTAAGATAGATTGGAAAAGTAGAAGGGTATACCTCTATGGTCTGTTGCTCCGATATGAACTCG
      ACATCCTTGTTAAGGTCCATGCTGTCGTTCATGTTCATGCCCATGCCCATGCCCGGCGGCATACCAGCATTTCCCTGAAA
      GCAAATCATAATGAAAATATGTACATCGTCATGAAATCATAAGATGTACCTTCATTACGTTCTGGAAATGCTGCTGCAGT
      GCCTCGTCCTGATAGCGATGCTTCTGGTTCTCCTCCTGCGGCTTCAAATTTTGGAAGTTCTGCAGCGTATGGAGCTGCCG
      CAGCACATTCGGATTGTTTAGCAGCTGCTTGATCTTCTTCTCCTGAAAGAGTTATTTAAAAGGTTATTCAAAATGGGATC
      GATCTAATGTGAGCAACAAAAGCAACAAATAGAAACTTAAGATAAACAAAACTATCTAAATGAAGAGATGTGTTAATGGG
      GTTCGCCATACGTCTAACAGGTTTGAAGAAGTGGGCGGTGAGTCGTCGCCCATACAGTGGTGATCATCTGCCATCAGCAT
      CTGCAGGCCTTCATCTTCTTCCTCGATGATCTCCCGCACCTGGTAGTCAATGTCGTGCGAGCTCTTGACATATTCCCGTT
      TGTGATGATGCGACTTGCTGGTCTTCGACGAGCACGAGACCACCGACTGTCGTTTGGAATAGTGTTGCTCCGAGTAGTGA
      CGCTTGGAGCTGCTGCTGCCACCGCCGAACTTCTCATGGCCCAGCTAGCGATTGGGCGAAGGGCAAAATGGGCGGTTAGT
      GGGCAAGACATGAGAGACAGAGAAATGTAAATGCAGCAGAATTGTAGACGATGTTAGTTAAGCCATTATCCAATACTAGA
      CACCTGTAGAAGCCTCAACCGAAAGCATCACTTACCGACAAGTCGGGCATGGCACCGCCCATCTTATCGTCGCCCCCGGA
      GCTGTTCATGCTTATCTCCATTCCGGAGCTGTTTAGACCGTTCGGACCGCTCGATATGTCCGCCAGGCTAAGAGCACCGC
      TGCTGCTGGGTCCTGGACCCACGCCGCCGCCCTGTCCTCCACTGCCACCCACCGGAGGCATCTGGTGGTAGATTGGGTGG
      TTTGGGTCGGCCAGGTCGAAGATCGGCTGAATGACCTCGGACTTGAAGACGTTGTTTTTCTGCCACAGGTTCAGTACCCG
      GATGATGCGACTCTTGTCCTCCGGAGCGCACCGGAACAAGTTGGCAAAGGTCTCCGTGAGATTACGCTGGAATCGGGGCG
      CGAACAGATCCTTGTCCATACCGTACTGGTGGCGCGACTGGCGCACTATCGAGTCGATTACATACAGCCCGGGTACTTTG
      TACTCCGGCTTGCACTTCAAGATGAACTTCTCCACACTCTGGACGACGTGCTTATACAGCTTGATGGCCCGCATCGCCGA
      CTTGGTGATGGCGGCCATCTTCGCTTTGGAAATGGGCGGTCGGCTGTCATAGAGTCCGGAGAGCTAAGGAGAAATATAGA
      TGTTACAGTACGGCTATAGTTTACGGATATCTGGGACATGGAGTTATCGTTATCGGGTGCTGGCCAAAAAGCAACCCTGA
      GCGGTGCTGTTCGGTGCTCTGCCTGCGCCTCCAGCAGGATCTGTATACCTCCCGCACATTGGACAATCCGAATACCGACT
      TCAAGCGGACATTGTGCAACCACGCCGGCTGCTCCATAACGAACCTCGTTTCTAATGCATCTATAGCTTACCTCATTGTT
      GAAGGCAACCACGGTTTCCATGTTCAATTGCTTGGTTCACTCACGGCACGCACACACAATATTTAGTTTTGCATACTTTG
      GTTGGTCAACACAATCGTTTAAAACTGGCGAAAAACAATTTTCTCGACCTTTCTGCGGTTTCCACGGCTTTTAAAAAAAC
      TTTTTACAAAGCGTGAAAAAAATGGCTGCCCTAAAGCCTGAAGCGTTGCCAGACCTGTAAAGTTGACATTTTCAAGGCAT
      TTCTGGAAATTGTGCTGTTAATGGCAGTGTGACCGTATGTGGTGCATAACGTTTCGGTATTAAAAAATTTTCCAAATATT
      TATAAAAAATAAAACGAAATAGAATTTTCATTATGGAATCCAAAAGTTTCATATAAAAAAATAATGACAACAAAATAAAA
      ATGACCTTAAATAAATTTAAATGAAATCAAATCTTCTTAAATGTACTACCTTTTAAAAATAATCGCTATCGGCGGTGTCG
      ATCTTTTTAGCATTGTGTCGATGACAATACATCTGGCAACACTGGTCAATATTAAACATATATTAAACAAATTAAAATGA
      GCTCAAACCACCGTCCTCTGGACGATTCGGATATCCTCCTAATACAAACCATCCGCGAGACGCCGTCGCTGTACGATCCC
      CAGCTGCCCTCCTTTCGGCTGTCGCAGCGCAAAGAGGAGGACTGGGCAAAAGTGGCGGATTTGCTAAACATCTCCATCTC
      AGACGCTCGGCGACGGTGGACGTGTCTGCGGGATCGCTATTCGCGGGAGCTTAAGCAGAAGCGCCTGCATCCGTCCGGCG
      AGTTTGGTCACAATGACTTCTTTCGGAAGATGGACTTCCTGCGGGACTTTGTGCGCAAGAGACGCGAGCGCAGAGGACGC
      GAACGGGATCGGGAACAAAAGCCAACCGGGTGGATGAAGGTTGATTTACAGCGACGGCGTCGTACCCGCCTGCCTATTGA
      CACAGAGACCTTGATCGAGGAGCAAGGTTCGCACGCCTACGATGAGGGCGAGGAGCAACACGACTACGACGCTAAGCTGG
      AGTCTCATACCACACAATCGGAGACGTATTCGGTGGTCGTGGAGGCGGACGATGGGCAGGAGCCCGAACAGGAGAGCTTC
      GATGAGTTCCTGGGGGATGCGGAGTGCGAGCAAAAGGTCAAGGTGGTCACAATTCATCCGGAAATCGCTGCTCCGAATGC
      GACGTCCGCACCTGAGCCTATTGAGTCTAACCACGCGGATCTGAACTACTTGGTCTGTATGCCGCCCAATGCGAATCAGG
      AGCGAGAGCATTCCGCCCCAGAATTACCCAATCCCACGGCCGTCATCACCCAAAAGACTTGCGAAACAGAGGACGACTTC
      TTTTGCAAGTCGATTGCCGCGTATTTGCGCCAACTGTCGCGCGTGCACAAGATCAAGGCCAAGGTGGAGATGTACCAGAT
      TCTAGAGAAGTACATACTGCTCGAGGAGTGCGGAAAGGGGTCGGGTGCGGGCGGATCAGGCTAAGCAGGTTGCATGCAAT
      ATGTACATAGGTTTTAACATAGTTTTTTAATGCAGTACAAATATACAAAGAGACGAAAATCTTTTGAGCTTAATCTAACT
      TTGTGCTTAGGAAAAAATGGAGTCTTAGCAGAAGTCCTCGTTGATTATGTTGGCATCTACGGCCAGGCCTCGTTCCTTTA
      GTGCCTTGGATACTAGGCGGTGTTTCTCCTGCCGCTGCTCCTGTTCCCTACGCTGGGCGTCCAGGATTTCATCGACGGAT
      ATCTCTTTGAGTGGCAGTTTCTGCTCCTTTTCACGGTCCTTTTACGCATATTTAAAGGGTGTTAATCAGTCATATTGAAA
      AAGTATCGAGTAAAGCTTACTATTTCGCCCAGTAGCACCACATTCTCCCCGCGAATGATGAAGACTCCGCGAGGAATGTC
      GCCGTATTCGTTGCCCACATGTATCCGCTCGATGGTGCGTTGCAGCACCAGGTTGGCGAACTGGTCCACGGACCGCAGGT
      ATCCAATCAGAGTCCGTCCGTCTCTCAAAAGTACCATCAGTTTCTCTGCAATGCGCCGGTTTTCAACGACTGGCCTTCCT
      TTCATTCGGATTTACTCACTGTCAACCTCTTCCAGGAGGTGAGCCGTGCCCGCCAGCGGATTTAAGTCGTCCATGCTATG
      AAAATATGTGGGATTTAGATAAATAAATAAACTGAAGCAACTAAACTTTGGTCTAAATTTTAGTATTTAATATTAATGTA
      ACCCTCGCTGAAGGGTTTAAAAAACCACAATGCTCTAGAAAAAAATACTAAAAATATTACTACACTGTTCAACGAAACTT
      ATAAGATATTGCTTACTGAAATTGATGTTTTTAGTTTTAAAATGCATAGATATTAAATAGTTATTATTAATTTTCAAACA
      GTTAAAAATAAGATTTCTGCTCTAACATCAAATATTTTTACGCTGTTCACAGAGTTACAAAATAAAAAGAAGTTGACCAA
      AAAAATATCAAAACTTGTACTCAATCCATGCAAATTTTTCACAGCCCCATCGATAACGATGGTACAAATTCTATACCTCG
      ATAGTACCATCGATAGTTTGCCGGCACAGGGAATTGTGAATTATCCCGGAATAGGCGAATAATGAAGTAAGTGGCAGAAC
      GGGATAAATGAAAGTACTCCTTTAACAACCCAGTCCACAGGCTCAGCGTGGACGGCCTGTTGGTGTACTTTCCGTACGAG
      TACATCTACCCGGAACAATATGCCTACATGCTGGAACTTAAGCGTAGCCTGGACGCCAAGGGCCACTGCCTGTTGGAGAT
      GCCCTCGGGAACGGGCAAGACGGCCACGCTGCTCTCCCTGATCGTTGCCTACATGGTGGAGCATCCGGAAACGGTGCGCA
      AGCTCATCTACTGCTCGCGTACTGTTCCGGAGATCGAGAAAGTGATCGCCGAGCTGCAGAACCTGATGGTTTACTACGAG
      CGCCACTGCCCCAATCCACCACCCTTCACCGGTCTGGTGCTCAGCTCTAGGAAGAACATGTGCATCCATCCGGAGGTCAG
      TAAGGAGCGCGAGGGCAAGGCCGTGGACGGTAAATGTTACGGACTCACTGCCAGCTACATTCGCGAACGGCACGAGATGG
      ACACCGAGACGCCCATTTGTAAGACTATTGTTATCCATATGTAACCATTATTTCAACTGCGAACTTGTAGGCCAGTACTT
      TGAGGGATTTAGCCTGGAAGGCAAGGAGTCCACATTGCCGGTCGGCGTCTACAGCATCGATGATCTTAAGGAATACGGTC
      GGTCGCGCAACTGGTGTCCCTACTTTTTGGCTCGCTATGCTGTGAGTTTTTTCGTTTGAAAATTTCAAGACTAGATTTGA
      CTATATCTTGCATTCTTTACCAGATTGCCCATGCTCACATTGTGGTATACAGTTACCACTATCTATTAGATCCGAAAATT
      GCCCAGGTGGTATCTAAGGAAATGAGCCGCGAGTCCTGTGTGGTCTTTGATGAGGCGCACAACATCGACAACGTTTGCAT
      CGATTCGATGAGTGTGAAGATCAACAGACGCACCGTGGAGCGAAGCACGAATGCTTTGAACCATCTAACTAAACTGGTTC
      AGGAGTAAGTTGTTCAGGATATGCGACTGGTTTATGGCCAAAAAAAACATTCTTAATCTACAGCATTCGCGAAGAGGACA
      CAAATCGTCTGAACGAGGAGTATCAGCGCATGGTGCAGGGTCTGAAGGATGCCAGTGTGCAGCGCGACACGGACATGATC
      CTGGCCAATCCGGTCCTGCCAAACGATGTCCTAACCGAGGTGGTGCCCGGAAATATTAGGAACGCCGATCATTTCCTTAG
      CTTTCTGCGTCGATTCATCGAGTATATAAAGACAAGACTGCGCGTTCATCATGTCGTTCAGGAGTCACCTGCGGGCTTCC
      TTAAGGATATTTCCTCCAAGATTTGTATAGAGAGAAAGCCTCTGCGTTTTTGTGCTGAGCGCCTGTCCAGTCTGCTGCGC
      ACGCTTGAGATCAGTGATTTGACGGAGTATGGAGCCCTTACACTGGTGAGCTTTCAAATTCCATACAAGGTAAAAGCGAT
      ATTAATGCTCTTTCTATTTTCAGATTACACACTTTGCCACCCTGGTGTCCACCTACACAAAGGGCTTCACAATCATTATA
      GAACCCTTCGACGATAAAACGCCGACTGTTTCGAATCCCATTTTGCACTTTAGTTGCCTAGACTCTTCCATTGCCATGGC
      TCCGGTATTTTCGAGATTTCAAACCGTGGTCATCACTTCTGGCACATTGTCACCCATGGACATGTACCCGAAGATACTCG
      ATTTCGATCCAGTGGTGATGAGCAGCTTTACCATGACACTAGCCCGTCCGTGTCTTCTTCCTATGGTAGTTAATCTATAT
      AATCCAACAATCAGTCATCACAATTATCTGAATGTTTATTCCAAACAGATTGTATCGAAGGGCAACGACCAGGTGACCAT
      TTCGTCCAAGTTCGAGACGCGAGAAGACACCGCCGTCATTCGAAACTATGGCCAGCTTTTGGTGGAGGTGGCAAAGACAG
      TGCCCGACGGTATTGTATGCTTCTTCACCTCCTATTTGTACTTGGAGTCTGTGGTGGCCTCTTGGTATGATCAGGGAATC
      GTCGATACCCTGCTTCGCTACAAGCTTCTATTCATTGAGACTCAGGACAATGCCGAGACCAGCTACGCCCTGATGAACTA
      TGTTAAGGTAATATACATATATGCTTTCAATTCTTAGAAAACCACGACTGGATTGCTATGGCTTCTAACCAAATGTTCTT
      GACACAGCAGCCTCGCTCTCATTATGATCCGCTCCCTTGGTGGTTGGATCATGTTCAGACCACTAGTTCGCAGGGTTATC
      TAATATTACTTGAATTATTTGACATTTTTTCGACAAAAATCCAATGAGCATTTGGATAAGCATGCATGTGCAACCAGTCT
      CACCGCAATGATGTTCCCATTTTGTGGTTTTTAAATGTTATGTTTGCTCACAGAACGGATATTTATCCCCTTCGCTTGTT
      CGCAAAGTTGACTAACCCCAATCAACCCTCCCATTTCGACTTGCAGGCCTGCGATTGTGGTCGTGGAGCAGTGCTGTTGG
      CTGTGGCGCGTGGCAAGGTCTCCGAGGGTGTGGATTTCGACCATCATTATGGTCGCGCGGTGCTCATGTTCGGCATCCCC
      TACGTGTACACGCAGTCGCGTATTCTGAAGGCCCGGTTGGACTACCTGCGGGATCAGTTTCAGATACGTGAGAATGACTT
      CCTGACCTTCGACGCCATGCGTCATGCTGCCCAGTGCGTGGGTCGTGCACTGCGCGGCAAGACGGACTACGGCATCATGA
      TCTTCGCGGACAAGCGCTTTTCGCGCCACGACAAGAGGTCGCGTTTGCCCAAGTGGATCCAAGAGCATCTGGTGGACAGC
      TTCTGCAACCTGAGCACGGAGGAGGCCGTCCAGCTGGCCCGTCGTTGGCTGCGGCGCATGGCGCAACCGTTCACACGTGA
      GGACCAGCTGGGCATCTCGCTGCTGACCCTCGCCCAGCTGGAGAACATGGAGCAGGAGAAGCTGGAGCGGCAGGCTCAGG
      GCAAGCAGGGCGTTGGCGGCGAGGTGCAGGAGCTGTGAGATGTGGAAGGTGCTCTGCCAACCGGCTCTTTGTCGACTGCC
      TTCCGGGAATAACTCAACACAGCACAAGCCGTCAGCTAATGACATTGAATGCCATTAAATGCGGATCACAACGGCGATGC
      TGGAAAATTTAAAAGTAAAATTTTTTGTTTTTCGGCTGCCATGCAAATCGAACGTAAATGTCCAATTAATGGCTAATTAA
      TATTATTTATAATTTCGCGGGCATGACTAACTTAACTGGCCGCTCAAGGCGGCGAAAGGGCGCAAGCGCAGCGCGAGTTT
      TGCTCTTGCAGTTGTATTTGTATCTATACCTGTGATTGTATCCGGATTTGTTGAGCTGCAAATTTAGAACTAAGCGATCG
      TGAAGTACACTAGCACACAAAGTATGCTAACACAATGTAAAATAAAGTAAATATTTCTTTAAATATACTAGGTGTTTTAG
      TTCAACTCCAAACTTATGAATACTTTAACCGAATCCTAAAATCTAGGACACCTAGCTTACCAGAAGAATCATGATTTTAT
      AGAGTAACTTTGATGATTGGCATATAATATAGTGCGGCTGTGGAAAAATATGGTTCGTTGCATGCAATCGAACTGCATTT
      TAGTCATAATAATTGATGATGCGCCTTCCTGGCTGGATGCCCGCCGTAATTCAATTTCAGGGGCTCGCAAACGGGCTCCA
      AATGAACCGCGATGACCGAACAAATTTCTGACATGCACGATTTAGCCTGAAAATGGCATTGTTGTTGTAAAACGAACGCT
      ATCGCCTCATAATTGCCAATGACCCGTTTACGATGCCGTCCAGTCGCAGCGGGGTTATCAAATTGAAATTATTGTCAAGC
      CGGGGTCCAAAGCCAGGCACCAACGTTTCCTTAATGGCCGTGTTTTCTTCTTATCACTTTTGCCTTTCTTAATTGTTATA
      TTTTGGAAATACATATGTTTACTCTGTCAGAAGTTATGCCAATAAAGTATCCAAAATGCTTGACCGCCAAACAAGTAACC
      AAATTCTGTTTCGATTTCCTGGAGTCCTCGGACCAATCAGCTGTCGAGCTTAAAACGGAGCCGAGAGCCAAAAGCTCCAA
      AGCCCAAAGTGCCCCCACAATAGCCGGAGAGCAATTACAGTTAACGCAAAATGATAAAACTGTCGAGCATTGCTCGCCCT
      CTCTCTCTCTCTCTCTCTCTCGCGGCAGAACTTTCGATTTTTCATAATAAAAAGGTTACAACTAAATCTCAGGCGGTTTA
      GTCGGCAGATAAATTCGGAGCGAGCGCGCCAAATACAAAAGTCCGCCACGCGTTCAGAGCCCCAATCTCAAGTCCCATAG
      TTCAAACAGTTCCGAGCCCGTGTCCTCGCAGAGTCCACCAATCCCAGCCAAACATCAACTCCAATCAATCGAACATGAAG
      CCCCAGACAAGCGAGCAAAATGGCAGTGGCCAAAATGGCGAGGGTGCCGCAGATGCCGTGGCCGTTGCCACGATCCCCAC
      GGGCGAAGCCTCCGCCGCCTCCGCCACGTCCGGCACCGATCTAACGGTCTCCAAAAACAGCCAGCAGCTGAAACTGGAAA
      TGCTCAACTTGGAGCTGGCCAGCAATGGAAGCGGTGAGTTCTCCGGAAGAATGCCACAAACGGGAACTCTTCCTGGTTTG
      AGAAAAGTGCGTATACGCATAGTGGGATTGTTTTGATGAAGTCAAAATAAATTGGTTGTTAATTAGTTGGTGTAGAAATT
      CGGTTTCCATTCCAGGCTATAAATTAGTATCTCCCACTTAAGGGACTTTTTGCTTTGTGATTTGAAATCCATATCTTGGA
      TGATTAATTGTCCACAAGTGCACTAGCATCTTTCCATTTCGAAGTTCTTGGAATATAGTTAGTAACGTTTGGTGATCTTC
      GTCAAGAAGGGGTTTATCCAGAAGCCTACTAAAGTTTGGTAATACCACAAACATGATTCATCCTTATCTGTTTCTGTTAC
      CATTTCATTTCTTCTGAATGCCCGCACAATTTGGTTGAAGAATTCAAAGCTAACCCTTGATAGCCAGTAAACCCGATCTA
      GTTTCCGGGTAATACAACCCCTTGAACTGGCTAACATCGCGCGCAATGCAATCTGGCTGCCATATTGCATCAGTCATAGG
      TTAGTTGGGCCGCGATTGAAATTCAATCAAATGCGCATAATGCGAAGATTCCGATTTCCGGCGATGCTGGGCCTCATAAA
      TCCGAGAACATAAACCACAGAGATTCGAGAGCCACGATTTCTGTCCCATATGCAAACCACACGCAGTGCCGGATATCGAG
      AGTAACTCTTGTTGTGTCCATACCAAACAAAAAAAAATAATAATAATAAAAAAAAAAAAATAAGAGAGCTACTAGCTGTG
      GCACTGACTGGGCTTATTGACATTGACATTGAAAGATTTGCTCGGTACATGGCACTTGGCTGAACGGATCATATCGGATT
      GGATTGGATCGGCAGATTCAACGAGAGCTGAATGGAGTTCGGGAACTCTGGGCCATGAGCCAAAGACAAAGACATAAACC
      CCTTTGGCTTGTGATCCGGTATTTGATTTCGTTTGATTTGGCCAAAACGTAGGGTGGTTAGTTGGAATGGGGGAGGGGGG
      AATGGGCCTGAACTACTTTTGTGAAGGTTAAAAAAGTGTTTAATTGCGAGTACGGTGCTCCAAACGGTTTCGATTCGTGG
      GTCTTAGCCACTAGCCACGGTTTCAGTTCAGTTTGAGTTTCAGTTTCTTCGATTGCCCCTCAGTTTTGAGCTGGTGTCTG
      TCGGCTATGGTGACTAATAGGCCTGGCCGCAGTACTTCACATTTGAGCGATTGCGGTCAATAAAACAAAAAAAAAAAAAA
      AAAAAAAACAAAGACTGAACAAAGCTGGCTGGCTGAGAGCCGAGGCGATCCAAGCTAATTGAGGCACTTAAAAAATTCTC
      CGAGCGAATTCTCCCAAGGCGTGGTGGCAACCCTGTCAGCACGGAATCCCCGATCCCGATCCCGATCCACAGACCAACGA
      ATGGGGGGGAATGCATTCCTTATTCAGATCAAATGCCGTAATGGTTAATTGTGCAGCCCAGAGAGCCGGAGACAACACCT
      GCCCTGTGGAAAATGTTAATGATGCTTTAATTGCACCGCATGAGCATACGGGTCGACCAATCCGGAAGAAACCCATTGGA
      GCTCAACGATTTGCATTACATCTTTACAAGCGGTTTCAATTCAGACATCCCTCAAGTCATCTTCTTTAAGGGTTGCATGC
      ACATATATAAGTACTAGCGAGGTATCACTGTACCTACGTCACATAATCTGTAACGATAATCTGCAGCTGTCTTATACTTA
      TGTAAACTAAACCAGCCTGTGCTATTCCCAACTGATTTATTCGACCCTAAGCAGCGGTGGAAGGTTTTAATGTGCTTTAC
      ATTCCTTGTGGTTTGTACTTTTTTACAAACCCACCAAAATCTATTTCTCAGGACATATATATGTATATACATATATAAAG
      AATAACCTTCAACTCCATGCCATAAACAAGAAAAGTGCTCGCGATAAACCACGAATACTTTGCATGCAAATAAGATTCCG
      AATATATGCAGAGAATAATCAAATTTGGCCAGCTGGAGAGACTAGCTACTTTCAATTGAAGCCCCACATGTGGGATGCAG
      GGTTTCCCGCACAAAATGAGGACACTTCTAAGTGGGGTTAATGCTTTATTGATCGGCGTTATGTGCCAAAAAGCTGCACC
      CATCCAACCATTCCCTCACATAATGGTCTCCTCCTCCAGCATGTACTCCGTGAGATCGGCTTCGCCCGACAGCATGGTCA
      CCGGCACCCGGTTCATCTGGGCCACCCGTTGACTGGGCCAGACCATCACGTCGCAACAGTTGGTCAACACGACCACATTG
      GTGCTCGGCGTGTTGGTGCACATCAGGTTGCCGGCCTTCTCCTGGTCGCACTTGTTGAACTTGCGCCGGAAACGGAACTT
      CACGGGCAACGAGTTGCCCATCACGCTCTCTTCATCGAAGTACGGCGGCAGGGATTTGTTGAAAGCCGGATTTGTGATGG
      CCGGCTTGGTTAGCTGATAGATGAGTGGAGTAACATCTAAATCACTGAAGCACATTGAATGTACAGATCACTCACCTCTT
      CGAGAACCACGGAGGTCTTGAGTCGGCGACAGGGATCACAGTAGTCGGAGGCCAATGTGTTCTCCGGTGTCTTGGTAGCA
      CATGGATCCGGCTTGGGTTCGGGCACATTGGATCCCAAACCACTACCATGTGGCCCACTGTCACTGTCACGTTTACCCTT
      CGGATTCATGGGATCCTGGCCGCGCAATACGCATTCCTGCAGGAACTCTTCCTCGATGTCGATCAGTTTCTTGATGGCAC
      AGTCCCGCTTCAGGAAGTTCTTGATCACGGACAGATTGCGGGGCACGGCGCCGATAACGTCGAAGTCATCGCTACGGAGC
      TGGAGGCGGTGCGCCATGACTTTGGTTCTCCAAGATGAATGGAGGGGCGGATGGTTGGAAGGGGGTTCGAATTTGGGGGA
      GTAGCTCGTTTCGAGTGGAATGTTTAAATGAACTACAACTTGACGTCTGGCCCCAAGTTGAGTGGGTTTCAAGGATATGC
      AAACAATAGTTGAGATTAAGTTGGCGCCAAGGATAAAGTGCACGTTTGAGGGCAAAAGCTTGGTACACTCTATTTAATAA
      TATATATTAAGGGTAAACGCTACACTTATCCCAATAAGGTAGCTTTACTTTCCTAACAAGTAAATTGACCTACCACCCAA
      AGCTAGTTTTTAACATTTGATGGCACTATTTTCGTGGCTAGTGCTGTAGTTCTATCGCCTCCTGGCCGAGCAACAAGTTC
      GTGCGCGGTTTTACAGCCACTGGATGCCAAACCGTGGGCCTGCGCTCAGCTCGGTTTAGTTCCGCTCACTTAATCTCCGG
      CAAGCGAAACTCGGAGCAGAGCTTGCCCGTTGGATGGTCTGTTGGCTATTGATTGGAGCTTTCCGCCGCTCAAAGCTCCG
      CTCGAGAGGTTCTTATTGCCACCGCTGGCCACAGCAGCCACCAGAAGAGCAGAGCCACCCGAAGCGCCAACACGCGAAGA
      CAAAGTCCGGCAGACAGCAGCGCAAAAAGAGACAGATAGCAGTGAGAAAATCATCGAGGAAAAAAGATTGTGTGCTAGCC
      GTCAAATTGAGTTCCATTCGAGTGGCAAACAAACCTGAGTAGCCGCACCGCCATGAGCTTTACCCGCCAACTGTCCGAGA
      TGAGTGCCAGCGAGCTGAACGATGCCATCGACGACACCAACTTCCCGCAGGCCCACATCCTTTCGCGCGGACGCAACAAC
      AGCGTCTGCTCAACAAGTAGCACCTCGGGCACCTCCTCGCTGGCGGACAGGCAGCAGAACCAGGCGGAGGAGGCCACTGC
      CATTGCGGGCACACCCGTCGAGGAGGTGGCGCCAGCTCCTGCTCTCGTCCCGTTGGCCGGCAACCAGAGACCCCGCCTCA
      TCCTGAAGACCAACGGCAGCAGTCCGGATAGTGATGGTACACAACCGAAAACACCACTGACACCGCGTACATCGACAACG
      CCAGGTAGTGGTGGGTAGTGGTCCAGGACCAGGTCAGGGGATCCAGAGCTATGTTTGCTGCGACCGATTTAGTTAGTCAA
      TGAACTAGGAGGAGGAGGAGTGCTTGACAAACTCTTTTTGAGCATAAACCGTACGCCTATCAGTGGGTTAGTGTTTCGGT
      TCAGAGGTCAGAAGATGCGCCTCGGAATGGGGAATAGTACTTAGACAGCCACACACAGCCAACGAAGGGGGGCAATGCCT
      TCCTATCTCGCATGATAACGATTCTCATCATGTTTCCATCCGTATTTCCATTTACAGGCCACGAGAAGTGCACGTTCCAC
      CACGACCTGGAGCTGGACCACAAGCCGCCGACGCGAGAGGCCCTCCTTCCGGACATGGCACGCTCGTATCGTCTACTCTT
      GGGCGGCCTGGGCGAGAATCCCGATCGCCAGGGACTGATCAAGACGCCGGAGCGGGCAGCCAAGGCCATGCTGTACTTCA
      CCAAGGGCTACGACCAGAGTCTCGAGGGTAAGCACACCACACATTTCAAGCAATTAGCACCGGGTCAGTGATCGAAGTTG
      CTCATCCTGGTTTTCCCAGCGAGTGGGAACTAGTTTCATGTCGGTGAATCACCATTTACGGGGGTTCCTCGGTCCGCTAT
      GGTGCATTAGCCTAATTACCTGACCACTCGAGAGATAAAGCACATGAACATAGGGAGCCATTAGGCAATTTCGGGCTTGT
      CCAATCAAGTGGACGCATCCAAAATCCATTCAATATCCTATGAAATATGAGATTTGACTAGTAAAGTTTTTGGTCTCATG
      TTTGGCGTGCATTTCGACTTGCAGTCGCTTTTGAACTTGTCATGTAATCAATGTGAGTCGTTTGAGAAACAAAACAGAAT
      TGCGAATTATATGGTTGCTACACCAGCATACCTAACCGGTTGCCCGAGAAATCAGGTTCTACGGTTTGTCAAATAAAATC
      GCATGTAAATTTAAGATCAACAGCAACAGCAGCAGGCCATTTGAAAGCTAAATTCGTTGAACGAAAGTGAATAGCCTTCG
      GCATCGGCAATAGAATGGGTTGGATTGTGTTTAACCCGAATTCAAAGAACCCAAGAAGCCGAGCCAACGTGACTTGCCAA
      TCTGGTGTTGGGGGAACTCCACCCCCCTCCCCACCACACACACAAGATGCTTGTTGGATTGTTTGTTAGATGGCTCACTG
      GCTACTTGGCTACTTCTTGGCTTCTTCGCTGGTTGGTCAGGAAACGCACTGAAGCTTTCCGGTCTGTATATTAAGAGCGG
      TAAAGTGGGTGGGTGTGCGGTGCGGCGGCGGCTTCTATTCAAGGAATGGGAATCTCAAGAGCACATCGTTTAAAACGAGT
      GTGGCGAAAGCTCACACTCCACAAGAACCATAAGCCCATCCAGTCAAGTCAAGTCAAGTCAACCTCCCCCCAAGACCCGC
      AACCTCACACACGCACACACACACACAAACACTCGCTAAGCAACCACTTTAGCACTCACAGTCGCTTGAACTTAACATTC
      AGTATTCAGTTATGCAGCAAATAAATCTAACACGAATTACGCGCGCCATAAATCACGGGTAGCGAAGGAACGCCACTTGA
      GTAGCTTCGTGGTTGTGGGACATTGGGCGAACTTTTCAATAACGACTCCGTGGCGCAACGGTAGCGCGTCCGACTCCAGA
      TCGGAAGGTTGCGTGTTCAAATCACGTCGGGGTCAGGCGATGATGAATTCCTTTTTCGTACTTTTTTTTTACTACACCAT
      TTCAAATTTTTTTTAATAGATGTTCTCAATGGCGCCGTTTTCGACGAGGATCATGACGAAATGGTGGTGGTCAAGGATAT
      TGAAATGTTCTCCATGTGCGAGCATCATCTGGTGCCCTTCTACGGCAAAGTTTCCATCGGTTATTTGCCGTGCAACAAGA
      TTCTCGGACTCAGTAAATTGGCACGGTAAGATAAACTTAGTAATGCATATTAGATGATCTTTCATATAATTTGCGATCCC
      ATAGCATTGTCGAAATATTTTCGCGTCGCCTGCAAGTCCAGGAGCGCTTAACTAAGCAGATCGCAGTGGCCGTGACTCAG
      GCCGTGCAACCCGCTGGAGTAGCAGTGGTCGTAGAGGGAGTGTAAGTATTAAATATATATACATATATATTTTAAAGAAT
      ATTATAGTTTAACGAATGGCTTTCCTCCTATACAGCCACATGTGCATGGTGATGCGTGGCGTGCAGAAGATCAACAGCAA
      AACTGTTACCTCAACTATGCTGGGCGTGTTCCGAGACGATCCCAAGACCCGTGAGGAATTCCTGAACTTAGTCAATAGCA
      AATAGAGTGGGCACTAGAGGACGCTACTGAAATCCGAGACCAACTAAACCCCTACAATATTTTTGGAGGCGCTTATATAC
      AAACAAACAAAAATGAAACGAAACACAGGGTCCATTAGTTTATGTTTTTAGGATTGATTTCATTTAGTTAGTGCAATGAT
      TGCGCAGCCATTTTCCTTGTTGATTTGTGTAAAAATTGTTGAAAAATTTTGTTAGCAAAATACGTTTTTTAGATAGATGA
      ATGTAATGAGAAGCGAGATTCGAAGAGGACGAGATTTGAATACCGGTGTTGGGTAGTTTTATGTTCAATTTTATATGCAG
      TTTTATGGCACTTGAACGATAATTTTTACAACGTATACATACGATTAATGCATTGTGCAATAAGGGAACAACTGATAATA
      AATCACGGCAAATTGTTTAGGGAATTTACAATTTATAAACAGTTCACATCAAATTAATCAGATCTATAGTTATGTATGTA
      TGTTAACCTATATAAAGAGTTGCATTCATAATGTTCCTCGACAGGGACCAAAGTATATTGGAAGATTTTAAATGTTAAAA
      TTATATGCTCATTATGTAAATGACGTTGCTTGTAGTGAGTCAAAGCTGCTTATTAATTATACAATAAATTATGTATTTAA
      ATAACGTTAAAATGAAGGATTTTTTATAAAATGTATAAAAAAAGAAATATCCCAAAAACAACAGGAGCTTTCTCGAATGA
      CCCCGACGTGATTTGAACACGCAACCTTCCGATCTGGAGTCGGACGCGCTACCGTTGCGCCACGGAGTCTACTGAAATGG
      AGGCTACTAAGTGACAGGAATCCCCCAACACCAACAGGTTGTTGGTTCCAGTCGTGTAGTATCCATCATAGTGCTTTGTT
      TGAAATGCAGCAAGAGCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCC
      GATGCATAATTTTTTTTTAAATTTATTTCGTATATAACGAATCAAAAAAAAAAAAAAAAAACAGTGTAAAATATGATTCA
      AAGAAATAAATATAAATATTTTTTATTCAACTTCTTAGTTTGATAAATATATAATCTATTACTTGCAAATCCTACTGTGT
      ACCTTTCGTTTGGACCCAAAATTATTGGATAACAATTTCACAATAATTTAATAATGAAGTCATAAGAAAATATATCACGG
      CGACGTACCTAAAATAATGGGTTAAATAGTAAAAAAACATACAAAAAGTTTCTCGACAATTACGTGCAACTTACACCAAA
      CCATATTTTGAGCAGGCCGATGTTTTGATGCATCGATAACAACAAAAATCGTCAATAAATATCCCCGAAACTCCCACCAC
      TAGTCGTCGTTTCGTTGTCTTGTGGAAAAGTTTGGTTGGCAGTGATACTTTTTGATTTAATTCTTTTCGCGCTAATTAAT
      TGCTTTTCTTGATCTAACACCACCCATACGAATCACCGTTAGCACGGGTGGCACTTGCTAAGCAGGCCCCCGAGAAATTT
      AAAAGACTGAAAGCCCCCAAATAGAAATAAAATCGCTGCACCTTGACAGACGTGTCTGTGTGCATCGCGATTTCTAATCA
      CTCGCAAGACTTTCTTCCACAAAAAGTGAGCAGAAAAGAGCCCACAAGAGCCCAGCCATTAAGAAGTGTGCCACTATTTC
      GCCCCAAAAACACGCCGTCCACTTAAATTCCGTAAGCCAGGCAGCAAAATAGAATTAAATAACAGGGGCAAGCGAGAAAG
      AGACAGAGCACCTGGCGAAGGGTAGGGCGTTTTTTTCAAAGTTTCGCTTTTAATCTGGACAACGACGACGACAAGACGTA
      AGTGTCTTCCCATATTAATTACTTTACGTTTAATTTCTTTAGATCTTAAAAAAAATGAAATAATGGCAAGCATTCGCAAT
      GCCACACACATACGCACTGTGCATTCCAACCGAGTATGTGCTAGTTCAGTTAGTATTCTGGGCTGACACCCTTTCGCCGG
      TCCAAACTAACGGGGCTTCTACAGCTGCACCTGTATGTGTGGGGTCGTGTGCCTGCGTTTTTCAATTGGGATAAAACAAT
      TTTAAGAGAATCTGCATTGCTTCCAGCGAATAACAACATACAAATATGAATGGACAGGCGCGCATTGCTCTTCCCTCCAA
      AGTGGACCTGTACATCACTCATGTGGATCACGTGGGTCCGTATCTGAAGGTCTACGGCCACGTTAACCGAGACGCCGCCT
      CCCTGATCAGCGAACGAATCAGGAATCTGTTGCCCACATGCTTTGCCATTGAGCCCAGTTGGTCCGTGGAGCGCCAACAG
      GCTCTCCTCATACCCGGCACGTTTTGCATATTCAAGAATATCAATGGCCCGGCTCCTGGTGATGTGGAGTACAGGCGGAT
      ACGTGTGGTCAGTGCAGACCTGGAGGGTCAGTCGATGCGGGCGGAGATCGATTTCGTGGACTTTGGCTATAAGCGTACTG
      TAGATAGTCATGATGTGAGTGAATGAACCTCCTTTCAATATTGAACAATACCTTTCTAAACAATTTATCCCTTTTAGTTA
      ATGTTCCCCAAGCAGCCCAAGCTGCTTCAGAACATTCCCCTGCACTGCTTCCAGTACATTGTGCTGGGAATCTGCTCCGA
      GTGGGATCAGACCGATCTGGCTGAGGTTCGGCGGCTGGTTGTCAACCAGATCGTTAAAATCACTGTGGAACCTACACAAA
      TCTGTGACCAAAAGTTTGCCAGTCTGCGCTGGAAGGATTTTGAGCTCAACGAGTTCTTAGTGCAACAAAAACAAATCGGA
      GTTTCGGTCGACAAGCAACTCATGATGGACCACTGCAAGAAGCTGTGGAAGGATAATCCGCAGTCGCCGGTCACCGAATA
      CAACAACAATAGTATACACAACTCAAAGACGCCCATGGAGATTGCCCGTGAGCAACTAGCGGTGCGACAATCCTTAGCTG
      CTCGCTTGGATGCACAGCGATCGGTCCAAGTGACACCGTCAAGGCCGCTAAACGCCGATGCCCCTGACTATACGCCTAAA
      CATCTGCCGCTGGTCAATGTGGTATGAATGGTCAAAATTTCTATAAAAGTAATTATTAATATCTCAATTTACAGACAAAT
      GTACAGGTACAAATGCCAGGCCTAAACAATACTCAGAAACCGGTATTTGTATCGACAAATCCTTATAATCGTGCCAACTA
      TCAGCCCGCTGTGCCGGCTGCTCAACCATATGTGCCCAAGGCGAACCCCCGATCGCAATACACCTATTACAATGTTCGCA
      TGAACAAACCGATTAACGCCATGCCGCCGCCGGCCGGTCCACATGTGCCCATTCAGCACTTTAATCAACAGGCTAACAAC
      GTGTCACTGAGCTATGTTCCTGCACGGTTCACTCCACCTCCAACGCCATCGATTGCGCAACATCAAATCCCCATTCCTGC
      CTTCAGAACCACCAGCTTAACGGTGGGCCTCACCTACGACGTGGTTATAAGCTATGTGGAGAACGGTCCGTACCTATTTT
      GGGTGCACCTGAAAAGCAGCGATCATGATCTGAGCACCATGATGGGTCAAATTGAACGGACGAAGCTCAAGGCACTCGCG
      CAGGCTCCTGAGCTTGGAACTGCCTGTGTGGCCCGTTTCTCAGAAGATGGTCATCTGTATCGCGCTATGGTGTGCGCTGT
      TTACGCCCAACGTTACCGCGTTGTTTACGTGGACTACGGAAACTCTGAGTTGTTGTCCGCAAGTGATCTGTTTCAAATAC
      CCCCAGAACTGTTGGAAATTAAACCGTTTGCTTTCCGATTTGCTTTGGCCGGAACCAAGGAAATTGAGCCCATTGACGAC
      AGCATGAAGCGGATTTTCAAGAAATCAGCCATTTATCGTAACTTTGAACTGACTGTCCAGGCGCCAGAGAGTGTGGGCTC
      CATGCAAACCTGCCATCTCAACCAGAATGTAAGTGTAAATATAATTACGACAGAAGAATATAAGTAATTTGACATAAATT
      ATTTGTAGGGCACCAATATGCTGGAGCTTCTTAGGCAGCTAAAGAACTCACGTCAGTCCTACAAAAAGGCGGAGCAACTT
      GAAAACGACGACGCCGTGGAGATTCGTTTTATTGATTCGCCCAGCAACTTCTATGTGCAGAAAGTGGCCAACATAGGAAA
      GTTCGAGCAGCTCATGGACGAGATGTTCTCCTACTACAATGCAAACCAGAGAGTTCCCGATCAGTTGATCTTGGGCGCAC
      CCTGCATTGTTAAATGCGATCAGGAATGGTACCGTGCAGAGATTCTGCGCGTTGATGACTCTGTGATTGTGCGGCATGTA
      GATTTTGGTTATGAACAGAATGTGAAGCGGCATTTGATTGGCCATATTGCTGAGAAGCATCTGGAAATGCCTCGCCAGGC
      AATTAAGTGCTGCTTGAAAGGATTCGAGAACAGTGAACTTAGCGAGGACAAGATTACCGATCAGTTTGAAATGTTAGCTG
      AGGAATCCAATATCCGAAGGCGCACATTTAGTGTGCGTATCTTTCGCATTGAACCCGATGGTCTGAACGTAGTAAACCTG
      CTGGCCAAGAACCTGAATGTGATGAAGAAGCTCTACAAGCTTTCTATGCCTTTTGAACAATATCTGTCCCTGGAAAAGGG
      TCAGTTTAATGCAAACAACACCCGTGCCGAGTCTGTGATCTCTTCTGAGTTGAATAAGAGCCATATTTTGAACTCTACAA
      GCATTGGCGAGACCGAAAATCGTTTGCAAGAACAGGAAAAAGAGCAGCAACAGAAAAAGGTCGATGTTAGGCAGCAGCAA
      CTAGCAGTTGAAATTCCGCAAGCAGTAAAGTCCGTTAGCGGAAGCAAAAACTCGACAGACTGGGACAAACGTAGCTCCAC
      CTCGGCAGGCTCAAAGGACAGTAAGCGTCAGCAGCAGCAACAAATACAGCGAATCGATCGCCATTTAGACTTCAGCTGTG
      AGACACAGAGCACCGGTAGTTACAGCAGTGGCATGAGTTCGCCGCGCAAGGGTAACCGACAACAGAACGGTCGCACACCG
      ATCCAATCACCACGCCATAATGAAAAGCAGGAAGCGAAAAAAAATGCGTGAGTATTTTAGTTATTCGAGCAATGTATTTA
      TAATTTGTGATTACTATTTCAGGCGCTTTAGCAACAGCGAGTCACCCCGCAGGAGTCGAGATGGCCAGCAGGGGAACCAA
      CGCTCCCAAAATGCGCCACAGGGCTATGCTCAAAAGCCACAGCGTCAAAAATCCACGTTAGACGGAAATATCAGCTCAAA
      GCGTTCCAGCGGAGTGGGGAGTGATATTGCCTCATCCAGCTCCGAATCGGTGGCTGCCGCCAAGCCGGAGAAATACGTTT
      CCTTGGATAAACCGTATGCGCTGCAGGAGATGAAAACACCTAGCAAGGAGGCAGCTAGTTTGTCTTGGTGGCTCTCGCCA
      TTCCAGTTCTACATCGTGCCCAAGTCTGTCTCTGCAAAGTACGATAATATAATGCGTGATATGCGAGAGTTCTACCGCCA
      GAAGCAACACCAGCCACTTCAATTAAAGGTTGGATCCACCGTAGTTGTGCGCCAGCGAAAGGACAATGCCATTCTGCGGG
      CTACTGTGACCGCATGCAATCACATGATGCGCAAGTATCGCGTTTTTTGCGTGGACACAGGCAGCTTAATAACGGTCACC
      TCGGAGGATATTTGGCAATTGGAGCAGCGCTTTGCAGATCCGCCCTGTATGGCACATCGCTGCAGCTTTCACAGCGTCGT
      TACCAACTATGATCCATTGTACATTGTGGATCGCATGGAAACATTCGTTCCAGTTAATGCCAAAGTCGATTGCGAGTTCG
      TGTCCAAAGAGAAGAGCAACCAAGGCTCAAATACCAGCAGCACTTGCTCCTACACAGTTAATATTTTTGTAAACGGAGCA
      TCCCTACGAGATATGCTCGTCAAAGCGGAATTCCTTACCGAAGTGGCGCCTGGTAAGAGAAGCAACTTCTTTCTTGAAAA
      TTGTTTTGTGCCCAATCAAGTGTTTTTGTTGATAATAATGTAATTTGTTCTTATTTTTCAATAGAGATTCGCGTTAACCT
      TTTAGCTGGTCAGCAGATTAGAGGAAAATTCACTTCTATTCGTGACATGACAAGCTTTAAGGTTCAGTTTGATTATGGTA
      ACAATGTGAACTTCCTTTGCACCTATGACGATGCTAAATTTGTTAAGTCCAATCCGAATTTGGCCAGGCGATTTAAGGAG
      TTTTACGAGGGTAAATCGTTTGCCTTGAATGTCAAGAATGTCTGCGAAAACAATATGTAAGTTAATATGCACTTTACTGT
      GTGTGCGCAGTTAAACCCGATATCGTTGTGTCTTCTGATGCATTCGTTACTATTATTGACCAAATCTGATAAAATTTATG
      ATTTATTTTCAAGCGTTCATCTGAGACCTGTAATGCCGTTGTTCATGGAGGATCGCAGGTCATTCATCTGCCCCTATCCC
      GTGGTGCTGAGCTCATTCCAAGCACTCGTTGTGTACACCGCTAAACCTTACCGCGTGTATGTTCAACCGCAGGCCATAGT
      ACCATCTATGCAGACCCTATTGGATAATATGTATGAACACTACAAGGCCAAGGGTAAATACTTTAGTTGATATTTAGACC
      ATCAAATTAACCTCTTTTTATTTTAGGCGACTCTTTGAAAAAATTTGATGTGGGACAGATCTGTGCTGTACGAAGCTCCG
      ATGGCAATTGGTACAGAGCCAGAATCTCAGGAAAGGATTCGAATGCAGCGTGCTTCGAGGTGTTTTACATCGATTACGGC
      AACACGGAGGAAATAAAGCGTGACGATATCAAGGCATTGGATGCAAAGTTTTATGAGCACGCAAGCGGCTTTGCAGTGGA
      GATTAATTTGCCGATTGGCCGACCCAGCAACGATACAAAGCTAAAGGCGCGTATATCCGAGATTCTTGAGGAGAAGGTTG
      TCACTATCAAATCGATTGAGGTGCGGCGCAGTCACCTAATTGCCGATGTCATTTTGGAAAACAATCAGAGTGTGATAGAC
      CTGCTAAAGGCTGAGAAGCTTGTACCCGGCAAAGATTTGGATTACATGCGCAAGCAAATGGAGAAAGGAAAGTCTCGCAC
      TTACGAGTACATTGAAACAGTAGACCTAACTTTGGACGAAGAGGAGGATAAGGGTCGCAAGGAAACTGTCAGCAAGTCGG
      GTTCGGCAAATGCCTCCCCAAAGAAAAAACAACATAATGACAAGGATCGCGAGCCCAAAAAGAGTAAGCCAGCAGAGCCT
      GCTCGTACTGTTGCTCCACAACCTGTTGCATTGAAAACTCCTTCACCAGTTCCGGCGGAGCCAGCACCAGTGCCAAAACC
      AGCCACTCCAGTTCCAGAGGTTGTTGAAGTACCAGAAATTAATCCAACTGTCAGAGAAGCTGCTGCCGAGTCAAAGCAAG
      CTCCTGCACAAGAGGATCCTTACAAAGATTTGGACTGCGTTGTACTGAGCCATTGCGACAATCCTGCACAGTTCTATGTC
      CACCCGATCGATCAGCTATCGAAACTAAATCAGCTGCATGAGAACCTTCAGATTGTGTCTCCCTCTTTGCCCCAGTTGAT
      GAACGTGGTAAACGGTGCAGACTGTGTATCGATGTATTCGGTGGACAAATGCTGGTATCGCGCCAAAATCATTGATGCCG
      AGCTAATGGTACTACTTTTCATAGACTATGGCAACACAGATTGCGTTTCGGATGCCACTGACATCAAAGAAAGCATGTGG
      TCGCATATCGAACCCTTCTGCTTGCCATGCGCACTCCCGATTCGACCCAAGGGTACTGCGGATTGGGTGGATGCAGCGAA
      TGGCATCTTTAACGAATCGTACTCGAAGGTCCCGCGTCTGGAGTACCTTACCCAAGGAGATCACTACACGACCAGCTATG
      TTAACATGTATATTGATGGCGAGGATGTGGCTAAGAAATTAATTGCCGATGGTTTTGCTAGGCCGTTAGAGTATTTGGCC
      AGCGGATGCAGTTGCTACATTTCGCACGTGAATGGAATTTGTGATTTCTTTATTCAACTTGAACGTGATTCAAAGGCGCT
      AGAACTAATTGAGTTGTATTTGCGCAAGAAGGACACATTAAAGCCCCTCGAAGGATTTGAAAAGGGTTTGATTGTGGCTG
      CTCTATTTGAGGACGATGAGCTGTGGTACCGAGCCCAGTTGCAGAAGGAGTTGCCCGATTCCCGATACGAAGTACTCTTT
      ATCGACTACGGTAACACCTCCACCACATCGAAGTGTCTAATGCTGTCCGAAGAGATTGCTAGCCTACCCAGCTTATCCAA
      GAAATGTTCGCTGCAGTTGCCAGATGCCTACATCTCATGGTCACCAGAAGCGGAGGCCAAATTCGCCGAACTGACAGGCG
      AGGGTGAGCTAGTGTTTACCACACAGCTTCTGAAGCCAGGACAGGATCATGTCACCATTGATCTTCTCCTGGATGGAGAG
      AACATCATCGACCGCCTGTTACCGTTGTGCCAGCGAAAGGAACCCAAGGAAGCCAGTAAGGAGTCCTTAGCTGTTACCAC
      TAAAGCCATCATTACGCACGTGGAGAATACATCCCGTATATATCTACAGTTTAGCGAGAAGGATTCATTAATGGATATTA
      TATGCGAGAAGCTAAATGGAAGCAAGCTGCAGCCTAAGACGGAAAAGGCTGCAGTAGATGATATGTGCGTAGTTCAATTC
      GCCGACGACTTGGAGTTCTATCGCTCACGTATTCTGGAAGTGCTCGAAGATGACCAATACAAAGTCATTTTGATTGATTA
      CGGCAATACGACTGTGGTTGATAAGCTTTATGAGTTACCTCAAGAGTTCACGCTCATTAAACCTGTGGCCGAAATATGCA
      GCATGGAACCCAGCGCCATATTTGAGAAAAATAAAGCTCTAACCCTGACAACATTTGACGCACTGCTGGACAGCTGCAAG
      GGTGTTGTGGCGGTGGAATTTGTAAACAAGTCTGCCAGTCCTCCTGTGGTCAGATTGACTACTAAAGATAAGAGGAGCCT
      GAAGATCTATGAACACCTTCAGAAGTTGGTTCAAGCCGAGCTGAAACTAATCCAAAAGCGAAACGAGAACTCTGAATGCA
      TTATCTCATATGGAAACTCACCCAAGAGTTTTTATGTGCAAATGAAGCACAATTCAGCGGATTTGGACTTGATTGTGAAG
      ACACTGCAGTCCTTAAAAAAGGAGAAACTGAAGAAATTAATCGATCCTACTACAAATTCAAATGGTGTTTGCTACTCCCA
      AGAGGATGCCTGTTACTATCGCTGTAGTATCAAGTCGGTATTGGATCCTAGCCAGGGATTTGAAGTCTTTTTGCTAGATT
      ATGGAAACACCCTGGTCGTTCCAGAGGTCTGGCAGCTACCCCAAGAGATAGAGCCGATTCCATCGTTGGCTCTACACTGT
      CAGCTGAGTAAGATTCCAATGGATGTGTCTGACGAAAAGCTAGAAGAAGCCTTTGCTGCTTTGCTAGAGCAGCACTTCGG
      AGAACTATACGAAATAACTACTCAGCCGAACGAGGATGAGACAAAACCTCTGATTGCTGAACTCCGAATCAACTACAAGG
      ATTTCGTCCAGGAGCTGGTCAGTACGGTGACCGGCGTACAGAAACCGCTCGAAGCGGAGCTGCACAACTGTGTTGTGGTG
      CAGTTCGATGGCCCCATGTCCTTCTACGTCCAGATGGAGAGCGATGTGCCAGCACTAGAGCAAATGACTGATAAACTGCT
      CGATGCAGAACAGGACCTACCCGCCTTTAGCGACCTCAAAGAGGGAGCTTTGTGTGTGGCTCAGTTCCCGGAGGACGAGG
      TCTTCTATCGCGCCCAAATTCGCAAGGTTTTGGATGACGGAAAGTGCGAGGTGCATTTTATTGACTTTGGCAACAATGCC
      GTGACGCAGCAGTTCCGCCAGCTGCCTGAGGAGTTGGCCAAGCCGGCGCGATACAGCAGGCATTGCGAGCTGGATGCGTC
      GACCATATCCAAGTGCGACGCGGCCCTGCTCCAGTCGTTCATCGACACTCGCTTCTCTGAAACATTCCAGGTAGAGATTC
      TGGCCACCAAGGGAACTGGCACCCATGTCGTACGACTCTTCTACCAGAGCAAGAACATCAGCGAGAAGCTTCAGGAATGT
      CAGTGATCACCCCGTTGTACAGTCAGATCGGACTCATATGTGCTCCATGCAGGAGATTGTGATTGGGTTGGCTAAAAACA
      TGCGATGTATTATCCATTAAGTTGAACGAGTTAAACTTATTCAAAGGGAAGAGGAGGACACCACACGATTAGCCAAGATG
      CTTCATTGACTTTTCATGGAAAACCAAAATGAAAGCAATTTTTAATATTAATTAAAGAATCAATACGGAATGCAAAACAT
      TATCACCAAAAACACAACAAAACGAAAAAAAATCGAACAAAAAAAAAAACGAAAAATCATTGAAAAAAAATGTATAAAAA
      CAAACGAAAAATATTGAAAAAAACTTTAAAAAAAAATGTAATCTAGATAAAATTGGCACTAACCTATATATGTTAGTAGC
      TATTAAGGCGGATGACGATTTATTTAATTGCTCAACCTTGTTTAAAACAATTTTACATCATCAACGAAAGTTGGCGAATT
      GAAGAGAAGTGGAGTGAAGTTTAAACCTCCTCCAGATGAATTATTTATTTTTTCCCTTTATAACTGTATTTGTACTTTCT
      TTTCTCGATTAACCAACTGAAGAATCACATATGTTTTTCGTACTTTTTTTACTTTTCATTACCTAAACAAACAAGAAACA
      TTGCAAATCGAAGACTTAAGGAAACTAAAAGGAAACTAATGGAATATGGGTTTATGTATTAAAACCTTCAATCACAATGT
      CATATTTTTCTACTATTTCTTTTTCATGTTGTGAACAATATATTAAAACAAACCAATAAATACGATGAAAAGTAATGCCA
      TATAGAGCGTATATTATTACCTGGTAGTTATACCTGGAGTTCCAGACCCGGTGCCAGGTAGCAATTAGCGGTCGTCAGTC
      GGGGATTTATTGGATTACGATGTGGAAAAGTGGCGAACGGACGGACAGGGCTCATGTCCGTGCTTGAGGAGATCTACGGG
      TGCCTGGGAATTTTACCTGTTGATAAGAAGAGAATTAAGTCGTCTGCCCACATTTATGATACGGATCAAGCTCTCATTGC
      TGACTATCCGCGATATCATTCACATTCATTTAGTTAGTTGCGATATCATTCATACGCGTTTACAACTGTATTGTCAGCTG
      GCGTGGATGCTTCATTAGATGCCTCTGTATCAATTTCGATTATCAATCGCTTGCTAATTGAATGAGTGGCCGGCCAAATC
      AGAAATATCCACATTTGAACTGTCAAAATCCCGAAAACAATTCAATTTCCAGTCGCAGAGTGTATCAGTTTCCATTGCTG
      TTATCAAAGAGAGCGCTTCTCTCTCCACTCCGAATTTTCCATCCGAATTTTCACAGTGCAGTGCAGTGTCATCTGGGAGC
      GTGCGTCCGCTTTATCAGCATTTTTCGGTGTGCTTTGCTCGGGCGATCGGATTGTCGGAGTCCGAAAGGCCAAAAACTGA
      AACGATCGTTTCAATTCTGTGTCTGCGGTTGAATTGAACGGTTCCGGCCAACGTGCGCGCTCCGTAACGATTGCTATAAC
      ATTCTACGGCGTAATCATAACTAAAAAATATTGATAATATAACATATAAAGCTGTTTGAATATTACATATATATAAAATA
      TATAAAGATCACAGAAAATCGAAGAATCCTAGAAGAGCATAGAGTGATGTGTGTGTAGTGAACTAACAAGAATCCTGCCA
      TTTTACTAGGATTATCATCGCCGACTTTAAATGGGATTATACCTGAACACTTGAATTTCCCCAGCGGTAAGCGGACGGAA
      AAATCTGTTTGGATTTTTTTTGATTTTTTTTTGTTGATTATTTTGCTTTCTTGATGGTAGTATTATGGGGTCTGGCGGGT
      TATCGTGAATGGTGCACATAGTACTACGACTAGATTGCACAACAGCTGTGTAAGCTATATTGAATTTTCTAATCAGGAAA
      CTTAGCATTGAAATGTGCGCCAGTCTCTGGATTCTATATGCTCTATATGCAACCAAAAGAGTCTCCACGACAGCATAATG
      CGATAGAATCCAAGTTAAATTGATTTCAATTAGCGGAGGCAGCACAACGGCAATTGTGAGCCTTTCTCTGTGTGTGTAGC
      ACACATATCTTGCAGATAAAATAAAAGTTTCACTATATACTATATACTACTTGCTGTGTGTATCTACTAAAAGTAACGCT
      TCAGCAGGGCTGTTTATTCAGTAATTAACTGTGGTAAAAACACGTAGGGAACACCTGCTTATCAAGGCGCAGACTAATCT
      TTACAGCCAGTGTGTTCTGGAAAAGTAATCAAAGCCTCGAGAATAGGGAAACGTTCTCAACAAAGAAAAGTTATACAAAA
      TGTCATATTCTTAAATAATAAACACATGATCGAAATATGATATTTTCGACTGGCATTCCGATAAAGTAGAGTAGTCACTG
      TATTTGGATACTTTTGTTTTTTTTTTTTTTTGTTTTTTTCAGTCCCTGGGCAAATGTTTTCTTGATTGTGTTTAATTGAA
      ATAAATGAACAACGCTCTTTTATGCTACACCAATCTTTACGGGGCCGTTTCAATTAATTTTTTTTTTTATTGTTCTTGGC
      ATCGCCGTTATAATTTTGAAAGAAGCTATCAGCAGAATGGGGACTTACACGATAAGAGCACTTGACGTACTCTGATAAGC
      TTCGGTTTTTTTTGAGGAAAATATGATTGTTACCCAATGGCATTTCTGGGAGGTGGGTGGTAATGAGAAGGTAGCCCAGA
      TGGGAAGGTTGTCTCAAAGCAATGTTTCATCAGTGCATCAGAGAGAGAGAGAGAGAGAAGAGTCCAAACAAATAAATCTT
      TATCGTAGCAACGAGAAATGTGAATAAATCTCGGGGCCCTCCGGTGCACACACACACACACGCACACCTGTTGGGGGTCG
      GCCAGGGAGGGGGTGGAGCTGAAAGATATATATGCCGATCGGACGGGGTATAGCCGATAATATATGCCTACTTCTGCGAC
      GCCCACAATGTGTGACAGGAACTATCACAAGAGCACATAAATCCATTCACAAATGTTTAGAATGTTATTAAAATATTTGA
      TACTAATTTCGTGTTTTTTTTTTATCTTCCGATTTTTTTTTTTTGTGGTGGGGGATTTTCGATTTCATGTTGCGTTTTGT
      TAGTCCAATAATCGCTTGGCTCGGCGAACAGATAAATAATCCCTCCTCGTCATATTTATCATATCGGGCAGGCTGCAATC
      CGTTGGTCGACAGTCGGATACGGGCAGCTGGGTGAATGAATCGCTAGCGCCTTGGACCATTCCGATCCGTAACCCATTTC
      TGCCACCCCATTCGCCTTTCCATGGCATTGTTTGTCTGGTCTGCCGCCTGATTGGGTATAATATATAAATAAATATTGAA
      GCTGAACAAATGCGGCGAAAGTGAAAAACATAAATTGTGACCCCAACCAATAATTCCAACTCGCAAAGAACTAATATCTA
      AGGCTAATTCGGATTCACCATTTGATTTGCGGGACGGGATCACTTTTATGGCCATAGCCGCCAAGTGGATCTACCATTTG
      GTGCCTGGCATTAGCCCTTTTTATGGCCAATTTCCTTGAATTCCCAGCCCCCTAACAAAAGTTGTATAATAAAGTCAGTC
      AGCTGGGGGATGCGATGCAATCTCCTCAAATCCAAAAGTTTGCATTTGGTCGCCACTGTTTATGCTGCCATCTCATTCTG
      GCCACTGTTTTGGGCTTTTCTGGTTAATTTTAATTTAAATATATGAAATATATTTATAGCCATTGTTGCGGTTGCTGTCA
      GTCCAAGAGAATGTGTGTGGAAATCGCTTCAATATTTCTTTTGATATTTTCTGCTTCGTTTTTTCGCTGATTCGACAGGC
      GGCTCTAATGACAGAGGTAGCCGCACCACACTGGGTGGCAAAAGTGTGCGCCACGCTTCCGCTAGTGGAGCAAACATATT
      GGCAGAAACTGTTTTTCATTTTCTATGTTTTCATTTCGTGAGCACATGCCTCTCAAGTGGAGCGCAACATTTTTTGGTCA
      AAGGCCAAGACACTTCAGCTAGCTGGAAAATAGGCAAAAATTAATAAATGGTCGAATCATGATGTCTAAATGGGGACCAT
      GAATCACTTAAATTTTTCCAAGCCAACGCAGCTAGTATGAGCAACGACGAATGGTTACTAACTTTATAATTGATTAGCAC
      TCTTTTGTTGCCTTTGCAAGAGGCCAAGATCTTATCGGCCAACTGGGCGCTCCATATGTCTTAATTCCGCCACTTGGACG
      GGCTCAAAGTGATTTGCCAATATGGATGGATATCTACGACGTCGTTCATCATTCATTGGTAAGCAAGCGTTTGAGCTTCG
      TGTAAATAGAACTATCCACTTTTGCTGACCCGCAATTGATTTCACGGGAATTTCAGCTTCGTTGGGCGAAATGATGAAAA
      CTTCAGCTGCGACAGCAATTAGCCCGAATGTCACAAATGGAAAATTACAATACTCAAGACATTACTCATGTTGTTCGGTT
      TTCATTTTCACATTTTTCACAATGCAAAATCACGCAAAGCCAGCTGATACAAAGTTGGGAAACGTGCAATTTTCTAATTG
      CCCTTCAATGGGGCGTAACAGAGACATTAACAATGGATTCTGGCCATTTCCAATTCCCAAATGTGCATACCGAGTGGGCT
      TACATGTTTAGATCATGTCTAGATATATGTACTTATCCTGAGGTATAAATCACGTCGAAGCATTCCTATTTCTGGCCCAT
      AATCGATTATTGGCTTTCATTTTCACCAAAAACACTTATATTGCTTTTGGCAAATTTCGGGAAATGCTTTTGTGAATCTG
      ACATATTGAAAAGAGCCATAAAGGCATTTTAATGGAATATTTGTTTGATTTATGGCTACCCCTTTTGCTGTTTGATGTAG
      AATCAAAAGATTTACACGCCGCACGATAAGATATTGGAGCAATGGCAAGTGCTTCCCAAAATGGCAGTGAGTCAGTTATT
      TTTCGGGCTAGTTGCTTTTATTACTATTATAGGGCCGCCAAATGTTTCCGCCGCCGCAATGCGGAATCATCTTTTGTTGA
      TGTGCATGAATGCAGCGGGAATGACACTGATTGTGTGTTACGTATACGTAATATGAATATCGCGTATACGCAGGCCAACA
      GCAGCTGACCTAGGCTTCGAATTTGAGCTCAGTTTGTATCTGTATCTGTATCTGAGCTGCCATGGTTTAATTCCATCTGT
      CAGGTGCGGTAGATCCGCTTGATTGAATGCATTCAGCTTTGGATGCGAGTCCGCATTCACCCCCAAAAACCAATCAAAAC
      CCAGACCCAGACCCCCAGCGATCGGCAATGATCTTGTAAATTGTTAATTCGAAAATAAACGCTTTGACGAGCCCATGGGC
      GATTGTTTGCTTAAATTTATTGTTCTAGTTTTAATCAAGAATATAAACAAGTTAGCGCCGAAATGAAGTCCCATCGTTTG
      GATTTACATTTTCATCTATATGTATATATGTTAATTTATTTTGGCAGAGCATGGAACTGCATTGGCAGCTGCTGACGTTC
      ATCGTGTGCCTCCAGTTGTTGCATTCCGCCGGATTCATCATTCAGTCGGAAGTGCGCAAGTGCACGTACGGCCATATCGA
      TAAGCTGCTCCGGATTCGTTGCTACGACTTGGACCTCAAGGAGGTGCCACAGAACCTCAAGAGTTCGGTGGAGGTGAGTA
      ACGATCGAGGGGTCAGGCGATCAGACTTGGTCATTGCTGGGCCCCTCGTCACAGTTAGCCTCAATTGAGCTTAATTAAAG
      AATAAAGAAGTTGCCCACAAACATAAATTTATCCATTACACCGACATGCATAGTCGATGTGTATGGGAACCCTACCCATG
      CCATTCAAAACTCTCTACTGAAATTAAATGATCTGACAATTCGCTGAATGTTTTTTGCAGGTTCTGGATCTATCGCACAA
      TCGCATCAGGAAGCTGAAAACTAGCTCGTTTCAGCGATACACGGACATTAAGTTTCTGATGCTCTATGATAACATGATCT
      TATCGGTGGAGGTGGGAACCTTCGAGCCACTCACCTCGCTCCAGGTAACAACGACATCCAATTAATCAACGAGTGTGTCT
      TTAATTAATTTCTTAATCGAAATTCCCAGGAAATTGATCTTTCGAATAATGGACTGACAACGATACCGCTGGAGTTGTTC
      CAGCTGCCGCGACTGAGAAACCTATACATCGATAGCAATGAGCTAACATCCCTCAATCTTCAGGCACTGGAGAAGCCCAT
      TCGTGCTCCACTGGAGTACCTGAACGTGGCAGGTTGCGAGCTACAGGAGTTACCCGATCTGGGCATACTTCCAAGTAAGC
      AGAGATATGTAGATATATGGAATCTATCTAATATTGAACGATTCTCTTCAGAACTCTGGCAACTGAATGCCTCGATGAAT
      CCGCTGCAGAACTTCAGGATCGACAGCCTGGCGAATATGTGCCACCTGCAGGTCATCGATCTGACCAAGTCGCAGTTGAG
      CCAGTGTGGCTGCCAGCAGGTCACCAACCATCTTATGATGCTCGGCGCCAGTCCGAAGTTCGTGCCAGTTTGCTTGGGTA
      AGTAGTGATGGCGATGATGGCGCTGCAGTCGGAGCAGCTGCTTATTTTTGGCACATGACCAACTTGCAATTCCATTTTCA
      GAGGCGCTCGACATCCGCGAGTGTCCACTGCCCTACAATCGAACGATCCATTCGCCAACATTCGCCAGTTGCCAGACGAC
      ACTGCAGTTTGCCGAAACGCGCAGCTTCTGGCTCTTTGGAGCTGGCTGCTTTGGCGGAGTTTGTTTTGTGCTTTTAAGTG
      AGTTACGAATTAGTTCTATTCGACATAAGTAAATACATTTCCCACCTCCCACAGTTGTCATCTTCTGCGTGATACACTGT
      AGGAGAAAACGAGCCCAGCGACGAAAGAGGAATGCCCAGAAGCGAAAGCCGTTTGTGATCTCGCCCAGAAACGCCATCAA
      CAACCGTCAGCCGGAGGACGAGCCTCTGCACTGTGATATTGCCCGAAAATAGCACTTTAGTTAGTTAATTAGTTGCTTAG
      TTAGTTAGTTAGTCTTAGGTGCCAGTTATTTATTACCTACCATTTATGCGTTAGTTTAGCCTTAGGACAACCGTCTACCT
      AGCAAACTGCCTTGAATCCTTTACCAAAAATCACACAAAATCACCAAAAACCAAAAACAGCGCCATCAAAGAATATTGCC
      TTGCTCAAAAGCCATCGCTTATTTATTTGGTTTAATACGTAACATAGATTTAAGCCAGCAATGGAGTGGATTTTTTATAA
      CGAATGACAATAAAACGTTGATTTAAAGAAGAAGTCTGTATTGAGTTTGTATTTAGACTTGGATATTTAGTTTCTTAACA
      ACATTATGTATTTTTATGAATAAGGAAAAATATTAGAGATATACATTATTTGAATATATCGTTATTTATTTATTTTAGTT
      TAACTTAAAAATTGTCCTAAATCAATTTAAAGTGCATCAGCCTGAAAGTAGGCAAGCTATTTTGCAACCGACTTGGTGGT
      GAAGCCTTTTCATCACGGCCAACAAGTATGCAATGGTTTTACAGGCTTAGAGCATTCAGTTCCATGTTCAATCGACAATT
      CATTTTAATTGAATTACCAAATTGCTAATGAAAAAATCGTATTAATTCGATTTTAATTTATATATTAATTTCGATTTTAT
      TAGGCTTTTTCTTTACAATTTGTTCGGCCTGCGTTCTCTTAAAATGCTTTTGTATAGTCTCGTCGCTCTTCGTCTCTTTC
      ACAACTACTACTCAATGCTCGCTTTTGATGACTTTCTTTCGCACCTTTTTTATCGCGCTCTCTCTGCGCCTCTCTCTTTT
      ACGCTTATAGCCGGCAAGTAAAGAAGAAGCATAAATAGAAATGAAATATAAGTAAGCGGAATGCAAAATACTTTTTCTTT
      GGCGCCTTCCTCCTCACACACACACATTCGCATTCGTATGTGAAACCAGAAAGAACAATATAGTATTCATACTGCACCTG
      TATATCGACTATAAAGTACGCTGTACGTTGTATGTTGTATTTTACCATATGTATAGCTTATGTGTTTCCTTTTTTAATGC
      GGTAGCCTAGGATGTTGAAAATTATTTTAATTACATTTTTAAATCCTTTTAAAAAGACCCTTGGCTCGGGACTTTAAATT
      CACTATTTATTTATTTTTATTTTTTCTCACTTATACATTTACCCAACTTGCCTTCGTGACTATATACCCTGTGTAGTTCA
      CATATAGAGGGTATAATAAATCTCCCACCGGCTTTTCTTGTGGTGGCCAACGACGTCGACTGCGCTGCCGGTGGCTCTGC
      ATTGGCATTTAGGCATTTATGCCCACGGCAGTCGAACAGCCGCTTCAGATTCTCGTCATCGCTCGTGGAAGGCACATCGC
      AAACGCCGCTCTCGTTCTCGAATTTATTGTGAAAGCTCAGCCGCCCACCGCCCGCCGGAAAAGTCTCGCGAGTGTCCCGA
      AAAAATCGAGTTAACCCCCCAAAAAAATCTATCATATAAAATCCTAACAAAATGAGCAGTAAGTTGGGTCACAGCCAAAT
      CCAGAGCAAGCAAAAAAGCAAGAAAATAAAAGAAAAAAAGAGTGTGTGTGTGTATGCATGGCTAAAGCTGGAAACTGAGA
      ACTGAAAAGTCGATAGAAAACAGCCTGCCCTAAGTTAAAGCTCCTTTGGCGTTTCCTGCTAATCAATCAATCAAGCAACA
      AATCGCCTATCCTTCCATTTCGTAACACTCGCTTCAGGTTGGAGTTATGCAAAATCCGAATTCGATTTGAATGCAAAATC
      AGAAGCTGAATCGAAATCATAGCGATAATCCCACTACTATAATATATATAATTATAAATCGAGCATAGAGCGCGCGCGAT
      GTTGGTGTGGCTACGACCTTTACTGACCTTCACTAGCGTACGACTCTGCCCACGGCCCCCCGCCTCATCACCATCACCGT
      CACCACCCCCTGTTTCGTCGCTCTCTCCCTTCGCTCTTAGTTTCTCTCTATTTTGAAACACTAACGTGCAGGAAAACATT
      TCAAAAATGCGAACATTGCACTGGAAACCGAACCGCTGCCAGTCAGTCGTCTGGCATATTTGTTTGTTTATGAAAAGTTT
      GTGCACAAAATCGCTGATAACGTGAAGCTCACATAACCTTCAAGAAGAGAGAGAGAGAGAGAGATAGATGGGGAGAGAGA
      GCGAGCTTACAGTTATGTTAATTCCGTTTTGTTGTGATTCCATTACATCGATTTCTGCGCTTTGTACCTGTCGCAATGCT
      GGGTGGTGACCCAGTAATCCCACGTAGCGCCATTAGCAGCCGCCTTATCATCCATCCGCCTTATCAGCAATGCGATTATT
      TCCGCATCTGCAGCCCATTGAGATTAGCGGCCCATTAAGGGATGCACTTCGCCTTGGCATTTTTCACACGCATTCGCTGA
      CGTCCGGCGATCTTGTTTGAAGCAATACAATATTCACAATCTATATGTGGTACACCCCATGGATGTGTGATTCTATTTTT
      AAGTTCGATATGTATGGGTCGGAATTATGGCTGGCGACAGGCGCTAACAAGTTTTGTCTGTTTCGAAAATAATATTATAT
      TTGCCTTTCAAAAAGTTTTCCACGCCCGAGAACATTCTTTTGTGTCGCATCGCCATCGCCCACTAGTAAAGTGTGTGATC
      TCTCACATTTTTCTCTTTCCTTGGAAATGCCATTAAATCTGCACGGATTTATGCCCGCATTAATCATCAACCTACGGCCG
      GCCACAGCAGCTGCCTTCAATTTTCTAGCCCGCAGGGATCTCCAGCATCTCGCGTTTCGGTCATCTACAGACACATCCAC
      ATCCACAGCCACATCCATGAATCCATGGTGATTCAATTTTCTAAAATTGCTGCGTCGCCTGTACCGAAGCGATCCAATGC
      ATCGCCTACCAACCAGCAGATACAATCTCATTTCATTTCACTTCGCATCGCCGGCGCTATTTTTAGTGGCCTGCTCTTTC
      GGATACAGCATCGGCATCCACAAGATACACACGCCGCCTGCTGAGGTTTCCCGCAGAACTCGTTCCGCGCCTTGCACTCG
      CCAATTTGTGCGTTGGTGTCGCCGGCGATCCTCGACACGACTTCCTCCCAAGACCACTCCCTTCATTGCATACCATTATG
      CACTTCCAGCGTACAGGCCAACATGGATAACTCAAACTCTATGCTAGACATAACCATATATGTAGAAGGTGATGTTTGGT
      ATATTATAAGCTACTTAAACACACAGGATAACCTACTAACTATACAGAATTTGCAATAGAGTTATTGTGCCGAGCTAGCC
      AGGCTTGACTGTACTTCATTTCTTGTGCGCCGGCTGCAAATTATGCGATGCTTTAATGGGGACCCTGACAAACGGGTTTC
      AGCGAGGGAAGGGATGTCCCCTTCAAGGTCTTGGCTGCCCATTCATCTAATTGGTGACCCCATTCATGGTGGTATCTGGC
      GTTAATCTGATCTGGGCCTCATCACGCCTGAACGGGAATTTGTTCAGTCACTTGACCCAGACCCAAAAGCTCAACCCGCA
      GCCCACGACCCCCGACCTTTTTTCCCAATTGCTTTGGCAGGGCGCTTTATCGGCTTTATTGTGCTACGGCCATACGCAAT
      TGATAAAAGCGGGTAGTAGAAAACAGAGCGCAAACTCTGCTCAGCGAAGAGAGCGCTTAAGAGAGAGTTAAAGGGAGAGC
      ATATCTCCGAAGAGAGCTCTCTCTCTCCCTACACTGTCAAAAAGTTAAGGAATTTTCCCACAGTTAGCTGTCACATAAAT
      TGCTAATTTACCTATTTTTAAGTTTACGTGCTAAGCATATGTTTAAGTAAAATGTCGCGACGCATTCATTTTGACAATTT
      CAACAGTTGTTGAAATTTTTGTATATTTAGACCGAGTGTTGTTTATTTAATTTTGTTTAAATCGCCAAATTTATGACGAT
      TGCCGAAAATTCCTTTTCACCGTTCTGCCACATAAGTTTTATTGTTTTGTGAAATTTTTTGTCATTTTTCGCACACACAT
      CCGGTAAGTCAGAAGTTATTAAGATTCATTCTAGTTTTGCCGAAAGTAAATGATTTCATTTTTATTTTAGGCCCAACGAA
      TCATTTCACAAGCACACACAAACGCAAATAGAAAAGAAAGCATCTGTGTATCTCTCACTCGCACACACACCAATGCAAAT
      ACAAGACCCAGTCACACTCACCCACACACACACACACACACACATTAAAGAATCCGGCGGAGGATATAGATCGTCCTGAT
      CTCAGTCCAAATCAAGATCAAGATCAAGATTAGGATCAAGTTCAGCCTAGTGAATGCATTTGAATGCCGCTGATTAGCTC
      GCTGTGCAGCAGTTACCATCAGAATGCGCATCCGCATCCGCAAATGTGTCCACATCCGTATCCGCATCCGTATCTGACTG
      CGAGAAGGTAGTTGTTGTTATCCACCTACTTGTTGTATCCTACGCTTCACAGTTCCTTTTCAGTTCGCTTCTCTAAAACC
      AAACAACCAACAAAACCAAGCCCATGTAAACAGAACTCTAATCTGACACTTAACCCGACTAAAGTTAGCACAACGAAATG
      TATCAAGAATATAACATATATATACACACTTGTATATATATATATTCATCTATCTATCGATTTGTAGTATTAATACCCGA
      ATAATAATGTTCTAAATTCCATTTACTTGTCAATAATCAAAATTGGAAATAAAAAATAATTCGTACATCTTCTCTCTCTC
      TTTAACTCTAATGAATTTTTAATTATCTAAACAGCAAATCTGCATGGTTTAATAATTTATAGAAACGAGAATTTCTTCGA
      AATTCACTTGTAAATTGTGTACCATACGGATTCTAGAACTAATTCCCCATCGAGTGAGAAATCTGCACCGAAACAAAAAA
      AAATCAAACTCATAATCGCCTCATAAACGTGTATATAGATACATTCATATGTATATCCTAGCCAGCGCCATGAATAATTA
      TCTACAGCTTTTTTGCCCAACTAAATGCCAACTACGCAAAATTCTAATTGCCCGTTCGGACGCGCCTGAAATATGCTCAG
      CTCGATTTTGCCAATTCATTAATGGATCTTTATTATTTTTTTTGTTTTTTTTTGTTTTTTGCAATTTTATCCTCGCTAAC
      AAAGCAAATGAATTTTGGTTGCATGTGGGCGATGCTGACGCAGTTGGAGATCTGCACACACCACTTGAACATATATATCT
      ATATATCTGTTCTATTTCGAATGGGGAACCCGAACAATCGCTTGTTTATTTATAATCCGTAACGTTTTTTGCTGAATCCG
      AAACTAATAAATACAGCCAACTGCTGCAGTGAAACGTGCAGTGCGCAACAGTATCTTTTTGTGTTGTAACCCAATTTGTA
      TCTCTGACTTTAGCTATATATCTCATCTCTCTTGGCTACTCCATCGATAGCGTTTAATTTGCAATTGTATCTCCATCTCT
      CGTTTCGAATAGAATTCGCTTGGGTGACGCTGACGACAAATGACACGTACTCACTGGGTGCCTTGGTCTTGGCCCACTCA
      CTGAAAAGGGCCAAGACCGCCCACCAGCTGGCCGTTCTGGTCACGCCCAATGTCTCGCAGGCGATGCGCGACCGACTGAA
      GGAGGTCTACAATGTGGTGCAGGAGGTCAATGTGCTCGACTCACAGGATGCCGCCAATCTGGCGCTCCTCTCGCGACCCG
      AACTAGGCGTGACCTTCACAAAACTCCACTGCTGGCGCCTCGTTCAGTTTGAGAAGTGCGTCTTCCTGGATGCGGACACA
      CTGGTAAGATATGAAGTATTCCAAGGGCACAACATGTAACTTGTGAGCTAACAAAGACTTAAATAACTACTTTCAATTTG
      ATTTCGTAGGTCTTGCAAAACTGCGATGAGCTCTTCGAGCGCGAGGAACTGTCGGCTGCTCCGGATGTCAGCTGGCCGGA
      TTGCTTCAATTCCGGCGTGTTTGTGTTCAAACCTAGCGTGGACACCTTTGCCCAGATCACAGAGTTTGCCGTGAAGAATG
      GCAGCTTCGATGGCGGTGACCAGGGTCTGCTGAATCAGTTCTTTGCCGACTGGTCGACGGCGGACATTAAGAAGCATTTG
      CCATTTGTGTACAATGTGACGGCTTATGCCTCGTACTGTTATCTGCCCGCCTTCAAACAGTAAGTTCGCTATCTCTGTGG
      AATGGAAAAGCAGTTTGTAATGGCATTTGTTTGCTTGCAGGTTCAGAGATAAGATTAAGATTTTGCATTTTGCCGGCAAG
      CTGAAGCCCTGGCTGATTCAGTTCAACTCGGAAACAAAGGTGGCCAGCGTTTCGTCGGAGTATGCTCATGCCCAGGATTT
      GATTCAGCTGTGGTGGAACATCTTTTGCGAAAATGTCATCCAGTCCCTGTCCACCGAAATGGTAAGTGCTATTTATACAA
      TGGATAACGCACATTTTGGAAATTTCCAGCGTTACTTGGTGCCCCCAAATGATCTTATGTCTTCCCTTGTTTTTGAACGC
      CAGACTGAAGCTAACCCTTTGATTTTTACTGTCTAACCCAATGTATTTGCTCCAAATCTCAAAAACAAAAAACCCTGCTT
      CGTTTTCTAACACGCTAATCGCAAGCAAACGCCAGGAAATGTTGCTAGTGATCGACCCGCGGGAGAAATGGCCCAAGGGT
      CCACTACTTTAGAGGTAAGCAGATCTTCAATTGCCGAATCGCACATATCGCACCAGATCTGTAGATACCTTGAGCACAGC
      CCTGTGTAAATATCTTAATTATAACTTAAATATTTATTTATTTATTTAGCTAACGATTCAGTCATCTTTCTGTGCGCCAA
      GTAAATAACCCAAGCAAACAAACTCAATTTCGATCTATTTGCCATTTGTTTTTTGCCGATAGCTGGCCTCGATATCGTTT
      CATTTCCCGCCTCTTTTCTATCAACTCGGTTTGAATATACTTTGTTTTCGTTTTATTTATTTTTATTTTTTTGTATTGGT
      TTGCAATTTTCTGTTGATTTTTTCTCGATTAGCAGCCACGCCCCAGAGTAACCCATTTTCCTTTTTTTTGTATATTTTCT
      TTCACTTTTTTGGCACCATAGGCAGACCAATTCTCAATTTATTTCTTCTGTATTTTTTCTGTAATATTTGTGCAACTGTG
      TGTGTCTCTCGTGTGTGTGTGTGTGTGTGAGTGCTCGTCTTAGTGTTCACTTTCTTTCTGTTTTCTTTTCCTTTCTAATT
      TGCATCGATTTGGCAAAGAGCCAGGAAAATGTTTCGGTTTACGCCATCGATAGATGGAAATGATTCAAATCAAGATGGTC
      GGTTGCGGGTGATGCCAAAAAAAAAACTCAACTGAATCATTAGATATATCCCATAACACAAACAAACACACACACACACA
      CACTAGCACGCATTCGTGGGGATCTCCTCTCTCTTGATACACACAAAGAAATTTTGATATAGAATGGAAAAATAAATTTT
      ATCTTATTCCAAATTCATTTAATTTAAGAGAAATAAATAATTTTTTTTATATTATTAATTTATCAAATTTTGCTGTGTGT
      ACTTTTCTTTTTCTCCCTTTGTTATGTTCGTGCCGTTGGGTTCTTTATTTTTTGCAAATTGATTTACTTTTCATTTACTC
      TCTATTTTTTGAACTCTGCTCTCCTGTGTTGCGCATTCTGTAAATTTATACTTTGCCATAAATAATACGTGGACTGCCGT
      ATCGCATATAACTCTGTATATCTAACATTGTCTCAGTGCCTTTGCCTAAATATAATACGCACGCAAAGCGAATTCGCGGC
      GGATGAGCTGCATCAGCGGCAGCAGCATGAGTTCTACCAGCAGCAGAAGCTGCACCACCACCTGTTGCATGTGCGCCAGT
      TCCGCGATCCTTGGGCAGATTACTATGAGAATCTGGAGAAGGAGCCGCAGGAGCAGGAGCAGGAGCAACAGCGCCACCAG
      CACCAGCAGCAGCACCACAATCCCAGCCAGAATCACAGCCAGGACAATGGGAATGCGGATGCAGCTGCGCATGAGAATGA
      TAGCACGATTGCAAATGCAAATGCCACTGACTGGCATCATGACGATGCATGCCACCCACCTGCGCCGACGAGGCCTCTGC
      CCCAAATTCAAAACCAAGCCCACAATGCCAATGCCACTGCCAATGCCGAAGACTTTTCATTCGTAGATGTGAATAGCAAT
      GAGCTAAACATTTCACAGCCACCTGAACACGCCTCCTACTCCTCCGACACAGCCACGCCCACTGCCACAGCCACGCCCAC
      TGCCACGCCCACGCTAACGCCCACGCCTCATCATTCCGTGCATAGTCAGACAGTAGAAAAAGCGACAAGCCACCAACAAG
      AACATGAAGTTGCAGCCACAACGCCGCCTGAGGTAAAGGCAATCAATCCAAACCCGGCCTGAGAACTACACAGAAAAAAA
      AAATTCCCTAATGGTTGTATGGGTTTTTCAAATCCAACATAGCCCTAAGCAAATGCTAGAACTTATTATTTATGATTTTC
      CTGGCACCTCATGCAAAATGGACTTCATGCTTATATATGGAAATATCAGAATATTTAGTTACAAATTGGAATTTTTTCTG
      TGTAGGAATCCCGATTCCCAACCAAACAAACCAAATGCATTGGATAACGGTGTGCAAGTGTAAAAGTGCTAGTCCAAGTG
      ATAGTGATAATGTAATGTCCTGGTTTTCGTCTAGTCACTGTTTTGCATACGAATTGTCATTGTCGTCTTCATTGTCCTTC
      GGTCATCGTTCATTGTTCATGGTCCTTGGTCCATGGTTCTTGGTTCATGGTTCAGCGTTGTGTTTGTGGCCTGGATAAGG
      GGCATTTGTTGATTTATTATTAGTTGGCCTGGCACCTGGTCAAGCATTAATGTAGATGGAATATGGGGGGCCTCGCTACC
      CTACAACATAATCAACATCATCATCATTTTGAAACCCAAACGCAGCAAAAGCCGGCACTCCATCCTCGTGTTGCATGCGC
      ATTTTATAGCCACCTGCATCTCCTGCATTCGGCCCACTTTCACATAGTAATCTGCCCGAGAGTTGCTGGGACACGCATTG
      CAAACGCAAGCAGCCGGAGCTCAACGCGTCGTATACTTGATTTATGCCTCGAGTAGCACTTCTGTTGTCACATTAATCAT
      ACGCCCTGTGCACCGTAACTAACATCTCAATGTTGTCAACCGCTCGTCTGCGTACTAGTGCTAGTAAATGTTTAACCCGT
      AGTGCATGAAATGTCGTAATATACCACCCGACTGCATATGTATATTCTCCTCCCTTGCTCCATCATAATGCAATCAAGCT
      CTTAATCAATTTAATTAACATACTTTCAGGCGGGTCTGGCTGGTGCTCTGTCACAGCTACGCATCGGTCAGCAGCGCACT
      CCCGAACAGGAGGCCTACGAGAACCAGATGCGCCGCCAGTGCTGGGAGTCTGGACAGATTGACTACACCGGCGCCGATTC
      GTTCGAGAATATCTGGAAGAAAATATCGCAGACGCTGGAGAGGAAGACCGATAAGGAGTCGGAAGAAACTGGTAGCTCAT
      AGATACAAAACCGAAACTAAACAGAACAAACAAATGCAAATCGTTCGTTATTCGTCGTTTTGTTGCCATTTTTTTCTTGT
      ACACGCGCACACACGTACACACTTAACACCCACCCCTTCTCCACCCTAAAATGAAAACCCCAAACACGCACACAATCGTA
      TTTTATCCCCCCTCCCTCCCCACCTTTGGGAGGCAGGCGAACTGTTGCCAATGTCAAGGAGCCGCCGGTCTAATTGAAAT
      TTAAGGTTTGGCCAAAAAATGTTGTCGAAACGAATTCTTCAGAGTGTCATAAATGCAATTTTTATTTGCCTTCCCTGTTA
      CAGCCACCCACCCCCCCGTCCACACACGCACACACACACACACACACGCGCGCATCTTGTTAAAAAGAATGAGCGAGAAA
      GCAGAGAAATTTTAATTAAGTTTTCAAATTAAACTTTTTGCACTGCTGCTACTGCTACTGCTGCTGCTCTCGACATACGT
      GATGTGATGCGATGTGTATGTGGGCGACACACTTGGCACAGTTGCCCCAATGCCCTGCCCCTCCCCCTGCCCCTGCCAAG
      CCCTTGGACAAAATCGAGAAAAAATGAGGCCCGGCCACAAAGTTTTACACTTCATTGTGTTTTAATTGAAATTTTTGTAC
      TTTCACCCAGTCGTGTGCTTACCGATTTATGGCGATGACTTTCCAGCTCATCTGCATCAAAACTCATTGTGGCATAAAGG
      CCATTTCCTGTCCTTGCCCCACCTATCCCACCCCTGACTACCCTTTTTCCCTCTGCCGCCCCCAAACACATATGTACATA
      TGTTTTTCCTATGAATAAAACGCAAACAATGAGTGTATACAATAACTCTGGAAAAGATAAACGAAAACCATTTAAAATAA
      AGTAAAAATCAAAAATGAAATTGTAGCCCACATGTTGTGGCTATTGTGTATATGTATCTATGTGTGTGTGTGTTTATGTG
      TGAGTTAGAGTGTGTGTGCGAAGTGCCCCGCCCCCTTTTCGACCACTTTTCGGATCGAATTCGAGCTGAGCGTTAAATGT
      TTGTTTCAAGTGTTTTGGCAGCCTAAAATTTCTATCTATATACGTATATATACCATTTATGTTATAATTTACATTTTGCA
      AATATTGTCGTAATATTTATTCGAGAACAACAACAACAAGAACAACAAAGAAATCCCAAACAACACAAACAAAAAATTTT
      CAATTTATGAAACTATGTTTTCGAATTTGCATTTTTATTTTAGCAATTAAGTTAAGTTACGTTCTTCTTTCCCATGTTGT
      CACCTTTTCAGTTGTGTACTTTTAAGCCATCTTAGCCATGGCAAGCATTGTGTCTAAGTCTTGGGTCTTAGAACCATCAC
      ATAGCCATAAGAGCCAGCACCATTCACCCATCGCATCTTAGCCATCAGCCATCTTCAGCCATCACCAGCAATACAGCAAC
      GCAGACGATGTAGCTGAATCGAATTAAAACTACTGTCTCGTTACCCCTAACCACATTTACAGATAATGATAACGATAGTG
      ATCCCGCTAACCCACTAAGCTCAGCTCGATTGCTAAACGAAGCCGCCAGCATACTGCTGCATCCGCCCGAGAAATCACCA
      ACTTCAAAGGCGATGAAAGCGAATGGGGCGACTGGGAATGGCTCCCATCTCGACCAGTCGCATCCCACCAACTCCCCAGC
      AACTAACAAACAGCCTGCGAATGCTTCAGCTTCCCCCAATGCCTCCTTGAAACAAAATCCACAGAAGCGACAGGAGAAAC
      CGCAGCCCCAAGCGGAACCGGAACTGGAACCGAGACCACAACCACAACCGCAGCCAACAGAGCAGCACATCAGGATGCAG
      CCAGGCGGCGGAAATGGCAGCGTCTCCAAGAGCGGCAAACAGAGGTCCGCACGCAAGTTCAAATAGCAATTACTGAAGCT
      GCTGATGCACTACAGCTGCCTGCCACACCTGGCGTGCCGCTGCAAGTCGCAGTATCGGCGGCTGGAACCCAATCTGGATA
      CCGAACCCCAACCCGTCCACGTCTAAACCCGACGATTGATAGACAGATCCGAGGAAGTACAAAGCGTATGCCACGATAAA
      TGCTGTACAAATTGCTTGCTAAGTGGCTCTTAGACGAAAGTAAAGTAATCAAATCGAAACGAACTAAATTTATATATTTA
      TATTAAATTATTAATGCAACAATTATCAGAGCACACAGGATTTCAAAAGTATATAAATAGGTTTTCATTAACTTTATATC
      GCTTGAGTCTTTGAAAGTAAATGTTTAAAAGAGAAAACTCTTTTAAAATGCATAGTAGGTTATATTTCTTGAGGCCATAT
      AGCTCCACGACTTTTTTGATATCGTCTAAGGGTCCCTTGGTTTACCCAAATACCACGCTGCCTTACAAAGGAAACACATG
      CAATATCTTAAACTTAGCATATAGTGTAAGACAAGAGCTAATACTAGATGTAAGCCGCAAGTGCTTTGGATAACCCTAGA
      TGCAAACACACACTCAGGAGCTTGGGATGATATCGCCTTATATGCCATATATACTATACACACATGCATCCACACACCAC
      AGAGCTACTGACCTCCGCGGACATCGAAGACGGTAAGGTGGAGTTCGACAAGGCCACGGGTGCCACCACCACGTACAAGG
      TGATCGAGGGTGGCTACGAGGTGATCACCACCTCTCCGCAGCCCAATGGAACCATCAAGACCCAGGTGCGAACCTTCTGG
      GATCCCAAGCCCGTTAGCGAGGAGGATCTGAAGAAGGAGCAGGAGAACAAGAAGCTGGTCCAGAAGCGTCTGGGCAAGGA
      GATTCGCATCGATGAGCGCACCACCATGCTGACCCGCGCCATCGAGGGTGGCTACGAGGAGGTGTACACCACCATCAACG
      AGGATGGAACTCGCAGCTCTCGCACCAAAACCTTCTACGACTCCGTTCCAACCGAGGTGGATGAGAAGACGGCCGCCAAG
      TTGAACAAGAACAAGAAGAACGTGACCAGGAAGTCGTCGGTGGACTCTACCGATTCCACGGAATCCTCCCGTCGCATCGT
      CCAGAAGCAGCAGAAGAATCTGGTGCAGAACTATGATGAGCAGACCAACTCCACCACGACATCAGAGCGCAGGGTGTCGG
      TGACTCAGAACATCGAGATCACCGAGAACAATCGCACCGTGCGCAAGAACTCGCTGCAGGAGCAGAACGTCAAGGCTATC
      ACTACCACCTCGAACACCTCGTCCAGCGACAAGAAGCAGAAGAAGAAGCCCAAGTCATCGGCTCCACCACCACCCGCTGA
      TTTCTTCCAGAACGATACCACCTCTGTGGCCTCGAAGCGTGTGCCCGGCGGTGTGGAGTACACCTATTCCACGCAGCTGG
      ATTCTGGCAAGACCATCACCACCTCGAAGACTGTCTACGAGGAGGAGGAGGTGGAACTCACCGAGGAGGAGATCCGCCAG
      TACAAGAAGACCCTGAAGGACGCCGAGAAGCACAAGAACGTCTCCACCACCAAGAAGCTCAAGTCCGAGTCGGGTACCAA
      GAAGATCGTTCCTTCCGAAAATCCCGGAGATGTGACCACCGTGGAGACCATTAAGATCGAAGGTGGCACCGAGTACCACT
      ACACCACCGTGACATCCGAAGGCATCGTGAAGAAGGCCGTGAAGACCGTTTACGATCCAGTGCCCAGCCAGAAGTCCAAT
      CCCGATGACACCGACGAGGAGGAGATTATCGAGGAGTACGAGGAGGAGATCATCGAGCCCGGCGAGAAGAACGTCAAGAC
      TATCGAGACCGTCAAGCAGCTGCCCAGCAAGTTCGAGGGTGAGGATAAGCCAGTCCACTTCATCCGCAGCTAGGTTATAT
      TAACCCATTTTCTTTTTTTTCGCAGAGGAAGTGACCATCACTCATGAGAGGAAGGAGAAGAAGGTAAAGAAGTCCATGGT
      CATTAGCCAGTAGAGATCGCCGCTTGCCCACACCGAAACACACTCAAACACACACGACACTCACACAACACACAAGGCAC
      AAGAATACACACGAAAAAAAAAACAAGCTTATGAAATGGCCGGAAAATAGAGAAGAAAGGCCCTGCGAAGATCCCGATCC
      CAAGCTAATTCTCCTGACCTATTTCAGCATCCAGTTCAGTTAGTTGCTGGCGGTCTTTGCACGCTACTCGTTAGCTTTGT
      TATCAATTACCAGCTGTCTAGTGCCCTAGAAATGTATTACGAAATTATCCAAAATTTATTACAAGAAACTATCTAACATA
      ATTGTAGCCTCTTTTGTTAACAACAAAATAAAACTCAAGTTTTGGTTCTAATTCTTCTTGGTCTTCTTCTTCGTCGGAGT
      GCTCTTCGGCTTGGAGCTCCTGCGGCAGATCAGGATTAGAACTACGATTGGCAACAGGATCACAGCGAGACCTAGACCCA
      CAATGTCCAGTAGGTAGAACTGGTACCAGGGTAGATGTACACCAGCGGCCACCAGATGAGGAGCACCTCGGTGCTCGATC
      ACATAGTTGATCCAATATATGGCCGTATCCATGGCACCGAGTGGTCGATCGCGGAATATCCGGGAGGCCTTCTTAATGTT
      ATTCCTATACTTTGGATTCTCAATCAGTTCCATCAGCAGACCTCGCAACTCCTCCACCGTGACTTTCCGGTAATCCAGTC
      CCAGTGCATATTCTGCACTCTTACCCTGGTTAATGTTCTGATGCTGATCACAGTAGACTGGCATTCCCAATATGGGAACA
      CCATTGTACACCGCCTCCTGGGTGCCGAAGAGTCCTCCATGGGCAATGAAAACCTTGACATTCGGGTGCGCCAGAATGTC
      GCCCTGAGGTAACCAACTTTGCACCTTAACGTTAGCCGGCAAATTGGGCAGAGATTCATCTTCGAATTTCCAGAGAACGC
      GTTGCTTCAGACTGCCAAAGACTTCCAGGAATACTTTGAGCTTCTCAGGCGGCAAGTCGGCACTTCTCACCTGGGAACCT
      ATGCGAAAAATAGATGAAGTCATTAGTGTTTTTAGATTTAAAGTCGCAGGGTTAAGGACACTCACCCAAGCTAAAGTAAA
      TGGCACCATGTGTGGCTCCGTCCAGGAATTTTTGTAGATGCTCCGGTAGTGCCTTCGGTGGTTGAATGTGCAAACCGCCC
      ACTGGGATCATATTATATGCCATCGGTCTCGAAGATGCCAGTGGCATGTAGCTGTTCAACAGAATGGCTGAGATATTACG
      TTCGAGTTCTTTGATGGTCGGTACTCTGTCGAGTAGCTTGGAGAAGTGCTTCTTTAAGACCGCATCCTGACCGGGGTAGT
      AGGAGAACTCTCTGACGAGATCCTCGGCTGCACTCATGGCCACATTGCCGATGCGTTCCCACAAAGTCATGCGATCCGTA
      TAGGGCATATAAGCGTGTGGTACATATGACCAAGGAGACACTACCCCAAATAGCTGACTAAGGTGGTTGGCATTACCAAA
      TGTCGAAATAGTTATGGTTGGGATCTGGTACAAGTGTCCCAGGATGAGGGCACCCTCGTTGAAGAACTGCTCCGCCAGCA
      GCAGATCGTATTTGCCAATTTTGTTCTTCTCATTGATTACTGCCTGAATCTCCGGTTGTTCCAGTGCGAAATCCGTGGTG
      TGGATACCCATCACATTGACCATTCGCAGGAATGCAAAAGTTGGCAAATCTGTCATTTCCAAAACGGTGTTCTTATTGGT
      CATCTCCTTAACTATGTGCAAGTGATTAAGTTAATACATGTTTTATCAATTAGCAACCATACTCACTTTCTGGCCAAAAA
      TCGTATTGAGGAATCACAATTTCCTTATAATTTGATCCAAGTTTTTCCTTGGCCAAGGAAAACGGAGTAATAAAAGTAAC
      CTCATGTCCTTGCTTCACCAGCTCCCGTATGATGGCATTGGTCATCATGAAGTGACTCTTGCCAGGAAAAAAGAATGCTG
      CCAAGATGCGGGAACCGGTACCCAACTCTAGTTGCTGAAGAGCAACCAGACTTAGGAGAAATATGTGCAGAGCACTTTTC
      AAAGACTGTAAAATGCAAAATATTTATAATCATTATCTAAATTGAAGCTTAAATGCAGCATGAAACAGTCCTTCATTTGA
      ACTCAAATAGTATTCGGCGATAACAGGTAACTTTAGTTTAAGTTTCGGAACTTGCGTCTATTACGATTTCAAAGCTTTTC
      CTTTAATTTAATTTATACATAAACGAGAGCTTCAAAAGCTTATTTACAACATATCAACATACCATTTTGATTAAACGACA
      CTAGTAGCAACCAGCAACCGACTCAGTGGACCGCTCTCGAACGACTGCGAATGCGTTCAGATAGATCGTTTCGTTTGGGC
      CTCTCTGTAGATCGGCTTTATATGTTTATATACATATAATGTTTATGTATATGTTTATGTACGCTTTTAGAACCCTAGAG
      AATAGCAAATGTGAGGTTCGTGCGAAAAAAACGAGAGAGCTCTTTATTATCAAAACGGGGCACTTCATCAGCGTGCTCTA
      CAAAATATCCCTTATCATCATGGAAACGTTAGATTTCTTGCGGATAATAGAAAGTTATTCTTTCTTAAGGTCGTATTCGT
      TGTTTTGGGTAATCTATTTGCTGGTTGTCTAGGTACGTAAGTTTTCAAACTATCTTTATCCATATCATTAGCAAGAGAGA
      CAATCCTCGACTATCAGATAATATCGTTTTTTCTACCTGTTAGATACTTTTCAACGAAACTAGTAAATCGTTTGACTTTT
      CGATGCGAAATAGAAGATATAGACAGAAACATATACTAATATATTAAGATTTTATTGAAGATATTGTATTTCTCAAACAT
      TTTTAAAGTAATTTGTTTAAATAAACCCTTAAAATACTTTAATTTTGCTTAGCTTTCCTGTGTTTCTTATTACTGCCCAT
      CAGTAATCGAATGGCCAATGAGAGAGCCATGACGCCAGCTAAAGCAATGATAGCCACAAATGCTATGACATCCAGCAAAT
      AGAATTGGAACCAGTTGAGATCCAGGCCTGCGGATCTCATATGTGAAGCACCTCGATGCCGGATGACATATTCGATCCAA
      TAGACGGCACTTTTTCGCGGCTCCAGCGGACGATCGCGGAAAATATCCGATACCCTCTGAACGTTCTCTTTGTAGGTCAC
      ATTATGGATAAGTTGGTCCAAGGAGTGCCGCAGGATTTCCTCGGTAATCGATTGGAAGTGCAGACTAATGGCATATCCGC
      CCAAAACCGCTTTGTTCATATTAAGGTGCTGCAACATAATATATTCCTATAGAAGCAGTTATTTATATAATTAGTGAAAT
      ATACAAATACCTGATCACAGTAGAAGGGTATACCCAGCATGGGCACAGCATAATGCACTCCCTCCTGGGTGCCAAATAAG
      CCACCGTGGGTAATGAATACCTTCACATGACGATGGGCCAGAATGTCGGCCTGTGGCAGCCACTTCCTGACCATCACGTT
      ATCTGGCAATTGGCTAATGCTCTCATCCTCGAATTTCCACAATACCCGCTGCTTGAGCGAACCGAATACCTGCAGGAACA
      ATCGCAGCATTTCCACGGGCATGTCCTTGCTCTGGACATTGCTGCCCAGGCTGAAGAAGATGGCCCCCTCGGTGGCGCCA
      TCCAAGAGGGCTTGCATGTCAGCCGGCAGCGGTTTGGGTGGATAGATGTGCATCCCGCCCACTGGCACCATGGCGTCCAC
      TGTGGGACGTGCCGTGGTCAGCGGTGCGTGACTGTTTAGTAGCATCACTGAGATTTGACGCTCCATGTGCTTGACCTTGG
      GCACCTCGGCTGGAAAACACTGTACTCAGGTGTATGTTCTCAGATAAACCATTACCGTAACTCACTCAGTACGGGTCCAA
      AGAACTCCCTGGCCACCGCATCCATTTTCGGAAAATAGTTTAGCAGCCTGTCCATGTCTTCGTAGAAGGATGCATAGGAG
      TTCTTCACCCTCTCCAGGAAACTCATGCGATCGGTGAAGGGCATAAAACCGTGTGGTACAAAGGACCAAGGTGTAATCAG
      ACCCATCATCTGACTCATGTGATTCTCATAGCCCAAAGTGCTCGTGGTCACCACGGGTATTTTGTACAGATGAGCCAGTG
      CCAAGAAGGCCTCCTGATAGAACTGCTCGGCCAGGAGAAGATCGAAGACTCCTTCCTTTTGCTCGGCATGAATGAGAGAC
      CGAACCTTGGGCTGCCGCAGGGCATGTTCGGTGGTCTTGAGGCCGATAATCTCCAGCATTTTGAGGAAATCATAGTTGGT
      CATGCGGGTCAGCTCGAATAGGTGTTGGGCTCCAAAGTTCAGCTTAACTGGTTCCAAACGTAAATATGATGATCATTAAA
      TCAAGCTCCACTCACCATCGTGCCAGAAATCGTAGACCGGTTCTATCAAGATCTCCGTGTAGTTGCTGCCAAGTTGCTCT
      TTCTCCAGACTAAAAGCTGTTACCATGGTCACCTGATGACCACTTTCGACAAGTTCCCTTATCAAAGCAGTGTGCATCAT
      AAAATGTGATTTTCCTAAAATATTTTCCACAACATAAGCCATAAGTTGGCTTTGTACATATCTTAAAATACTTTACCCGG
      AAAGGCATACACAGCCAGGATTTTTGATCCTTCGGCCAATTCCAACTGGGAATATAATGTTCCAGTCAGAAGGAGGCCAA
      ATAATAATGGAAACTGCATACTGAGCAGCTATACTATAATTCTTATTTTTTGCCAAATATTGATTTTGTTTTTGTTTAAT
      ACTGGCTTGACTTCTTTTGTTTGTCCGTAATAATCTGTTAATAGATTTTGTAAGTTTGAGATTCTGAAGTTTGTAGCTTA
      ATATCAAAAGATAGATTAAAGGTGCGCAAAGTTCTTGTTTTGTAAACAAGTTTGACTTTATTACAGAAACAAAATTATCA
      AATGAATAAATGAAAATAAAAAATGCTGGTCATCAGCAGCTAATCTATGTTCCATAAAGATTTCAAGCATTTGTGAAATA
      CAAATTGTTTACTTTTAATAGGGTTGCTGATATAAAGAGTCAATTTAATTGATGATCGCGTGCTCGAAAAGCTTTCCACT
      TGCCTACCGATGAGATGGCGAAGGCGAAGCCAACTATTGAACCTCCGAATGAATACTGAACTCGAGCTCGGGGTTCCGAG
      AAAACCCAATATATTTCCGAGTAGTATAATAAAAGTCAAAAGCACGTAGCAATTTAAGCTTTCTTAATCGTTTTATTTTC
      ATCTTTCAAACGTATTTGCATGTCAATGTGTGTGTTGTTTGGTCCTTAAATGCTAGGTATTAAGCAATCGGTATATTATA
      TGTAATTAGATTAAGTTAAATTATAACATTTAGCCTATAATGCGATTACTTGTCAACGAATCTCCACGCCTAATGTAATT
      TACATTTTCATATTCGATACAAATTGTTTAAATTATTCTCGTCTTTATACAAAAATCACATTCGATTCGTTATGTATTCT
      GCTTGTGTATGTGTGTGTGTGTGTGTGTGCGTTTGCGAGTTTTGTTATAAGTGTTAAAATGTTGCCTTTCGATTAGCGTG
      AACTTTGTTCGAGTTCAATTAAAGTTTAAGTACTAACTTGATATATGCAATTAACAAACTTCAGCTCCTTCAGCTATCCG
      TTGATGAAACACACACACACAGAGTGTGTGTGTGTGTGCGGCCTTTGAGAAATTTTAAATTTTAAATTTCTAATTTTCAA
      TTTTCCATTTTCCTGGCTGCAAATTGCAATCAGAACTTTTTCTGCAGCGACTTGAAGGTGAAGTTTTTGTGGCGAGCGGG
      CGGCTGATATGAGTTATTAGTCTAGGCCTTAAAGCTAAGGAGCTTAAGTGAAATTCAATTTGCTGTTGTACGTATGCAGG
      GGGTGGTGGGCGGCGATATGCTCGTGGGTAGTATGTGGTGGTATGTGGCTGATATGCGGCTGATATGTGTGTTTTGCTGT
      GCTGAACTTTGTGCGAAAGCCTGGCTAATTGAGGGCAGTCGTCGGGATAAATGACTCAAGCGGAAGCTGCAGTCGGTTCC
      ATTCCATATGGATGAGCATATGGTGAGCCTCGTTTTGCTCCTCCCTCCATCCGCCTCCTCTCGTCCTTTTGTGTTGCTTT
      TCCCAAACAAAAAGTAAACATAAAGAAACATGGCGTCGTGATAAATAATTCCCCGTTGACTCCTGCGGTGGTGGCACGTG
      CCCAGAATCGGCTAGCTGCGTCGGACGGTCCCTAGATGTACTTGGATATATAGCGCTTCTGGATGAGTCGACCGGCCTTG
      CGCTTCAGTATGGTGAAGCGTATTAACTGCTAATCGCTGAAGTGCGGCGAATGCGGCGGCACACGCGGGTACAGCTGCAT
      AGTGTATAGAAAGAACGAAAGGAGTTGGCACTTATTTCACATCCGGCGTACGTGAAGAAATTTCATTAGCTCCATCATCG
      TCAGCCACAAGTACTCACCCCCAGGAGATTGCGGGGCACGTAGCCCTCCTCGCCGGCGGCATTCCGTGCCCACCACCACT
      CGTTCTCGGCATCGTCGCCCTTGCGCAGCACGATCAGTGGCTCGTTGACGTGGAAGGAGAGCTCGTCTCCGTTTTGGGCC
      TCGTAGGAGAACACGGCGTACACGTCGCCATTGTGCAGGATGCCCAGCTTCTCCTGAATGCCTGGAATGGATATGGTTAA
      GTTATATATATATATTATATTATATTATATGGTTAGGTTCCTAGTCCTACTTACTGTATAAATACTCGGAGCAGCCATCG
      AATCCCTCCTCATCCTCCTCGCACTTCTCCGCCGGCGTCTCGTGATCCGACAGCGTGGAGGCAAACAGACACGCGCCGCT
      CTCCACCAGGAACTTGACCATGGACAGATTATTGCAGCTGGCGGCACAATGCAATGGCGTCCAGCCATCCGAGTCCTGGG
      CATTCACATCGCAGCCAAACTCAACGAGGAATCTGAAGAAACAAAAAAAAAAGAGCAAGAGAAAGAGATTAATTAGCTGG
      AATAAGGAGAGCAAAAGGCCAATGTCACTTACTTGACAATGTCAATGTGGCCGGCACAGATGGCATTGTGTAGCGCTGTA
      ATCCCCTCATCGTTGGCAGCACTGGGATTGGCCACTTGCATGGCCGTCTTCTTGACCAGTTCCAGTTCTCCTTCCAAACT
      GGCGTCCAGCAGCAGGGCCAGCGGATCAAAGCTGACCCTTCGACCCAGCTTGGGTTTTCCGTTTCCCGTTCGCTCCTTGA
      TGTTGCTGGTTGTCACGGTTGTCGTGGTGGATGTTGCGGATGTTGATGTCTCCTGTTGACTGGTCGTGATGCTGGGGGCC
      ACCATTCTATCCGTTTCATCCGCGCTGGATTCACTGCTCGGTGAATGTTGGGGCGATGTGTCCGGCAAGTTCTCCGTTGG
      CTGTCTAGCTGAAGGCTCGGATTTCCGCTGGTTTTGCAACTGCAACAGAGGCGGCTTCTGTTGGCCATTGGAACTGGATT
      GGCTGGACTTGAGGCGAGGTTGCTCGAACAGCGGCTGCTTGCGGATGGTCAGTGGCTTCGCTTTGATGGGTAAATTGTCG
      TTGATGTTAAGGGATTGCAGTCCAAAGGTGGCCGTTTGCGTCTTATTAGCAGTCGATGCCGACGCTGCTCCACTACCTGC
      TCCGCCGGCGGATCCGGACGTATTGGCCTCCACTGGTGATGGCTGCTCTGTGGGCGACATCTTGCTAGGCTTGGGCGGCA
      GCGCTGGTCGCGGATCCGTCATCACCACATTGGGCGCCACGCGATTCACCTTGGGGCTGTAGGTGATCATTTTGGGTATG
      GAGCTGCCGCTGGAAACCGAATTGGGCGCCACACTGCTGATGGGTTTGCGTGGCGGCACGGCCACGTTGCTCACCTGCAC
      CTGGAGCGGCTTGGAGGCATTGGAAACGGCAAGAGCTACTGATTTGCTAATAGCCCCCAGAGGCATGCTGTGCACGGTAA
      GTTGCTGCTGCGTGTTGCGCTCCGAAAGCGTTTCGCTGGTCACCGAAATCTCGTTCTTCTTGGCTTGGGATTGCTGCTGA
      TCCTGGCTCTCCTTCGCCGTCGCCTGCTGGTTGAGTTTGCTAATCAGTGCCGAGGCCGAACTGCTGCTCGATGTGGTGCT
      CTTGGGGATTTTGCTGGCATTTGCAGTGGCGGGTGGAGATATTGCGGATGCTGCTGCTGCAGTTGCGGCCTGATTTGCTG
      CCTCTGCTGCTGCCTGAGCTGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTTCTCGATCTCGTTTC
      TTGGGTCCCACCTCCGCGTAGATATGTGTGGTACTGTCCATGGCCTCCGTTTGCGCCTGCTTGCGCAGCTCAGCCTCCGT
      TTTGGCCGGAGCCGCCAGCAGCTTTTTGGCCAACTTGGATTCATCGCTTTCGCAGCTGGAACTGGCCACGGGCACGGGCA
      CGGAGCCGGCAAAGAAGCCACTGTTTTGTCCCAGCTTGACGTGCGTCAAGTCCTGAATGAGCTGGTTCTGCTGGTTGGTA
      TTGGCCGTGGCCGCTGCATGCTTCATCCCACCGCTCAGATAGCTGGCCGTGCTCGTGATGGTGGACTTTTGGGGCGTGTG
      GATGAAGGGCTCAACGGCTGCCACATTGCCGCGGGCTCGTCCAGCGGCTGCGGCGGCAGCAGCAGCTGCCAGTTGATTGA
      CCTGCTTCTGCAGCAGTTGCTGCTTCAGGGCGGCCACTCCACCATGTTTGCCCAGATTGCTGGCACTTTGCTGCTGCTGC
      TGTTGTTGCTGCTGTTGGTGTTGTTGGTGCTGCTGTTGCTGCTGGGCAGTTGCTGCTGCTGCTGCCGCCAGCAATTGTGC
      AGACTGCACATGCAGTTGCTGCTGCTGCTGCTGCTGTTGTTGCACTGTGGTCTGTTGATGCTGCTGCTGATGTTGCTGTT
      GTTGGTGCTGCTGCTGTTGCTGCTGCTGCTGCTGATGATGGGTGTTGGCCTGCTTTTTGCGCTGCAGGCGCGTCTGCAGC
      TCGTAAATGCGCTGGTCGGTGGACCGCAGCTCCGCCTGCCTTTGCTGCAGTGCCTCACGTTGCATGTGCAAGCGTGCATC
      CTGCTGAAGCGACAACTGATTGCGGTACTGCAATGATAAACAATAAACACTTAAGAACACAATGTTCCCAATTAGTCGCT
      GATGTGCCTGTCCACTCACCATCAGTTCGCGACGCAGCTTCTCCAGTTCGCGGGATGCCTGCGGTGGAAGCGACTGACCA
      CCAACTCCGTTGCCAGCTGCTGTCAGGATATTCACAGGACATCGTCGGTCACGTCGCAGCTCCTCCAGTTGCCGGGTCAA
      AGCCTCCACCTTGGCCACGGCCAAACTGAGCTCCTTCTCCTTCTCGCTGAACAGTGCACGAATCGAGTCCAAGTCATTGC
      CTGCAAATGGGCGATGGTACTTTGTGCTATAAACTGCTTTATGTCCTGATCCTATTCTAAATATCTGATATTATACAACT
      GGCCAGGGTGGTGGTTTTACCCTGGAGATAATGGTTAATCTCATGCGATTATCATGGCACACCAGCATATCTTAATTATA
      CTTAACAACGAAAGGGGCTAAAGATAAATCTGTTGTTGGGCACTTAGTTTTTCGATTAGGAAAGGGGTGCTTCATTCTTA
      ATCAACAATGCCAACCCAATCCCGATTGGCGTGCCCACTAACTATTTTATAATCGCCGGCCGCCTGCTGGTCGCCGGTGT
      TTCCCTTTCGAGGATTTCGGATTTGGGTTGCCTGTTCAAACTAATTACGGCCACAACACAGGGCGCCAGCTCATTAACAT
      AATACCCCTGTATGGAAATGTGTGCGGGCCAACATCATCTTAGCCATGTTCGGAGGAGGCGCTGTTACCGCCCACAGGCA
      ATCATAAAGGACAACAAAGTGGCACACATACATAAATTAAATTCGCACACGCGACGAGCGCCGAGTGTGTGTGGCTGGGG
      GATGTGGATATGGATGCGGATGCGGATGGGATGGAATGGGATGGGCTGATGGCAGGCTACCTACCACCACTCAACACGGT
      TTTAACACATGTTAATTCACCCAAAGAACCCCTCGTCTCCACTCAGCCAGCGGTGGGTGCTTAACTCAATTGGAGGAGGA
      AGCTTAGGGCCGGATAGGATATCCCAAGCAGATGCACTTGGTGGCACTTCGCCACTGCCCTCCACTCACCACTTTCCTGA
      CCGCACTGCACAATTAAAATATTAAATTTACTCCAAGAAACCATTTCGTATGGAAAGTGTTTGAAATATTGTATACCCCT
      TAATTATACTAACAACAAAATAGTTTGCAGCTGCTTAAGGTTCACATACGGTCTTATTGTTATGTTGCGACTTTAATTTT
      CTGCCAGTGTACTCACTCAGTGTGACATTGTAGGTCTTCTGCAGATCCACTTGACCCCGCAGCGCTCGCAGGCGTCGCAG
      CTTGGACTCCTGCGCCTCCACCCGTTCCCGCAGCCGGCGGAGTCGCTCGCCCTCCGCGCTGGCCACTGCGCTGCGCACCT
      CCTGCGACTTGAGGAAGCGCAGGCGCTGCTCCTTGGTGGCCAGCAGCTGGTGCTGGCTGTCGATTTGCTGCTGCTGTCTC
      AATGCCATCGCCCTCAGTTCGGCTGACGTCAGCCTGCTGGGCACCTGCAATACGAGATTGGGATTGAGATTTTGGATGTC
      GGATCGTTAGCGAGATAAGCGGCTAAGTTGGATGTGAGTGTATGTATAGCCATCTGGGTGGCCATCCACCCACAAGTGAG
      AAATGAAATTTCACAATTTATAATCCGAGGCGTTACCGTGAAAGCAACCCACCCATGGGCAAGTCAAAAACTCAAAAGTC
      AAACTGAAAGTTGTCAACGTTCGTGGTCAGCCATAAATCAAGTTATGCTTAAGCTAATTTCGGCCTTTTGTTGTTTCGCA
      GATTGGATTTGCTCCTTGGATGCGGCCGAGATAGCGGTATACTTACGTTCAGCTTTGGCTCGGAGGTCACCACCACTCCA
      CGCGTGGGACTGACAAAGGCCAGGGAGGCTGTCGATGATGTTGAGGACGACGCGGAGGATGCGGATGCCCGGTGGGCGGG
      CATCAGCGAGGCGGGCGGCATCTTGGGCAGATTGCCGGAGACGGGTCGACACACGCAGGTCAACATTTTCGACGCGCTCT
      TTTGATATTTTGCTTCGATTTATCTTTGATTTATTTGAATTTATGATTCGTTTCGGTTCTTATTCAATGCACTTGAAGAA
      ACCAACGAGTTATAGCTTTCAGTTCGAAGAATTGCATGCGCTTTATTGTTAAATAAAACCATATAGTCTCAGTAATTCCA
      AGTGAATTTTTATATGGGTTCACTATAATGGATTACGGCAAAAAAGCTATTATAATCAAAAGTAAAACATTTTACTAAGA
      AATAGTTATGCTTGGTCTTTAACTAGGTATTTTCAAAATTAATCAAAGTTTTCTCTAAGTGCACCCTTTTGTGAGTTGCA
      ATCCCATTCACTGGCCTGCGATGGCATCCTTGACTGCAGCACCAAAGCAGGAACAGAGAGGCACCAAATTTGTGTGTTAT
      TTTTTTATTGTTCAAGAAAATGTATATATATATAGTGCAAGAGAGTTTGGCGGACCATGCCCTGGTCCCCACACCGCCAA
      CCAACCAAGCCCGCTACCCCAACGTGGAACAGTGGGTGCCAGTGGCAGTGCCAGCTGGCGCCAGTGCCTCCGCCTTGTAC
      TCGTTAATGGATTTTCAATTCAGTGCCTGATTGAAAGCACACTTTGTGTGGATGTGGATGTAGAAGTGGGTGTGGGTGTT
      GGGTGTTGGGGATACTGCACACGTAGTGTATGCAGCCATGTGGTTCTTGGGTTGGGTATGGTGGCTGGTAGTGGGGGGGC
      TGGTAGTGGGTGGATTTGGTTATGGGGTGTTTACCGAACGCCTACGGCGTTGTCAATGGCAACGACGGGGCAGCGCCCCA
      AACAGCCGTGACAATAACTGCGCTCGATGGACTCCAAGTGCCTGCCTGCCGACTGCTGAAACAACAAGCGGCAGTTAAAG
      TCATAGTTGCGTGTACATAATCGCTGGCACTTACAATTACATAAAGGATACGGCCAAAGGCGAGGACAGGAAAAAAAATA
      TGTAAAACCGGATAGCAGCAGATCTAGTCCCAAACAGAGTAGACTCGTAGTAGTTAAACTCGAGCGGAGAAACGCATATA
      TATACACCCCGGTATATATATCCACTCAACGGGCTAAAGACCGACAGCAAACAATAAAATGCCGTCATGAGGATTGGCCA
      GGGACACACGTCCCAGTCCGTTATCGAGTATCGTGTCTACTTCACGCCCACACTGAGGATAAACATGGCGGGCACAATCA
      AGGATCTAGCTGCAGGTTTGAAGTGAATAACTTTTGAAGGCAAGTATTGCTGAATCAAAAACTTTAAAACTTGTTTTAAG
      ATAACTTCAATTCAACCCATAGCAAGACTGATCCTCAAATCCTTATTTGATTGATTTCTGGCACATTTTCCCTCAGTGCA
      GGCAACTCAACTCAACCCGTCGTTCCACTAGCACTCGTTCCCATGGAGCTCTTTGCTTTTTGGCCTCGCCGAGTACGATT
      GGCTTCGGTCACCATCATCAAGTCCAGGGACGAATTGATGACGGCGATGAGAATGATGATGGTGCTGCAATGGATTGCGC
      TGGCGAGTGCTGCTTCAATTTGGAGTCCCCACAAGATGATCGGGCAGAGAGCAGAAGACTGCAATGGATACTTCAATACC
      CCATCCTCCCCCTTACTCAATTTATTGCCCCTTTTTCTGGGTCGCATTATACTCGAGAGAATGTTGCAAATAAAAAGAAG
      ATACATTACGGCGAAATTGTACCAAAAAAAAGAAGCGTACATACATATGTCCCCAGACAGCGCGTTTCGCAGCTATAAAT
      CACATGTAAAACACCAGCCGTAAAGAGCGAGAGAGTCATCAAACATGTCCGTCAGTCGTGGACATGGACTTTCCCCAGTC
      CATCGCTGACTTTTGTGAACCGATCCTTAAGGATAACCATTTGCAGCTGTCATAAAGTTGGCCATAAGCGTTTTGTCAAA
      ACTCCAGCAACTTGGCAACTATTTAAAGCCGAAGTCGCTTTATCTTTTGGGCCATAGTTTTAACGAACTTGCTGGCCGGC
      GTAATGAATTAATCTACTTTCCACCGATGCCATCTGCGCAAATATTTGCTCAAAAAAGCAAACTTTGCGGCATCAAGGGG
      AGAGTAAAAAGCGAAGCTTCAAACTTGTCGAATGCATTGAGACCGCAGAAACCAAAACCCAAACCCAAAAGCACGGGACA
      GGCGATGAATGTATCCTGTAAATTCAATGTGGCAGCAGCCAACCAGCCAAGCAGCCAGTCAGCCAGCATTTTCGAGGAAT
      ATTTTCCAATTAACAAAGTTTGTCATAATAACTCGCTCGCAGCAAGGAATCTCCAGCATGTAACGAGCAATGTGCTCGGC
      GTTATACCCCCAATACCTCCACCTCCTCTATTCCCTCCTACTCGGCGGCTCCTCTCTATTTACATTTTTGCAGCCATTTA
      TGGAGCTGACGAGGCTAAGCACGCGGGCCGGGAAAAGTGGGAGTAGTTGTGGCAGGAACGGGAGCTGTCGAGGAATTGGC
      TGCCAAGGACTCTCTACCCGGATCCCCAGTCCCAGGAATTTCCGGCATTTTCGCTGACGCAGCTAAAAACGTGCAACACG
      GAGAATAATATTGAGCCATATCAGTTTATAATAATAATAATAGTTATCTGATTAACTTGCTCTGCTCCTAAAAGCATAAG
      TATTAACTTTATATCGAAGGGCTTTATTGTGCATACTAGAGCGTAGATTCATTTCTCTCAGTGCACCTGGAGGGGAGGCA
      AAAACGCAACTATTTATGTTGCACAGCGACGAAGTACCCCTTTCCATTTCAAATGGTCTTCGCTGGGCGGTAGGCGTCTC
      GGGGGGGCGTGGCAAAAGCCAACCAATATAATTGTACATTGAAAGATGTCGTGGAAAGAGTCGCGACGTCGTTTGCCATT
      GTACAAATGTTGTTGCCTCTGGGTGTTGCCACTCCTTGTGTTGCCAGTAGTAGCTGCTTTTGGTGTCGGAGCAACAAGCA
      TTTTATTGATTTTAGCCCCCTTTTCTTTCTGTTTTTTTTTTTTTTTGTTTCAAAGTGGAGTGCGAGTTTGCGTTCGGGTT
      CCTGGGGGGCAGGACATCGCGTGCGCTTACGTTTATTGCTAATTTGTTCCTCTTTGTTCTGCTCTACTTTCGCCTCCTTT
      GGCGTCCCAACTCGTAGCTCTCCATCCGCCGTTGCTCCTCCCTCGCCGGACACTTGGCCGGCCAGTGTCCTTGCTGCACA
      TTTCCAAATCGATTACAAACAGGATATGCACTGCGGAAGCGTGTTTGATGGAAGTGCCAGCCGCCGCAAAGCGATTAGAA
      GGGCTGGCAACTACTACCTACTGCCCATTGGGGTGGTGCCCTGCGTTTCCCTGCCCCACAGAGCAACACACATCCGGCTG
      TGATCCCGTCACGGATTTGAATTGGATTGGCCGCCATCGCCTTTGTGGCCATTTTGTATTTTAATTAATTCCAGCAAACT
      GGCGAAGGGCAAAAGTTTTGCCTATGCGACCAAATGTCCGCAACTTTGGCAATTTGTGTGCATCGATGGAAGAGGAATGA
      GCTACGCTGCCAAGGATACACACCTGCAATACACATATTCTTCTAGGTAAATGTGTTGTCGAGATACAAGCTAGCTATAG
      AGCAAACTAAATTTCGGAATCATTTAAAAAACTTTAAGCTATGCACTTCATTTTGTCAGTGAACCACGGAAACCGAGCCA
      ATTTGCAAAATTTGACAGATTGCCAAACCCAATAGAGTAGAGTATATATATACCCAGTGGATTCGTTCACAAAAATAATC
      ATTTCAGCCGCAGAACCAAAGCGAACCCGCAATTTGATTGTCAACCAAATTGTCGGTGGCAATTGTGACATCTCTGCAGC
      CCTGATAAAAACATATTCCTCGTACTTCAACCACACACATATGGTAAAGGCGACAAGGATCCTTTGCCTTTGGTTGGCCA
      AAATCAAGCTTCACTTTCGTGTTAGTTACTGGAGCAGACATTAGTGGCACTCTCGAGCGCCTTTCAGCTCCTCCTGCTCC
      TCCAGCTCCTCCAGCTCCTCCTTCTTGCATCCATCGGCCATGGCAAACGGTTTGTTCCAAGTGGTTTCAGTTGCGAGTGG
      CTTTTGCCTCGGCAAAAAGTTTTCCACACTCATGTCAAGGAATGCTGGTGGTGGGTAAGCGGTCACAAGATGGAGGAGGA
      GGAGCTGGGGTGGAACCGCTGGGCACAAGGGTCTTCTGCGGACCAACAAAAACTCTGCTAAGGGGCTTAAGTCGTCGCTC
      ACGCGAATCTCTCTTCGCACTTTCCCACTCCGGAGGAAGTGTTTTGACGTACTGCTGATGTCCGGCGGACTGCTGCGGTT
      GCGGTTCAGTACGGTACGGTTTGGTACGTTTTGGTTCGGTTTTGGGCCTTTTTTTTCCTTGGCGGGCTCCTCAACTTGGT
      AAACGACCATCATACACCGTTTGCAGAAACCACACGCGTTGTAATTCCACTGACCCTCATTGGGCGAATTGGGTAGTTCG
      AGTTGGAGTCCAAGTCCGTGTCGGCTTTTTCACGTTGTATATATTTTTTTTTTTTTGGTTTCGTGCCAAATGCTTAACAC
      TCAACAAAGTTGAGAGTTGAAGCAATTTTCCGCAAGAGTAATTAAAGCAACGGACTGTCGTTTGGACAGGGGGGTTGTTT
      TTCCGGGGAGGGGGCCTCACAAAGTGTATGTATGAAGGAGTATGGCGGGCGCCATTGGGTCAAATTTCACGTGAACAGCT
      TCTGTGACCTGAACGGAAAATTCTCAAAATGAAATGTGAACGAGTTCAAGGTCAGGGGTATGTGCGCGAAATGTGAACGA
      ATCGAATGTAAATTTTCCGAAATTAACTGAATAATTACAGCTGCATATGCAATAAATGTTTTGAAAGAGATTTTGCTCGT
      AAACGTTTTAAAATCAGTTAAAAGCCAGTCTTTTCGGTTTACTCTTAATTGATTTAAAATGTCTTTCCTTTTAGCAAATT
      GTAAAAGTCATTTGTTTGGCCAACAATCACGCATAACTCGAAAGTTTTGGGAACACACACAATATGCAAAAATATCAACT
      GTGATCAAATGTAAGTAACCGTAACTCAGAAAATGTTGTCAAAAGTAGTTTGGTCATTGGATAGCTAAAAATTGAATAAT
      TTCAGCTTTGCTGCTCTTGTCTAAAAACCACTGCAGTCGTTTCTCCCAAGGGAATCCTTTTTCGAGAGCTCCTGCCCGGA
      AATCCAATAAAGTGTTTTGCAATGAAGCAATTCCTGGCACGAATCCCTTCGCCTGTCTGCACTCATTCGAAAAGTGTTGC
      ATACTTTCGAGGGCCCACAAATTGAGAACTTCCATAGTGGAAGGAATTACTTTTTTTTTTTGGCGTCAATCGATAATTGA
      ACGCAATAAAATATTCAATGCCATTCAATTCGGTATCAACACTTAAACTAGCTGGAAAAATGGGCTCGGCAATGAAACCT
      CAAAACCTAATATAAACCGACAGCTTATTGGCATTGCAAATAATTTGCGTTAATTAAGTGACTGTCAGGCTGGCGCAGTG
      GAATTAAAATGAAAGGACCAAAGGACCAAAGAACGTGGGCGGTTCAATGTCGATGCACTCGTTATCGACTGTTTGGCAAC
      TTAATTGCGTTTGCTTTTGTAAATTTAATTTTAATTTAATGCTTTATTGAATGACGCAGACACTGCCATTCAATCACTCG
      CGGCTCATCCCATTCGCCATTATTGATGACAGCGAAGAAATCATAAAAAAACAAAAAAAAAAAAAAACAAAAATAATAAA
      GCAAAATAAATAAAAGGCGAAATTGAAGCATAAAATTTACACGACTCTGCCGCGCAGCAATTGATTTAACACAATCATAA
      AATATAAACAAACAGTCTTAAATAAAGGAATAAATAAATAATAACTGAGATGGTGCGAGTGCGAGTGCCACTTGGGCGAA
      AGGGCATTAAACATTTACGCCCATTTTTAAGCGCAGATTATGCAAGCCAACTGGTCAGCTGGCATGGGAATGGGATTCCA
      TGCCCTGGTAAATTGTGGCCATAATTCAGGGAATTAAATTTAAATTTGCCGTGCAACAAAGTGTGGCGCCTCCACCGCGC
      GACTCCACCTCTACGATTCTCGACCCCAATTGCCCCCGGCAAATAATAGTTCAATTTCTCACGGTATTCATTATTCACGA
      CTGGACATAGTTGCTCCTCCTTTTTGCTTCGTCCTTATTTACCATTCTGTCCAGACCTATTATCCTGCATACTTGAGCCG
      GAGACCCTGGCACCGGCTGCCATTGAAATGACTTTTAAAACTTTTTACAGTTGTAATTATTATAAATAAATGAAGCGCAA
      TTTGGTGGGTTCCCAGGAACATCCGCCGCCTCTGCTGCCTGTCTCTTCTTTGTTTATTTCTGTTCCGTTCCGTTCTGTTC
      AGTTCGCTTCTCTTCAAATGTCCTTGACATGCACGTGTGTGCGTGTGTGTATGTGTGTGGTTCTGCTTGTGTCTGTTTAT
      TATTAACTCGAATGACGACCCAAAAATTTGCTCATTTCCAGAGCTGTCAGACGGAGACTAGCAATGGAGGGACCGAATGA
      CCGAGACTCCGAGACATTCGAGGAAGAAAGGAGTGGCCAAATCCTGGCCGACACTCAACTACAAATTGGCCAGCAGGGCA
      GACATGTGCAGATGTCCTGCGACAGATTCGCAGGCAATTATTCAGATGGGCTTCGGAGCCAATTTGCTTGCGGCTCGATG
      ATGACATTAATTTTTGCCAGCCCGCAATAATATATGTATGTATATGTAGGTTATAATAGTTTTTTATGCTTCATATTTAT
      GGGCAAACGGGCGCGCCGTTGAAGCGTTATGAGCAAAACAGATTTTCCACTTTGCATAAATTAAGCAGAATTTAATGGCT
      GACTTATTTAAATGGCTTCCTGCGGCCCGACGCACTGTTTGTTGAATGAAATCGAAAAGTTTGAAATCGCAATCTCGCTG
      GTGCATTGCTTTGATGACTTTTCATTAAATTATGCTTTCCGCATTCCATTTCCCTGACTTAGAGAGAGAGAGAGAGAGAG
      CCAGTGAGTGAGTGAGCGCTAACAGAGTTATGAAAGCAGAATTTTCCATTTTCCATTTCCCGTTTGTCTCTGTCTCCCTG
      CTTCTCTATCTTTCGGGTTCACTGCAAATTCAGTGACAACAAGACAACAAGTATGGAGGAAACCATCGAGGGAATGCGCC
      AGCCAAAACCAAAAAGCCAATACCAAAAATGGCCCAAATTGCATTGCCTGACCTTCACTTAGCGCCAAGGGAATGTTAAT
      TACTTGGCCATAGAACAAGGTGGTAAACTCGATCCGTGCCGAAATCCAACTATTTATGCAATGTGCGTGCCGCATGAGGA
      ATCCACAGCAATAATGTTGTTCTAACAGATTTCATTCGAACAACAATCGAGCCACATTCTATCGCAAAAGCAAACAGCTG
      GCGGGCAATTACGTGGGTTTGTGGATTGCAGATTGAGGATTGTTGGATTCGAAGAGTAATGCTCAGATATCTATCCTGTT
      TTGTGTAAGAATGTTTTAAGCAAGGATAAAAAGCACTACATATATACTGCAATCGAAACCAATCAAAATCGAAACTTATT
      TACTATTCAGTTAGTAATGAGTACCTTAAGTACTATACACACTGAAGGGCGAACTCTGAACTCTTTTTTGTGCCCGGAGC
      AAAACAACTGGTAGCAGTGGAAGCAAAGCATTTATTGTAATTCGAAATCAATCAATAGAACCCATAAAAAAAAAGTGAGT
      GGCAAGTCGTGGAGATGAGCCAAATACCCGCATACCCGCATCTGTGCGCAAACAGTTCGCTTCTCCCTTGACTGTTTAAT
      ACTTATTTAATCAAGTTAATGTAGTTAAATCAGCTTAGGCAAATATTCCCAGCAGCAGCGGCTGTCGAACACAATGTGGC
      CCCGGCCAAGATAAACCGTTCGTTTTAGCCATGGCCAAGAGGAGAGCAAGGCGACTTTCATTCTCCCACACACAGAAACT
      AATACAGATAAAAGGGCATTCATTACAAAAGACCAAAGCGGCAAAGTTTTTCATCGGCGGCGATGTCAGATTTGCGACAT
      CAGCGCCAGGATCTCAGTGCTCAAGATACTGCACTGAGAACAAAAAAATTTTAATTCTGCCGTCTTAATTTCAAAAGTTG
      TATTGAAAAAGGATATAAAGATACCTAGTTTTTTTGAACGGTTAATGCCAATGGCAAATCATTAGGCTTTGTCTCTCTTC
      ATACTTTTTGACATTCAACAATTGATTTGAAATACAATATCCTATTAAATCAAATGCTCAATATTATTTGCTGTGCACAA
      AAAAAGAAAGTTAAGTTAAGATGGTTGGTGGGGGAATAGACCTGGGACCACGACCAATGGCCACCGAGTGACCACACAGC
      CTGGCGTCATTAATATTAAGTAATCGTGAAGGATGCTCTCTGGTGTATAATACGTCCTTGCACCACCAACCCCCCCCCCC
      CCCACTCCTTGCCAACCTGTTCCCTGGCTTTTTGCCGCCCTCTCAAGCAACCTGTGCTCGGAAGTTCGTGAACCCGCTCA
      TTGACCATGAGTTAACCATGAGTGTTGACTGTCGTAAATTCGCCGCCTTCCTGCCTTTCTGCCTCCCACACACACACACA
      CAACCCAAGCAGTTATGAAGAACCGTGGGGGACAGAGGGGCGTGGCTAGGCCTGCCCACTTTCAATGTCTCCCAATGGAC
      AGATTAGTGAAGTGCCAAGAGCAAATGGACTTGGGCCGGAGCAGGAACTGCACATGGGGGAAATGGGCCGAACGGAAGCC
      AAATGGGGGGCTAAATCGAAATCTTGTGGTCAGCAAAGTGATTTTGTGAGTGGTTAGCTTAGAAATACATTCAACAATTG
      TACGATGATTAAATTATATAGAACAGAAATTATTAACTGCCGGGAAAATTATTAAGAGCATATTTGAAATTTGAAAGGGA
      AACCCGTATTTTGTTCCTGTGAGTCATTAAATTAATATCATCCGGCTGATGCTTAATTGCTGCAGAAGGAAAAGGCAATC
      AAATGACTCCAGCTTTGCACCTTTGATTAGGTCCATTTCGGCCACTGCGCCATCCAGGTAATCTAAAAGTTTTCCATCTT
      TGAGCCACACGACCCTTCTGGGAAATTTAGCCCAACCTAATGGGCTTTTCTTATAAGTGTATGTACGTACGGGGAGCCAA
      ACAAAAAATGGGTTAAATTTATGAGCTTAAGATAATGCGGTGCCCAGAAAAGAAATCATTCGCAGCCAAATGTGGAGGAC
      ATTGAACGTAATTTGTGCCGTCTAACCCCCGAAATTTGGACTAAACCGAAATTCAAATTAAATCAGCTTGGACCTGAGAC
      CCAAGTTGGGTTCGCATTCCTTGAAGCTTTAATTGCACATTAAGCTTAATTAACAAATTCATGAAGGAGACGTGGTCTCC
      AGTGGACCAGGCCATCCCATCCCATCCATCCAATGGCCCTCATGATGATGTGATGTCTGCCATTTGCAGATGGAGACGTA
      GGTGGAATGCTAGTGCTGCAAATAGTTTTTACACATTTGATTAAAATGTTGCAAGCCCAAGTTGTGCTGCTCGTTTCTCA
      CTTTCAACGCCCGGCAATTGTGGCCATGCAAATTGAGTTTGTGGCAGCTTTGTGTAAATTTAACCGGACACTTGGACACG
      CTTAGCAAATTAAAATGCCACAAAACCCTGCAGAGAGCAGGGGAACTGGGAGGTGGTAGGTTTTTGGGCTGCAGCGGCAG
      CGGCATCAGCGTCTTCATTAAAATTTTGCCCAGAGCGTCTTTTCAATGCCGCCTTTAAATAAGATTAAGCAAAAAACAGC
      ATAAATCCCGGGCTGCAGTCCGTGCGATCCTGGGCAACAAAAGCCGCCTGCCCTTGGCCCCTTGGCGAATCAAAGCCGAA
      AAAGTGGGCGGCCAACGGGGCGTATGAGCGTTAAATAAGTGTGTGCAAAGTATCTGCGGCCAAGCTGCGCTCATTAAGCG
      AATTCAGGCCAGTGGCTGTGAGTGTGGGTGTAAATGTTTAGATGTAGATGTAGATGGGTGTAGTTCGTTGGCTCATATTT
      CCGAGTCACCTTTTTCTAATACAGTGCCACGTAGGCGGGTGCACTTCAGCAAGATGGAGGCAACAAATCCGCACAAATTG
      CACTCGCAGCGGGAGTGGAAAATGGGAAAGCGGCCGAAAGGAGTGGTGGAGTAAAGAGTGGGGTAGTGGGACGCTGTCAT
      GCGACATTATTGATTTAAATGCCATAAACACCCAAAAGTAGAACACACACACACACATCGAAGCACAGCAAGTGGCACAT
      CCGAAAGATACTTTGAATGTTTTCCAAGATAGCCCACCAAGCGGAAGCTAAAAAGCCAGGCAAAAACAAACACGCTGTAA
      AGGTGTATGTGCGGCCGGTTGGGCTAACACACATTAATGTCTGTGTGTGTGTGGGTAATATGCCGCACACGTAGACAACT
      ATTAACTAAAGCAGACACAGACAGACGGACGCACTAAAGCATACATTTAGGCGCTGATGGCCGGATGTGTGGTGTGATGT
      GGCACGGTGACATTTGCCTGGAGTTGGAGGCGGGCAACCATCCCCACGACTCCAAATGACTATCCGGCCTTCTAAGAAAT
      TTGTAACAGATGCGGGCCAGCAGCTCACAATTGACTTCACAGGCATAGCGCAAGTAATTGGAAAAAAAAAAAAAACAGCC
      GGCTGCTGCTGATATTTTCTCTTGAATTTTCGCTTTGTCGCCAGCACAGAAAGCGAAAAAGCGCGCGATCCGCCCGTGCT
      CCCCTTTTCTTTTTCGAATGGGGGTTCCCTCGTAATTGCGGGCCCAGATAAGCGCTTTATTACCGATTCACTGGCTTTTA
      TCGCATTTTAATAACTCACGGAAAATGCGCCAAACGAGCCGCCCCGCAAAAACACAGTGTTTACGTTACGTTACGTTATT
      TGGCGAAACGAATCGAATCGAACCGAACCGAATCCACGTTACTCGATGTTTCTCAAAGTGGCCAAAATGGCAATATCGCG
      TTAGCTTCGAACATTCGCGACCGCCAGCCAAAGCACAACTGACTAGAATGCCGCTGGAAAAGCAGAACTGAACGCTACGA
      CGATTGCCGCTGCTTTGAATTCGAAAACGAACGTTTGGTCGGAAAAGCCGAAAGTTGGAAAAGCCCGAGGAAAATGCCGA
      ACGATGCGTCACACGAACCACTGCAACTAGGTGGGTGGTTGACACGAGTGGGGTGGCTTGTGTTGGGTTTTGGGCCGAAA
      TGTGGGTGGCCTTGCTCACTTGCATTGCCAAATAGCCGAAGACGCCGCACGGAAGTGCGTGCGTTGCTGCAGTTCAGCTC
      GGGTATTATCCCAATGAAAGGCTGAAGACTGACTAAATTCGCATATGAGCATTAAGCATGCATGGATGCGAGTGGAGAGG
      CGCTGCATGTCTCTGGCTCATAATTATGGATTAATAATGCCAAAACGCTATGCGAATATGTTGGAATTCAAAGGGAATTA
      GAGGCATTCAATGAATTGTTGTCTTTTGAATAACAAAAATTCGATTAAGATGCGTTTTTTGGCAAGCCTAAGTGATATTC
      TGCTTATCAAAGACAAAAGAATCTCAATATGTATCAGATATAAAGTTTAACTGCTCTTGTTTGCTATGCAATTTTATACA
      AGAAAAGAACGTCTAAAGCAACAGATATTGTTTGCAAACACATTTAATACAACAAAATGATTATAGCCACATAAATGAAT
      GAACACATGAAAAGTGACATTCTATAGGAAGTCGAAACATCTGTTAATCCTTGATTTGTGGTATAACTTCCTTGACTTTG
      GCCTATCTCCTTGATATGCTGGCGGCATTCTAGGACCCACTGTATCTGACCTAGCCTGTCATTCTGTTGCGCAAATTAGC
      CGCCACCCACTCCACCCATCGGCGGGTTAAGCTGCCTGCTTTTTTTTTGTGAAATGAAACTGTGTGGGCTGCTTAGCTAG
      TTTCAGCTTAGCCAGCTGCCTGTGTGCGTGTGCATCAAATCATTGCCGACTTTTGTGCGCAAATATTTACGACAACTGGC
      ATCTGCTCATCCCCATACCCACACAGCCCCAGCTTGTGCACATAGAAAATTAAGCTAAAGGTAATATTCATAACATACTT
      TCTATACCCATCACATTGTGTACTTTCAAAACAAAAACTTTGTTTAAACAGCTGTTGAAACGTGGAATATGCACTGCAGC
      TACGACTAAAAACGCCATTCGAAAGCTTGAAATGTACCTCAAGTAGTTCATCATAATAAGTATAAACCCATACAGTTATT
      CATATTTATTTAATTGGGCAATACGACTAACAAGTCTATAAGTAGTACCTGGCATACGTGTCGTATGAGTGATTTGAGTG
      AAATGTAACTCAGTTACGTGTGGAATGCTGTTCTCTGCTTCTTGAAGTGGAAGTATTTTCATAGAATTTGTGGTTTTAAT
      GCATTTATGAACGACAGTACAATTTCTTTCAGTATGATGACCCATTCCCGGGGTAAAATGACACCGAAAAGAAACAAAAG
      CATGCGTCTAACATCTAACGACGACAACAACCTGTCACGCCAGCTGAGGTACGACTGGTGGGATTCGTTGGGTTCACGGT
      TCGGTTTGGCCATGGGTGCGGAAATGGGCATGGGCCATAGACCGAAGGTATGGCAATGGATCCCCTAACAAGGCATCCTG
      CAGAGCCAGAAAGGGAGGAGGGAGTAGAAGCGACAGCAGTGCGTCGGGGGGTCAGCAAAAGAAGGCAGTAACCTGTGGAG
      ATTCAGAAGCCGGAGCTGGAGCAGCAGCAGCAGCCGGAGGTGCTCCACATGAGCTGACACTGGCAGTCAAACAGAGGCCC
      AGGGAGCCCAGCTCGTACTCGTAATGGCCTCTAAACAAAGGGCGTGCTTGTTTGGCAACAGCCAAACAGCCCGTTCGCCA
      TTGCCTGTGTTCCAATGCCATGTGTACATTTGTCTTTTTGCAAATTAATTTATAAACACAATTGACATTGAGCCGGAATG
      TAAATATGCCGCTGAGAATGGTTGTTGCCTTGCATTAAAAATTCAAGTCCCACTCTGTCACATCTGCATGCTTACCACAT
      GTGTGCGTGAGCCCTTCGCTGTGTGTGAGTGGAGTGCCAGTGTGTGTGTGTGTGTGAGCGTGACTCTTTCCCGTATGTGT
      GTGTCTAGCTAAAGAGTGTGTGTGTGTGTGCCTCGCTGTTTGTCTTTTGCCATGGCCTGGCATATTTATTTATATTTCCC
      TCCAGGAAGCAGCAACAAAAGTTGCGAAATGCCAAGCTGACGTTGCACTTAAGGAAATGGGCTAACACAAATATGGCTGA
      AATAGAGGACAGTCGTTTGTGGGCGGGGTGGCATCGCCCTGGGAAATTCCAATATTAGTTATGACCTTCAAGTGGGCCGC
      CTTCTAAATAAATAATTTAATCAATTGCTAATTGAGCACTGGCGCCCAACATGATGCATATTTTCTTGATCAAAATTCCT
      CGTCCAAGTGGAGACTCCTTTAAGCGAGGACTATTTGATGCTCAAGTACGCAACCCCTAAAGGTCACAACTCTTTTGCAA
      GAGTTTGCACTCGAAAAAATTGGTCAAGTTTCGATTAAGGAAATAGGTACAATTTTTGAGGGGAGCAAAAAGAGATTCCA
      TTGCTTGCCATTATTTCGAAAAATAGAGTTACTACAAAATCATTACCTAACAAAGAGGAAATATACCCCCATTTTTTCTC
      TGTGCACTTGCGAAAGAAAAAGGACAAAATTAAAATTCCTTTCTCCTCAACTTTGCTAAACGGCTATTAACTTTCCGTAC
      GTATCTGCTCGACCATAATTCCTCTAAAAATTCAGTCATAGTCATTCGTACGTTTGCAGCAGCCAACAAAAAACTGTTGA
      AAATTTTTTGAGAAGGAGACAAGCCAAGCACTTTCAGCTGAAGACCAACAGCAACAACAACAACAACAAGTTGTCGTTGA
      CTTAAAAACTGATTTGCAATTTTATAAAGAGCTTGGGCTTTCGCACAAAGGTCTGGCACACACAAAGGTGGGGTAGTTCG
      GTTCTACGGTGGTACAAAATGTTGTATATGCAACGGGTGGCAAAAGCGAAAGCAGCAGCAGAAACAAAAGCTAAACAAAA
      CTTTTGTTTGTCCTCATCGGCCGGCTGAAAACTGCTGACTGACTTGGCTGAAATTTGCCGACCGACCAGGCCTAAGCCGA
      AGTGTCTCCCTACATCTGGTGACCTTTTTTGGCTGGCAAAAATTGTAAAACTCATTTACATAACAATTACCGCTTGACAC
      GGCGATGTTGCCCCCACTTTTTCTGCTCCTTCCCACCCCACCAACCCCTTTTTCACCCACCCATTTGGGCCAAACCAAAC
      TTCACATTGGGTAATACTTTGAAGTTTGGGGCGAACTATACACATACATACATACATATCTATTGTTTGTTGTTGCTCAC
      ATGCTGTCCCTTTCCGTTTGTCTCTCCATCGCACTCCCCCGCTGGTGGCGCCACCTGCCGGCACTTGCGGGACTGACATT
      TTATTTAGATTGCTTTGCATTTTCAACTTTTCTCTGTTTTCCAACCGCCAACTGCGTGCAATTGTCGTTACAGAGAAAGA
      AAATATTAGATTTACCAATATGTGCTATAAAACGATTCTATTTAATTGGAACATACTTAAGTGTAAGCCAACATACCAAA
      TTGAAATGTAAAACCCAATTTAACGAATTAATTTTCGTTTTTCTTGAGGCTATTACGTAAATGAATCTTATTATTTTCAT
      AGCAATTTTTCCTGTACTGTACTGCGGACTTCCACCAACTGGAAAACTCGCTGGCTTTAAGTTGCCCCGCACTTCACTTT
      CATTATGTGTCAGTTGCATTGTCTTGACTTTGCGCATACATTTTCCCCGAGTTTTCCGGCCCCAGTGGATTTTTATGTTC
      GTGCTGCGGTTCCGCCCCGGTTATGTGACACAGGGAGCTGAACTGTTTCGCTTTAGACACTGATTAGCCGTAGCACTTAC
      AATTTCATCCAAAGTGTTCGTCGGCTCCTTCATACCATGACGTTAGAGATTCATCCAATCTGCCGGCGAGAGAAAGCAAA
      TAAAAGAGAAGTCAGAATCAGCAAACAGACAAACAAATAATCATTAAATATCAGATGTACAAAGCGGTGGGGGGGGGGGA
      GGTGGCCCCCTTTTCAGGTGCGTCAATATACAAATGTCTGCCGCAAGAGGGCGCCCACAACTTCCATGCGAATGTGTGAC
      TTTGGCAAACATATTTAAGCAAAACCAGATGAGCACAAAATTTAAATTCGTACTACTTAAAATTAAGACAAGCATTATTA
      AGCAACACAACCTGCAACTTTAACCCATGGATTTGCTTTAGATTTGGTTTGGTATTGATTTCAAATTACTTATGTTGCAT
      AAAATTCTAACTTTTTAGTTTACACGCTTCTACGTAAACATTCATTTGATTCGAAACGATAAACATGTGTTTTTAATAGG
      AAGTGCAAAATGGTAGGTGTGTTTGCCAACAATGGAAACTCACAGAAACTGCCTCACATCTGAAATTACGTATTTGTATA
      CAAAAGGCAGTCCTATCAAGTTCAAGTATTTTGTCGTAGAAATAAAAAAAAAATACAAAGGAGAGAGATCACTATTGTCG
      ACGTTCTCGACTAGCAGATACCCATGAGTCCTAAAATATTTGATTTTTAAGATAGAAATAGACAAGGAAGTGGCCAATTG
      GACTCCGCAGACTGGACAGCAGATCACCTTTTTTTTCCTGTTACATACCTTTCAACGAATCTGGCATACCCTTTACCACT
      TCAAGTAACGAGTAACGAGTATAATAATTTGCCTTTTCATCATCCAACATATACATATGTATGAAGGCAGTGATTCAGAT
      AGAGAGGACCAAGATGAAACCTGGCATTCGGTGCGTCCTTTCAACGCACCCAACTCTCTCAGTCAAGGAAAATTCACTCT
      TTTTATGCGACTTATTTAGTTCAACAATGGAGTAAAATGCGAAGGGCACAAGCTCAGTGGGGAAAAAGTTCATTCTTATT
      AAAATCATGATATACACAGCGGGAAGAACTCGCAGTCATTTGCATTTTTCAACCACTCGCCATGCTTCCGAATAGACTTT
      GTTTTTTGGTGCTTCTGTTTTGTAAGTTGATTGCCACATAAATTTCATGTAATCTAATAAAATTTGAATTGTCGTCGACT
      CCTGTTTTTGGGGCCAATGTGAAAAGTGAACTGCCAGCCGCAAAATATCCAGTACCCACAATCCACTGACAAACTAGAGG
      TGGTTCGATTTTACAACAGAAACTTAAATATTTTTAGCTAAGCAAACAAATTACACAATCGTGACTTAATTCAGTATGGT
      AATTTAAACAATTGAAAGCATTTAAGGCACGACTAATTTTGTCACGCGCACATCTCTAGCTAGAAATCGCAATCCTGTTT
      GAAATGCTGATGGAGTTTCAACTTTGAACGGGCGATAAGCTAATCAAATTAATTCAACTTAAAAAACTTGGCAAGCGAAT
      TTGCAACAAATTAATGTTATTTCATGGCTTCTTAAACTTGACACTGCGGTAACTACCCCCCAACCACCACCCACCCCCCC
      TTTTTGTCAGCTCACTTCAAAGTAATTCATTTCTGATTGGAAGTTTCCTGTCAGCAATTTTACTTTTTCCTCGCTTTTCA
      CTTTTCACTTTTTTTGTGTGTGAGCGAAAACTTTTCTTCATGGCTTAAAGTGGGAGCGTTTATGAACGGATGTACGATGC
      ACGATGTACGATGTACGTTAAACTAAGCCAGTTCGAGTTGCCACACATTTTACCCCTCGAACAATAAACTTGGAAAACAT
      ACTCCATAGCCGACGGGGAGAGAACATTTTCCAGTTTGTTGATCGAATCCTCTGGGGTGGAGGTGGTACCCCCCAGATCG
      AAGGTTTCTGAAATCGCATATCCTGGGTATTTGTAGGCAAATTGCCCGCATTTTGTTGCCCCCTCGAGTGCGAGTATCTG
      CTGGGTTATTTGTAAACTTTTTCGGTTGATACTTTGCGATGTTGGTGGGGGAAGGGGAAGGAGGAAAGGGGTGTGATGCC
      AAAGTTAATCTCGCTTAGACAAAGTTCTCCGTTTGCGTTTAAGGCATTTGATTGATTTTCCCTCCCCCGCAGCTTCGATT
      GAGTGCAAGTGGCAAATACTTCAGTCACTTGCCAATTCGCTCGAATGCAGTTTGCATGTTTGATGACAGCTCCAAACGCT
      TCTGGGGTTGCCTCCCCCCCGCCCCTCCCCACCCCTTCGAAATTCGATAGCTGAAAGTCTTCTTTTTTTTGCATACGCTT
      GCACACCTTTTTCAGCACCACAAACAAAACGTGTCAAATGCACAAAAATCCAAATTCTCACATTGCCAGCCGAATGAAAT
      TGTGAGGGCGATGCATGCACCTGCTATATGGAAATCTAAACAACTGCATTCATATATATTTTTGCATATAGACCAGCTCA
      GGAAAAAAAACCAGGCGAAACGAAGCAAAGCAAATTGGCTTTAAACAACAAATTTCTTAAAGAATTCAAGACCAATTTGC
      GAGAAAGTCGATCAAATAAATAGGCTTAAAAACTCAGCAAAGAAATGGATATAAAAGATTCATAAAAATCTGCCTTGAAA
      TATCTATTGATAATTTAATAATAAATTGTTAAGTGTTTTTAGACAACATTATTTATACATTTGAGCACATTTCTGAATCA
      AAAGCAACTCAAATCCCAAGGCATTTTATAAATAAATACCAATTGCAAAAATAATCATTATTAGCTTCGTATATGACTTT
      GTTAAATAAAGTCAGTCAGCTGGCGTATAATTTGGCAACGCAAACTGCTTTTAATTGGATCAATACCCCACAGCATTTAA
      TGCAATTATCAATTTGACAGTGAATACATTTGGAGCAAAAGTAAACACACATTTGAATGCAAATCCCGGATGAATATTTA
      CTCTAAAACAACAGGAGCGATCGCAACCGCATTCAAAAGGCTGACTAAAATATCAACGGCCAAAACAATTTTAATAAATG
      TGTAAATTACAAATGTTTTAATTATTCGCCAATGCTGTGGGAATTGGCGGCAAGGCACTAAACAATAAACAATTGCGCAT
      CCTGATTGAAAAAGCGTGAACCCAATTCACAATTAAGACACAAGGCCATGTTGTTTTGTTTGCGGATTTCGTGAATTTGG
      GTTTCGAATTCATTTGCGACCTTTTCATTTAGTTGGTTTCTGGTCTCTGTGGTATCATATCAAGTTACACTTCCGCTCAT
      CGGGGTTTTACATAAATTAGGGCCAAACTGGACAATGCAATTTTGATGAGAACTAATTTTTCAGCCATAAGTGGGGCAAA
      TTGAATTTGCAATGCTGGGGAAAGCTGAAATTTCGAAAGTGGCAAGTGGAAAGCGTTGCGTCCCGGCAATAAACATGTTC
      TAGTTGTTGTTCTCCTGTGGCAGTTGCACATTTGCCAAGCGCCACAGGGGCAAATGCTCGAATAGACACACACACACACA
      CACACACAGTATGGCAAACAAGTGCACATGTGTGCGAATTTGGCAAATGTACAGCAAAAGCGCGAAAATAACACCTGCAG
      GCTGCAAACTAATTAAAATCATTGCGGCCATTTTGATGAGCCGCGTCCATTAAATCATTCAGTGCGGATAAAATAAAAAC
      ATTGCCTTTTACAGTCAAGTTGATTTTACAAAATATTTGAGATAACTTAGTAAATCGAAAAAGAAAATTAATCACCAAGT
      TCGTAGTTAGAAACTCCCTAAAATAGCTATAGTGCTTGAAGTAAAATCTCCTTGGGTCTGTTTAATAGCACTCGACGAAT
      ATTAATTGAATGCAGCCGCTAATTAGTGAAATTGTCAGGAATTTGCAACTTCGGCCTTGCCCGAAATAATAACTTAACCG
      ACTAAAACAGTATAATTGCGACATTAGAGACTTTGCCAACTAATTATCTATAGTGCAGGCCATATAATCAGTTTATGCGG
      CAGCAGCACGTTTTGTTCGATAATGCCTACTGTCATGTATCTGTATCTGTATCTTCGTTGTCTGCCACTGCATCTGTATC
      CATAGCTGCATTTGTATCTGGAACTGATATCTGTACTTTAAGCGGTTTTATATTGGCCACAAAGAGACTTACGCTTGGCC
      AAACCAGAATTGGATTATACATATTCATTCAGAGAGGCAGAAATCCGAAGAATATCTCAATTATTTGCGTGTTAAGCGTG
      CGGCAAAGGCAACAAAGTGGCAGAACTTGACATAGGGTAAGGGTAATTAGCAGGCACCTCAATGTGGACAACCATTTGTG
      CTAAGCACTTCGCGGCGATGTCATTAAGACAGCACTCAAGCCTGGTCAAAAGGACCACAAATTATGGCAATCTGTGGCGA
      ATGAGCAGGAGAGGTAGCAGCTCGTACGGCGATCATAAATCAATAGCCATTGACAGCTTTGTCAATGAATCGGCGGATGA
      TTGAATGAGCATACGCCACGTCCATCACGGCGTATACGCAACGCTTCGCTTAACGCGAAGGTCATCAGCAGTAAGTGGCT
      GACGACCGGAAAGAACTCGGTTCACAGCGCTTTTCTATTTCAACGCGCCTCGTATTCAAAAGCATTTTTCTTTTAGAAAA
      TCATTTTCGCTGCCGAAATTCTAAAAGCAGTTCCCCATCCCCACAACATTTTGTGGCAATTTGTTCAATTACCCGAGCTC
      AGACATCGATTTGGTTTATTAAAAAGACGCCCAGAGTCCAGGCGAAAACTACAGACTTTCGGTTCTAGGCATTTTCGCTT
      GGCCAGCAAATTCAGCGGAAAACATTTTCAATTTAATTAAACAAAAACAAAGCAGAAAAATGTTGTGTCGAGTAAAGTTT
      TTATGTACTTTTGTGAAGGGGGTTTTGGGGCATTGAAAAGGGATGATGGCATGATGATGACAGCACAGAAGTGAACGCTG
      GCCATCTTCAAATAATTGTGCAGAAATTAAATTTGTGTGACCCACAACTTTTGTGAAATAAAGAACATAAAATAGTTGAA
      AAGCAACACTTTACGAAACAACAATAGTCAGCATGCAAACATTTTTGTGTTATTTAATTGCCCAGCTTATTTGGATACAA
      ATTAAATTGAAATTTAATTTCTGTTTCGTGAAGCGATGAAAACTATTACAATGGCAATTTAATTGCAATATAATGGCATA
      ATGGTGGCTTAATTGTTTAGGTTCATTATTAATGGTAAATGGTCATTTTGTAAAGAATAATACACGTTTTAATATATTAA
      TGTAACTTTTGAATGTACATTTCACAGACTCTTGCCAAATCATTAGGCAGTAAATTGCTCTCAAATTACGAGACTCTTCC
      ACTTCTAATCCGATAGTAAATTATCCCGAAATGTGCCTGTGTAAATGGCACACTAGAAATAGACAGCCGCATACCGCACA
      TTTGTCCCTTGCAGCTACATACACTACCGTCGACATTAGCTGACAATAAAATATGTAAATGGCTGCCGAATAAATCGCAG
      CCAACTTCTGACATGACAAAAAAGTGGGAAAAAGGGGCATTTTCCGGGGAGTGGAGCAAGTGGCAAGTGGCAAATGGAGA
      TCGGGGCGGCAGACAAGAGTCAAACAAGCAGAAACCGAGCGACATTTTCGTAATGCGAAAAGGTAACAGACGAAATCCAT
      CAGTCCATAACGAAAGCCCCGTTGTGTCGCATGTGTGTGTGTGTGTAGAATACCGCCCCCCCCCCACAAGTTGCCGCCCC
      AAATGATGAGTTGCGATTACACACATAAATACGCAATTCGCTTAAGTACGATGGCACGATGTGGGAGGTGAGGGTTGGTG
      GCCCGGGGGATTGGGTGTGCATCTGATGGGGATCAGGAGGTGGAGCGGAAGAGTTGCGGTCCCATTCCGCCATGTGAGTC
      ATGGCCCGGCTTCTGTTACCACTTACCCACATGGAAACTCTCTTACAGTTGCGGTTAAATCGAAAGTCATACCATAACTA
      CAATATAATATTACAAGCCAAGTCAGAGGCATAAAACCGAAACGAAATTGGTAACATTTACTACTACATAGTCTACTGTA
      GAATTGATTTTCTATATTGCACCCAAGATCAAGCCTTTAAAAGTTTATTAAATTTCTGTTGAATATGCATAAATACGAGG
      TCAAGTATGTAATATTTCATCACAACATGTATGTAATTAAAAAATTCATTTCTGGGAAATCGATTTTTCATGTTCTTGTA
      TCACTATTCTTTCGCCGGCAGCTGTATTTATTAGCAATTCAATGTGGAAAAGCACCGACACACACACACACACACACAGG
      GACAGACAGACAAACACGCCCCCACACACACACACTCACACAACAATGGCAACAATAATGCGAATTGATGAAGCGTGAAG
      GATTTCGGAGGCAATTTTCAGGAGAGGATTGCGCCTGCATATCATCACTCTGCACACGCACAGATTAGGCTGGGTCGAGA
      TGGTTAAAGCTGCGGTCCGAAAAGTATGGATTTCAGACGACGTATCACATTTGAACATTACTGAACGCACCCTGTGCGGG
      GATTAAGTATCCGCCCCGTTGCCGCTGCCTTTGTTTGCCCATCCATCGGCGGACGGCCGATCCATCCAATGCTGCAGGGG
      CTATTTTCATTTTAATTTTAAATTACAATTACGTTTGTTAATGATATTTAAATGGGCATTGAAGTAAATCACGCCCCAAT
      GGGCAAGCAAATTAATAATGCGATAATAAACGAAGCGAAGTGAACAATCTATCAGCGGGAAGCGGCGAATTTTATTGCGG
      CATTACGTGCCAATTAATTTGCGGAATGTTCTCCTTTGCGAAAGGCATTTGAATGGAATTAATCGCGAATAGTGTGTCAT
      AGATTTAAATGCGTCAAAACCGCCACTAAATTGCATTTGAATGCAAACTAGTATTTATTTATTTTATTATCCAGCCAGCA
      AGCGAATGAAACAAATGAAAAGGTCAAACCAAACTGAATCTAAAATAATAAAAAAGCGTAAAACGAACCGCACCGAACAA
      AACTCAATTGCGGCAAAATAACTAAAATTGCTTTGTCAGGTTAAAAGAGAATTTCCCATCATGAGGGGGAAAGTGGTGAG
      CATTTTGCCTCCGCCTCCAAATACAAAAGGGGGCGTGACAGAAAGCTAGTGTGTGTGTATCGCTGGATAATTCAGACACA
      AAAAACTTTGATTCTATATGCAAACAATAAGGGAAGCCGGCAAAGGGAAAGATTTGCATGTGGAGCGAAGCTGGCTGACT
      GGGATGTGTGTCAAATAAACATATTTGCCCCCCACCCAACCCCCCACCCCGGAAAAGGGGGATATTTCCACCTCCTCCGA
      AGGCAGTTGGCAGGCATAAAATATCTGCAAAGCGCATTTAAGCCGCGCCACACAATAAAAATAAATAACGAAAGGCGGCG
      AACAAAAAAGCGCACCGAGAAGCAGCGATTTTCTCCGGAATAAGGACCACCCCACTGGCGGGGTGGACCGTAAGCTGTGG
      GCGGGCGGGGCCAGGTAGCACATGCAAGCCAAAAAACATAATAATAATAAATATTCAGTTCAGTTCAGTGTGTTCAGTTT
      CCGTTTTATTCAACCTCAAAGATAGGGCAAGTGAGGGTATGAGCTGGAGTTGCAAGCCAATTCAAATATTTTGGCTCAAT
      AAAGTGCAAAATGTTCAAATTTTTGGCATATCGAAAATTGATATTTTCATCAATCTTTTAGAGAAAAAATGTACATGGGT
      AAATTTATGTTTACGCTTGAAGTAAGAAATATAAGATTAAAAAGAAAATAATGCGCTAGTCCTTGTACTGGGTATTTTTG
      TAGGAATCCTTTCGCTTCATTTCGTAAATTTTTTGCACCGAATTCGCATGAATGAAAATGCGATATGAATGAATAAAAAA
      CAAAACTACGGCGAATGAAAAAAGTGATTCGCCCACATGTGTACATGAAAATGCAGCATTAATATATGTGTGTGTGTGTG
      TGTGGCATATAGGGGAGTGGGGAGGGGGGCAAGAGTGAAAGAGAAAGTAAGGATGCAGGGTGAAAGGGAAGCGGAAACCG
      CCCGCAAGTAAGTAAACCAAATCCGAATGAACAGGGATTTGCATTCATAAAATATATCGCATGTGAGCAGAGCGGAGACA
      TCCTTGCTTATCCTCCCGTTTCGGTGTCTTCGCTCCGTCTCTTTCTTGCGCCCTATACCCGTCCCTTTCGGCAGCAGACC
      CTGCAGGTATTGCTAGTCACAAATGGAGGTCATGACTGTGTTTGTGTGTGTGTGTGTGAGTGTGCGACTTTGTGTGTGTG
      TTTTGCGCAAATTATGCAAATCGCAAGCATGAAAAACAAATATTAAACTTTCCACGAGAAAAAAAAAGAATCAAAAATTA
      AATAAAATTTTACAAAAGACATAAAAACCAAACGGTTGCCCCAACACGCACACAGTGATACACATAAGTGGGTTGCCTGC
      ATGACAAAAGTGGCAAAGGGGTTTCGTGGGGGGGGGGGGTGGTTTTCCAGCCATATAGTCAAGCTACCCTAAGGTGGTTT
      CTGCTGGCAATGGAATCAAATTGACTGGAAATGGCCTTTAAAAACTTAAGATTGTGCCGCATCTGATAATGTCTCAGGTC
      TGGAACTTTCTAACTTCTTTTTGATGGCAAAATAAATTAAAAGGTTCCCAAAAAGCTTAGGGTTTCATTGAAATGGCAAA
      AGCATATATTTTACTTTTCAATTTGTCTGTCAGTTTGGATTATCATTACAGGGAGTCCTTTTTTGTGGAACCTTATCGTT
      CATAATTTGGATAGCAGTGGCAAGTTGGACTGTAGATTTGAAAAGGGACCCGCGTAATGATTGTACTTACAGATGTATGC
      ATGACCTAGCTCGCCATCTGTGAATCCTGTTACCCCCCCTGCCCCCTGCCCCCTGCCCCCTGCCCACTTCCCCTTTTGGC
      CCGTTTGACGAAAGTTGGTAGCTCACCCGAACAAAAAACTAAGGCAAACAAACAAACGCAAATTGTGTTCTCTCTCATTT
      TTGTTTGTTTTTTTTTTTCAAAAAGCGCGCGTGGACAATGGCAAACATAGGTGGAGTGTTATGTGGTAAAAAGGGGGGAT
      GGGGCTTTTGAGAAGGGGTGGTAGGGGTGCGGCTCTGGGCGCGGCTGTCTGCACGTGTGCGTTTGAGCTGCGGAGCAACT
      AGTTGTGGGCCAGGCCCATTTCATTTCGGCCAAAAGCGTCGCAAAAATATCTGTAAACACGCAGCTGGCTTTGAGAAGAG
      CACCCCCATGAAAAACCTGAAAACCCCCCAAACCACTCGAGAGCCAAAAGCGTTAAATAAAATCTCGCACGCTTCGTTTG
      GACGTGAAAAAAAAACACGTTTGTATTCCCCTGCCAACACCAATACCCATCCACCCACCAACTCTCTCACTTTTCCTCGT
      TGCTGCCTCAGTGAAATGCAAAACAAATTAGAAAATAGGTTTGTCAACATCAGGCAGCCGGTTTCAAAACTCAACATGTG
      GGCGTACCTGCCACGCCTGGCTAAAAATTGGATTTCACTCGTTGTTGCCAGGAACCAAGTGCTTCATATGCAGCAGTGCT
      TGTAAGTGGCCAGCGTAAAAATGTTTGAGAGAATTGCTTTGAATTTTTTGGTTTTAAAACCCATGTTACACAACCTAAAA
      GGTCACTGCAAAAATTGTGTAGAACATTTGCAGCCAAAAATGGTGAAGTCTTTAAACCCATTGACTAAAGCGTTGACCTC
      AAAATTTGTCACTCAAAAAGTATCAGACTAAATTATCAGTTTATCTTCAAAAAAAAAAAAAAAAATTATAAATGGCTTGT
      CAATCAAGCCGAGTTCATTAAACGGTTGGCAACGTTTTTGACGTCACAAGCGTTACTACACGCACTCGGCCAAAACGGAG
      CGTGTTAAATGTTTGAAACAAAAGTGTTACTGACCTCACATTACACGTAAAAAACGTGCAGGTTCACCAAAACTCAAACT
      CTTTATTTTTTGGGGGGTGCTAAGCGCGAGAGAGAAAGGCATATGTCGCAGGAGTAGAGGAGGAGAGAAAGAGACGGGCA
      GCCAAGGGAGAGGTGATAGAGATAGCAAGTTTGGGGCCTCGAAGTTCGACGATAGCCTCAGCCTCGCTTCACTTTTCACA
      CTTTTCGTTTTCGTTGCGTTGGAATTTCTAAAAATCCAAAACTACCAGATAGAACGTGCGACAGAGAGGGCAGCAGCCAG
      AGCGAGAGAGAGAGAGACGGGGATAGTGGCTGGCATTCCTGGTTTCCAAGGCAACAAAAAGCAACCCAACAGCGATCGCT
      GGAATGCAGCAGCTACAACAACCACAAAAACAGGGCTTGAAACTAAAAAAAAAAAAACTGGCTTTGTTGCCTTTTTACAA
      CGTTTTGTGGTTGCTGCACAGAGAAAAATGTGAGAAGTACAAATGTAACCATAAAAAATATGTTAGCAAAAACATGAAAT
      GCTAACAGATATGTATGTTAACTATCAAAAAAGTTCTTCTTAAAGTATCAAGCCTGTAATTGTTACAAGTTGAAATGCCA
      CGCAGTTAAGATTAGTCCAATGAAGTTCTTCAAATATAACTATGGCTTTCTTATTTCACCATCTTCGTTTAATTCCTTGA
      CAACAGATACATATACATATATAAAAGATACTTAGTTCTTCATCTTCTTCATAAGAAAGCTAAATACAGTTAGTAGATAG
      AATGATAGATCTTATAAATACGAAAGACTTGGCTTTTTCGCTGCGTGTTTTTAGTCGTGGGGAACACGTTTAAAAGCGAT
      CGAAAGAGGTGAGGTGAAGGGGAACCCTGTTGACTTGGCTTTTCAATTGGAAATGGACTTGGGGCCCGAGAATGTGAGAA
      TGGGCCTGGCTTCGAATCGCTGTGCACATTTGTGTGGGTTTTCGGGGATGCTTTTGTGGACGGACTGCCGATTGTGCGGA
      TTGGCTTGCCTGGGCTAAAAAAAAAATGCTAAACTAAACCGGAATGTGGCTCATTCAGTGAAAAGAGCATAATAATAGCC
      GCAACATGATCATGATCGTGATGACGATGGCGATGACGACGACGACGACGACGACGACGCTGGCGATCGAAAGCCAAGCG
      CTGCTGCTGGCTTTGGAATATCGTCGTAACTTGAGGCCGGCAATCTAAGCGCTCGACTTGCTTGTTTTTCTGGTTTGCCA
      ATTGCGCCAGATTTGCGTTTTTTTTGTATTATTTTTGTTGTTCGTTCGGTTCTCGGTTTTATTTTTGTTTCAAAAGAGGA
      AAAAATGTCGCCAATGGATCAGAGGAAAAAAAACAGAGCGTGTACAGTTGCAGCATCATTGGATCGAACAAAATGGGAGG
      CCAACTCCTCCCCCTTTCGGGAAAATTCCCACCAGCCAATGTTGGCTGGAAAAAAGAATCACGTTTATACCGTTTTGTAC
      TGATTTTTCAGTTCCCTCTTCTCATTGTCATTATCTGGTCTTTCTCTTTCCACCTCGCCGTTTTCAAGTGTAATTTTGAA
      ATGCCACACAACACACACACACACTTGTGCGCCCGTCCATACATACACACGTACACACACAGTTACCATGCTCATTAAAC
      ATTTTTGCTGTTGAATAATTTTTCTTTTTTTCCACGAAGAGAGTGTGAGAGAGGGGGGGGGGGTTGAAGTCAAAAGAAAA
      GAAAACTTCAAGTTCACCTCACCTTGTCTGCACCTTGCGCTGCTGTTGTTGCTGCTTCTTCTTCTGTTGTTGCTGCTGCT
      TTTGCTGCTGTTTTGTTGTTGCTTATTTCGCTGCTGTTTAATTGCACCTTAAAGTGAATTAATCACCATTTACACTGCCG
      CTTCTTCTTCGCCTTTCTTCACCCTGCCTTTTATATCAGGCAACTTTTTTGCATACTTTTTAACTGGCTTTCTTTCATTC
      AATTCACATAGCTGCTTCTTTCCTGACTTTGTAATTAATTGAATATACACACTCACACTCACTTACGTGCTCGTAAAGAG
      CAGACAATCTCACAGACACACACACGCGCAGAATGAGCGAGCGAGCGAGACGGAGCACGCGGCTTTTCCTTTTTCGGGGA
      AAACACGTCTATCGACAGGTAAGCGCGTTGAGCAACTGATCGCCTCGCGTTTGGGCCACGCTCAGCGCAATAAACTGCCA
      GTCTACCACCACGCCAGCTAGCCGTCTCTTTCTGGCCGCTCCATCTGACGTCCCGCTCGCACCTGCGCACTTGTTGCGGC
      GTTGGCGATCGGAACGAAATACGTTACGAAGCACCGTTTGAATTTTACCTGTGACGCGCAGAAAAAGAGGGATAGAGCGC
      CCACCTGGCGAGCAAGAAACTCTACACAGCGGCAGAGAATCGCAGAGAGCGGTTTACCTGTGTTCACCTGCACGTAAAAT
      AAATTTGTGGCATAATATCAATCTAAATCTTAAGACAATGTAATCGGAGTAATCAGAAATCAATATAGGATTATTGACTA
      TGCTATAAGCACATATGTATACTATAAGTTTAAAATAATTCCGATATCTTCGCTTATCAGATCAATAACAGTTTTTTCTC
      AGTGTGTCGTTATCGCCGTAGCCGTCTCGAAGTTGTTGGGGTGAAGTTTTCCAGGTATTTGTGTTGTCATGGTGCAAATA
      TAATGGCAAAAACAATTGGTCTAGACATGATATTTTGTATAGGTGCCTTTATTTTACAAACAAAAGATGATTTTCGACCA
      GTGTGGGAGGATTTGTCCTGGCAAATTATCCTGCCGTTTATTTATAACAGAAGGCGCGAAATTGGTATTTAAATTTGTTG
      GTGCGAGTCCTCGCTTTAGTCTCAGCAATGCTCGTGTCTTTGCTATGATGGGTTTCCCCTTTTTTAGACCACTGCAAATA
      ACAGAGACAGAGACTGTTACCAACAGAACCAAGTCAAATTTAACAACTAGATGGCGCTATTCTACATCTACGTGTAGATT
      AACACATCAAACTGACAAAATTTAAATCTAACTGCTCAGACTTCTGAAAAAATTAAAGGATTTATTAATGGTAAGCAATA
      TCCTAAGTTATATTCTTAGCATAAAAATTGGCATGTACTTACCAAAGAGAAAATAACAATAAACCAGAATTCAGCACTAA
      ATTTAAGAGTAACTACAAAACTATAAACATATTTCGCCGGCTAATTGGCAGCCATAGCCATCACTCTTTTATCTTCCCTT
      TCCACATTTTTTTCGTTGCCCGCCGAAAAGTTGCATAAATCTGTAAAATTACCCAAACACTCGAAAGCTACACACACAGA
      AGGTTGAGTAATGCCCGCGATTCACACGGAGTGTGGCGAACAGGAAAATTGTAAATGAGGGCGGAAAATGCCAAGGGGAA
      AGTTAACCGAAAAGCGTAAATTTTCGGCGGCGAAGAATACGTCATAAAAACGATTTAACAACCGAATAAGCAACCGCAAA
      AGCGGAATGACAATGACTACGCTGTGCCCAACTCCTTGAATTTCTCCAATGCCACTTGGATACCTGCTGCTCTCCCTTCC
      ACTTTTCCGGAAATGAAGCCGTCGCGGCGCTTAAAACAAAGGATGCGAAAAGGAAAATCCATCTGATGTTGGGTAATACC
      TGTTTCGTTATATGTATTACAAATCATTCATGCGGTTTCTGGGCGGCAAACCTCAAAGAGAGTATCTATCTATTGGCTGG
      CAAATAATTCTCCAGAGATAAATCTTTTCATTTCGCCTTTGACGGCTGCCGTTGAGGCAACTGCTTTTTTTTATGGCCTA
      TCAACGAGCGTCTAATGCCGGCAATTAAAATAAACGACAGACAAGCGAAAGCTGCCTGCGGCCCAAGCTGCCTTAACTCA
      TCCTGCAAAGGATTTGCAGTTGAATTGGAGGGTAAACGCCTTCCAGCTGCTAGAAAATGTGCGTTTAATGAAATTTTTAT
      TCAATCAGCACAGCAACTTTTATGGCAAGACGACACACATAAAGGGAGGCTAACCTGTTGAGTTTATGATAAAGTGGCTG
      CCCTTCCTTTTACCCCGATCCCGAACGCAATCCCTATCCCGAAGTGCTCCACTTTTACAGCCTCCATTTATCTTACACTT
      TGCGCCACGCAACGCAACGCGTCGAGTGGAAGATGGAAGGGATTTCCCCGAGCGCTATGATGTTTGCTTAGTGCGGGATA
      TGGAAATGGATAGATGGAAAATTCTAGTCGAAGGTTTTGACAGCTATTAGCTTAGTCCTGTTGATAAATATACTATAAAA
      TTTAATATATATACAATACAATTGCATACCATATAAAAGAAACTAAATTTCTTTCAAAGGCCACCAAAAATTTGCCACCA
      TTTGCAATGGAAATGGCTAAAGCAGAGACAAACTCATGAATATCATTAGCAACAGCTTCATTTTGTGAAACCAGTTGTCG
      ACATGATTTTGTTTTCCCTCTTCCGGCTGAGCTCCTTATTATACACTTACCCACAGCCCTCGAGCTGCAATTAAGCGTTT
      GCGGCGTGGCAAGTTTTGGGCAAATTGTTGCCAAAAAAAAAACGAGCTCAAAGCGACCGACAAAGCCACAGCAGACAGCT
      GGCAAAGAGGTTCCCTTTTCCTTTTGGTTTTTGGTCACAACCCACCTCTTCCACCTTTTTTGGCCGACAGGTGTGCGCAT
      TTCATTTGCATAGATTAGCTAGATTAAAGCGAAAGACGAGCGATACAAATCCTGAGTGCTATATTTGGTGGCAAGTCGCC
      ACTTGGCGGCGGCACCGAAAGTTGCGATGCTCGGTCTCAATCCACCGTTTGTGGGTTAATTAAAAAGTTTTTCGAAATAA
      ATTAACATAAATTCTCGTTAGCCGGCAAATCCGCGAAAATGAATTTTCTTCTAATTGACCAACACCTGAGGCTGTGCCGG
      CTTTTATCCTCCCTTCAATCGGCAGCAGCAACAATTGGCCTTTAAGCGCGAGCTTTAAACCACTTTTTTTTTGTCTTTCC
      TGTGAGCGCCAACTTAGCTTGGCCCGCTTTTTTATCTGCCAAATATTGATCGCATTAGTGAAAAGGCAGTGGGTTGGGTG
      GGCGTGGCCGGTTCGTCGGTTCGAGTTGAGCTTTTGCCCATGTGGGTCAAGTAAATCAATTGACAGCTCTTTCCGAACTT
      GAGCGAGGACAAAGGCAATCCATTGGTGTATTTGTGTGCGTTTCGCAGTATGGGTGTGTGCCACCTGGTTGCCTCTATAA
      ATAAATCATGGCTTATGATAATGTGCCGCACAAGCACACACCCCATGTTGATAAGATATAGGCCATCGTACTCAACCACG
      TGGCAGGAGTCGCAACAATAACACAAACAGCCATACAGTCATCGCTACAAAAGTGTGTATATATATTATTAATTTTTACA
      ATTAATGTTTCAACATAAATACGAATTTTAGAAAGTAACTGAATCAATTAGTTAAAGTTTGAGTACTCATACCACTCATA
      TTTACATATTCACAGGTAATAATTAAGCTAATGATACTTTCTACTGTATTCATAGCATGAACCTTCGCCACAATAACAAA
      AACAAACAACATTTGACTTTAGTACAAGGGTTCCATTTGGTTGAGTTTTCCTTAAGCTTTAAGGACTTTTCCTTTTTCTT
      TTCCTGCCCGCCCTTTTCACAGTGTGCGTGTGTGTGTGTGTGTGCAATTCCTTCGTTCACTTAATCATCATAAAACTTGA
      CATATTGTGACGTTACGACCAAGAAAAAAAAAAAAAAAAAAAATTTACCAAATTTTGCCCATATGCGATATGCGACGCTG
      ATGGGATTTGTTTGCTTCGAGCGAAATTGTTTGCGGTCTGTGCGACAGTTTTGTCTGAAGATTAATTGCATTTCGCGCTG
      CAGCAGGTGCGTTTATTGTTGGTATCGCTATTTTTGGCACTTGCATTCACTGCATTTGGCAAATGTGTTTGGTCATTTGG
      ATAATTGCAAATCGAGTCGAAGCGATCAGCTCGAAAGTGCTGCATGTCACAAGTATTTCCAAATGAGAAATGGTTGGAGT
      TTTGTCAACAGGAATACAGGATGCACCAAAAAGAAAAATTTGTATAAACAAAAACAAATTTATTTAAATATTTAAACAAT
      TTTACGAGAATATAACATGAGTCATATAATTTCTTCGTTTGGTTTATGTAGTTTTTATTCAGCATTTAACGGCTGGAATT
      GTTTTCATATTTTTTTTGTTTCACAGTCCATAAAAACATATGCATTTACATATAACGTTTATAGCATCGTGTGCTAATTA
      CTTTTTTAATTTTTTCTTAGCCAAAATGTAAATATATATTGGCAAATAAACCGCGAGCATGAGCAATGGGTAAAACCCCA
      ATGTACTCAACCAAAATCGAAACATTAATAAAATGCCAAATAATGCTCGTCACAAATTCTAAATATTGCTTGGCTGTCAG
      CGATTTCGAATCATAAAAGAACCAACGGAAAACACAAGCTATAAACAAGGGAAAAACAAAACCGAAACAGAAGCAGAATC
      AAAATCACAATCAGAACCAAAACCAAAACAAAGGAACCAACAGAGAAAGGGTCAGGAAACAAAAAAGAATAGATTTAAAC
      GTTGCAATCCCCAAAGCGCCTTGGCTGCCCCATATTTGCCGCCCAATTGCCAACCGCTAGCCACCCACTTTTCACTACCT
      TTTCCCACCCACTTTTCACTACCTTTTCCCAACAGCTTTTCCACCATCCTTGCGCTCCATTGATGGAACATTCAAAACAA
      AGTCAGCAGAGACAGCCGAAGATAAACAAAGCAAAGTCGTAAAGAAAAAATACAAACAATACAAATGGCGCGGCAAGTGG
      AATGAGGGGGGGAGTGAGTGGTTGGGCAGAGCAATGCGCTCGGAAAAGCTAACGGTGACGTGGCTGAGCTTTTCCGTGAC
      GTCACAGTTGAAAGCGCCGAACCAACTGCCACACCGAACCGAGATGCGAACCAAACCAAACTGAACCAAAATCGCTTCAA
      ACACTCGACGGCGCTCGCACGGATCGGATGTGAAAAGCGTTTGGAAAATCGCCCAGCGCTTCACGTATCGTTTCGTTTTC
      AGTTGGAAAACCGCGTTTGAAAATACGCCAACCACAATAACAGAATTAATCAAAACAATATAATATACTCAATATATATA
      TTTATGCAATGTGTGCCTGCGATTCGTACACAAGTTTTGTGGTGGAAAATATTTGAAATCTAAAATATTTGAAAAAGAAA
      AATCGCATGTGCTTGTTTTTCGGTTTCGGATTCACTTCACAGCTGAAATCTATCTAAAAATAACGGAAAACAAGAAAAAA
      GAAAGTGAACAAGTGCACAAAATTATCTCGCTATATATATAAAAAGTGAGCCGCCATCACAATTTTCTTTTTATACCAAT
      TATCGATCAAATACATAAGTAGTGCCATACATTTTCGCTGGACGCTGGAATTAGAATTAGTAACGCGCCGGGATAGTCGA
      AGGTGCCAACAGTCGAAATACAGGTTTGTTTTGATTAATTAAATTGCCTAATTGTAGTGTCGTGACTCAAATAGATAATT
      TATCACAAAAAAGTTGAGAGACCTTTTGGCGTAAGTGTCGTGTGGCCGGGCACTTTTGGCGTTTCCGGCAGCGGTTCGAT
      TTGTTTACTTAATTCCCAGCTCCATTTCCCTTTTTGCCGCTTCCTTTTCGACGCAGGATAATCGGAAAAACCTTAAAGAA
      ACAAAAGCAGAACAGAAAAATCACTCATACGCCGCGTTGGCCTGCACATTAAGTATTCAACGGCAAAAAGTCAGCAGCCT
      CCATCGGTTTATAGTCCTTCCTTTCGAAATGGTTTTCTTTTTGCGAACGAATTCTTTGGGGTGCCATAAAGCATTGCACT
      CGTTGACGAGGGGGGGAAATTGCTAAATAACAATCAATTCGGGCAGTGTAACAAAAGATAAATGGATTTTCGACTGCAAG
      CGGCAATGCAAGAGCCTATAAAATAAATAAAATACAATTTAATCAGAAGTCATGGCAAGGCTGGTGGAATATTCCCGATA
      ATCGAGCTGTAAAAACTCCATTGGGACGGGAAAAGCCCTTAAATGTCGTTGAAATAAATTTACAGAAAAGCCCCAAGGGA
      ATGTGGGTAAAAAAACGAACAATTTGTGGCTAAGTCGCAGCGTAACTACGAATGCAAATGAAAAACTTGATTGAAATGTT
      GTTTAGCTAGCTAATGTTTTCATAATTACATACCCATGTAATTAATTTTCCTACTTTTCAACCGCTTTTGAACTTTTGGT
      TACAGTAATTACATTTTCCTGGAATTATGTGGCATGTTTGTTTTTCATATACATGCAACTTTACTCGTATGCAGTTTCAT
      GTTTCTGCAGCTCATCATTCCGTTCTTTTTTTTTTTTGTTCACTTTAAGCCAAATGTCAATGCACTATATACTTATATAT
      ATATATATATCTTGACAGACAAAAAGAAGGGGCAACATTTTAGTTATTGCCACATAGACTGGACTGCATCAGATAGCATT
      AAATTGCTGGTCACTCGCAATCAGCGAAAACAAGCGAAACTGAATGGAGCAAACAAAGAGCAGTTATTGCGGGCAATCAT
      TAGTGATACAAATCGCCGAAACAATTCCCCGGAGATCTGGAACCTAATCAGGACAGTCCATGACCACAATTCGCAATCGG
      AGGAAACGTAAATGTAGCTGCAGTGCGGCATTTTGATTTCAATTCACTGTTTTTCGAATGTGTGTGCGATTGCTCCTGCT
      CCCGCTCCTGCTCCATCTCGAGCTACTGCACCCAATTGGCCCCCGGCCAATTAAAGCAAAGTGTCTGGCACCATTGGCAC
      GCGACTTCCTGGCCACGCCCCCGGTGCAAAGGATCCGCATGGAATGGAGCCACAAGCACACCCGCATACGAATGAAAGTG
      GAGGCACGGACTGCTTTTATGGCAAATCAAATTAACAACTAATTCCATTAGAGTTTGAGCAAGAGAACAGCCACCACTAA
      TTGCAGTAGGTAGGTAGGCAGGCAGGCAGGCAGGCAGAGGACGCCCATCTGGTCATAGCCAAATTCGTAGCTCTTGGCCG
      AAATGGATTGGCCAGATTGTCCCCCTAGGCCACTGAGGGTAAAAATATTCCAAATTCAATTAAAAGCACTGCACTGCACT
      GACTACAACCATGAAGTTCAGCCACCAGAGCCCAACAGTCTGGGAACAAAGGTAAGTTCCTGAAAGCGTTTTGCACCTGC
      ACCTGGCATCAGGGACATCGGTGGCAAAGGACCGTGCCTCTGCGGCTCTGGGGCTGAATTCGGGTTTCGACCTGGTCGCG
      GCATTGTCCACCGCCTCCACGGCCATCCCGTTATCCGGCTTTATAGCCCAACACCCCCGGCACTTGGCCCCCAAAAATGT
      CGTCGCCCCTGTCATTGCTTTTTGGACTTTTTACGCCCGGAAAAGCAATGAACATGACAGCTTCGTGTTCCTATTGCTGC
      ACTGGCGAGAAAAGGGTTGCCGTAAGTGGAAAATATAATCATTTATTTAACCGCTTACATGGTAAAAAACGCTCCAGTAA
      CAAGTGAGAGAAAAAAAAAGAGTTTAGTCTTGACTAATTGAATGAAATCAAAGTCTGCTCCAAATACCTTAAATAAAATT
      GATACTAATTATTGTCGGCTTTTTAAAGCAAGAGTGATTTAATTATTTTACCATATTTCTCGAGAGCTAACCCCTTTTTT
      TTTGCCGTGCACAACACCCGTTTTACTTCAGCAGAAAAACGTGACTGAGCCCAGAGTGCCAGTGACAATTGGGCAGCAAA
      TTGGAGCAGGAGCCAAGTGGCTGCGATGTCAGTGAAGTGGGTGGCACATTTCCGCTGAATAACTCCTCCTCAGCCAGACA
      CAACTAACAAAAATATTTATGCACACACTTAAAATGCTTCCAGCGACCAAAAGCAACCAACTCCAAACCCTAACTCAAAC
      CCAAACCCAAACCAAAACCGAGCCAAACAAACAAACAGCAAGCAGTTCAAATGCGAATAAATTCCTGGCTAGCTTAACTT
      TTTATTCATTTTCCTATGTATTTCCCTGGCGGCAGCCACTTCCTCCCAATTCCACCCAGCTTGCTTTGATGGACATTGAG
      AACACTTCCAGCAGGATTTGCCCCCCCCCCTTGTTTTTCCCTTTCCTCGGCGAACATAATTGCAACTGTCTGGGTCAGCA
      GTGTCCATGCAAAGTGAATGGCATAAAGAGTTGGAAAATCTGATAGTTGCTAAAAGAAAAAGGAGGCGCCATTGATTCCA
      GTCAAATAGTTTCGAATGGAATCACTGGAGTAGAAGAATAATTCTGTGTCAGCCAAGAGGTTGGTTAATTTGAGCATAAT
      CTGCGAAGTTAGCAGAGATTAGCTAAATTCCATAACCTCTTTGTTACTACATACGGATTTCATTTAACTCACATAGCGCA
      GCCAAATATTTCCTCTCAATTATTCACTTCCAAAGGCATTTTTCAGTTGGCTTAGCAGAGCTAACAAAAGAAATTCCTCG
      AATGGCCGTAATAAAATCGAACAAAGACCATGTGAAATCAAATGCTAACCAATTCGGGCGCTTCGGGTGAGGAAAAAAAG
      GAAAATCGCAAACTTCCTCGTTCTATTTCCGTGCCCAAATTGCCGCTCAACAGATGCCAAAGGACATTTCCCCGATAGTT
      AATTATGACACACACTTCAAAGTGCCGCAATTATCCTGTCGCAAACTAAATGAAGTGAATTTTTGTGTAAACATCTGCGC
      CGGCGGCCAGACTCTTGGCTTGATTTGAATCTAAATTGAGAATAACAAGCCATCGTGTAAGACCCCCAATGAATGCCACT
      TGAAGTAAACAGCGGGCGGCAGCCAAAGGTGGAATAAACGGAATAAACACACACACACACACCAGACACACACAACGCAC
      ACACACACACCCACACCCACATGTGTGTCATAATCACCGTGAAAGACGTCGAGTTTAAACCAAACAGACAGAGCGTTTTG
      AGGGGAACTGCGGAAAATGGCGGTGGAAATCTGGCGAAGAAGACGGCACATTAGGCGGCATAATCTGCCCTTGAGCTCCA
      TTTTGCCCAACGATTTGGAAAATCTTTGTAGCAAAGTAAATTCTCGAGCAGATTTCGCTCATTCCCGCCGCCGTTCGCCT
      TTTTTCCGGCCAGCAATCCCTGTTTATATTCGGGCTCCATCTCATCGATTTATCGAACATTAAGCACGAAATCAAAGGAA
      ACACTTGCGTGAAATAAACATAAACTAATGTCAAGCTGTTCGAAAATCTTTGGTCAACTGAAAAGAAATAAAAGTCGACT
      GGCTGAAAATCTTTGGTCAACTGAAAACAAATAAAAGTCGACTGGCTGACGGAATTTCATAATGATTTCGAAATATTTCG
      CTTCTTTTGCTTGAATTTTTTGAATCATAAAAATTCTTCGCACGCTTAGTCCACACTGTCACATTCAAATGCTGGATAAT
      TTATTTAATCATTCAAATTTGTTTTCATCCCAGCTGAGAGCAGAAAGAGCAAATGAAATAGCTCGCTGCTAATAACATGC
      TGTCCCATTAGAGCTAAAACGACCAACGACAACGTGGCGTATGCGCAATAAAAACTTTTTGTTTTTATTTAGCTCATTTG
      CGTTGACAAGCTGCCAGCGAAAAATGTTAATAGTGAGCTAGCTATATATGCTCAAGCTTGGCCCAAGATCTCAGCCAGAA
      AGTGCTGCCACTAGCTTTGGATTAATGTCGCCAATCAGCGGCCAGAAATAATAGGAAGAGAATCCTACTCCTGATCCCAC
      CACCCTTCCTTTGGGACAAGCAGCCGGCGCTTTGTGACCCATTGAAATTAATTTTGCAGCAACAGGTGCTGGCCATGAGC
      ATAAACAAATACCCCTGTTGCAAGATGGGGCTCAAAGGGAAACATTAAACAAACGCTGCGAACATCCACTGACAACGACA
      CGAGCTGCACTGCCACACGGATAACAACATGGACATCGGACAAGGACGTGGATGTGGATGTGGACATGTTGAAGGAAGCC
      GCTGGCACGCCAAACAAACTCGCACACAAAGGAGGCGTGGCTCAAGGTCATATGCTGGACAAGATGAAATCGAGCGTTTC
      CTGGCGGATAAAAAAATGTACGCATTAGTTGGCTAATAGGCAACTGCATTCTATACGAACTTTAATGTGCTTTAAAGGGG
      AATATTTCCTGAATCAGCACAAATAATCACGTTAGCTGCACATCTATGTCGATTGTGGATTTATAAAACATACTAAGCTG
      AACATACTAAATTTTAAATCAATTTATTCTCGACCGCAATCAACTTTCATTTAAATCAAATCAAATTTGCAGTTTCAGCT
      AAATGCTTGTGATGGTTTCACCTTTGTTTTAGGCAGATGAATTGCCAACCTTGAACCACCTACTTTCCAGGCTAAAAAAA
      CAGAACCCTACCCCTTTCCGCGCCATATAATCCTTATCTGTTGACACTTTATCGGGGATTTTATTTTTTGTTGTTATTTT
      TTTGTAGGGTTTATATTGGTAGGCCGAAGCAACCATTTTTTGGGCTTATTTCTGTGATAGCCTACGTTGCCTGGAACCGA
      GCACAGCTGTCATCATTTGGGTGGCCTGATTAGCCGGGCGCAGAAAACGCTGAAGCGAAAATATTCATGTTAATAACTAG
      CAACAGGCCAACCGATAAGAGTGGGAGCGAAATTTTGGCCACATCATATCGGGCCATAAAGGCAAATGACCACCAAACGC
      ACCACTAATATGGCCCGAAAATGCTGGCCAAAGTCTGTGAGCATAAAAATGAAATGAAAATGAATAGTGAAGCTTTAAAG
      TTCTGGCATGGTGACACCATACTCCTACTCTTCCTACGGCCAATTAGAAGGAATCACACACACACACGCGCAATGCTGTT
      GTTAGCCAGAAATGCCAGCGGCATCAATTGAATGCAAACGAGGCAAGCAGCCTTCCAGTTCCATTTGCTGACAAAGGATC
      CCCGGCGAAGATGAAGACGAGGAGGAGGAGTAAGACAACTTCATCGTCATGTGGCCTGGAGTTTCATGCACGACTGGATG
      GGTCAGCAGCTGAAATCATCATCGGCGTACCCATTTCGCTTTCCCTTTTTTAGTGTGTCCTGCGTAATGCATCGCTGGAT
      TCTCACAGCACAGAAACTGTTCGCAACCCTTTAAAGCTGCTTAAGTCAAAATGCTGGGGTGGTTTTGGCCGCTTTCTTGT
      TGCTTTTGGCCCAGGTATACATAAAAATAAAAAAAAAAACGCTTTAATATGCAATATAAAATGCACTTTCACTTACACAT
      AACATACACTTTTAGTTTCTTGGGAAGTCGAATGAATTTACATTTACATTTGGCCATTTTTAAGGCACCCCTTTTAGCTA
      CCTTTTTCTCTCAGTGCCGCTGACTCTTTATCTCAAGCTGTTCTCGCATAAGCCGTCGCGTTAAAGACGTTTTCAAGTTT
      TTGTATTTATTCTGCTTCCTTTTTCCCCCGAGTCCTTTGCATTATTTACTGGCTAGGAACTTGGCCCGAATCTTTTACTC
      TTCGAAGCGCGAAAAAAAGCGTGGCTCGTTTTTTAATTATTTATGTTTAATCATTCGCACAAGTTGATTACCAAGCAGCA
      GGACCTTAAAGTCCTCGAATGAATGCGGCCAAAACTGCAAGTTCATCAAGTTCGCTACAATGTGCGAAAAGTGTCCTGGA
      TGCACTTAAGTGCAAGTGCGGATGAAAAGATAGCGAAAGCGTAATTCGATTTGTGGAATGGAGGAGAATGGAGGAGGACA
      GCCAAATGGATGGATGGAATTGGATGGAATAGGATGCCCCGGGTCGAGTGGCTAATGATGCATGTCTAAGGAGCGAACAG
      GATGCCTAAATGGATTACAAATATGTTTTGATTGGCCCGCCGGCTGCCTTCGCAACCTCATCCGCATCCGCATCCGCAGC
      CGCCACTCCAAAGCCCATCTCATCGGTCGGTGGAAAATTCAATTTGAGTTTCCCTGCCTTTGGGCTAGTTGAGAAATGGA
      TTTAATTTCGCCTCGGGAAATCTGCCCTTGCAAATGGCAATTAGTGTCTATTAGAATTCGCAGTCTGCAGTTTACGTTTC
      TCATTTAAGTTAGGCGAACTCTTTAAAGACCATTTTCCACACCGTGCCACTCGAAACTTTCCACATTTTCCAGCATTTTA
      TTTACATTTCAATTGTGAAATGCTTTTTTTTTGTCTATAGGAAACCATACGAAAGAGTTCGACATGTGGATGATGTGATG
      CAAGGGTTAGCAACTGTAGCCAATATGAAGAGTTTATTTTTGGACCAATGGGGATTACGTGATAAACGGACAAGATCAAG
      TGAAGCCAAACAACGATTTGTTATGAAATCAATGGAAAGAAATCTCGGCAAAATTCTGGGAATCATTCATCAAGAGGTTT
      AGCAATAAATGTAGTCCATACAAAATGGAAAGTAAGCTATGGCTTAGAAACAAATATTTGGCATAAGAAAGTTGTTTCTA
      TAAAGTTAGATTTAAATGATACAAAGTAATTGTTTTGAAAAGGTAGCGAGGAGGCTGCTGACACACAGATTAAACTAAGT
      GAAATAAAAACTTTGACATATAAAAACGAAAAGTTAACCAACTAACCCGGTATCAATGAACCAGAATCAGAATGGATAAC
      CCCAATCGCTTGCATAACCAACGCACAGTAACAGTCATCTAAGCCTTTATATAACTCCGATGGAAACCACAATTCCCAAA
      GGCTTTGGCCCCTTCGTATAAATTTCAAATTTGTTTGTAGCAATTTGTCGTTTTTGGGGTGTCCACTGAAAATGCGAATG
      GGCTTTGGCCAACTACCGAAGCTGACCCAGTTTTCAAGAGACGCGTGAGGCACGTTTAAAAATAAATCGAATGGGGAAAG
      GGGGGAATGAACAGAATGGTGGTAGAGGGGTGGGGGATTGGAAAAACAAACAGAGGAATTTTATGTTTAATGGCTGCGGG
      GCGAAATGAAAAATCACACAGCAAATTATGTTGCATGTTGTTACACATAGCATTTTGTAGAACGCAGATGAAATTCGCTT
      TTCGTAGCTCACTTTTGCTTTTCGAAAATATATATACACAGTATTTCTTTGGGTTATTTCTGTGTCACGTCACGACCGAA
      GCAAATATTCGAGATAAAGTGTAATTTTATTTAAAAAAAAAAAAACCAATTCATTTAAATGTTTTGTGCATTCGTTTCAT
      TTGCTTGTCACGGTTTATTTGCAGAGTGCACCATAAAACAAACTAAAGTCACACACCATACCAAAACTCAGATTATGAAT
      TATGCAACCAAGCATCCACAGCAGCAAAATAGAGCAACTAGAGCCACAGCACGAACTGCTTAATGCACACAAGTAGCAAA
      TCCTAGAGCAACTTGACCGAACTCGTTACGGAAAATTGCCGGCGAAGACCACAGACCACACACCGGACACAAACGGAAAT
      TTCCCAGGAGTTGGACCAAACGAGATCAAGAGAAGTCGCCATGGTGGACGACATCTCACCGATGCATCATCGGATGCAAA
      AGAAGACGCGCAGCGCCTCCATTTGTGCCACCGGCGCCAGCATCGAGACGGTCATCCATGGAATGCCCGGCGCCTCCGGC
      AGTGCCACGCCCGAGGGCGGTACTCCCGGGTACCGGCGACGCCGACCGGCCACGCGCTCCCAGAGCGCCCGCATCACCTC
      CGGCGCCAGATCGGTGAGTACGCGGGGCGTATACGTAATGCGCTTGGAACGCATCCAAGCGGTACAGATTTTTAGCATTA
      GCATTTGCATCTGCCCGTCACTCTGGCAAAAGTTGCTTATTTATTTATAGCTTTAGATAAATGCACGTTTGCTTACTATA
      AATACGTCGTCTTTTAGCCCATTTGGTAGTCACGCACATGCAGATTGACATTTCAACAATATTATAATGTGTTTTTTAAT
      TCCCAAAAGGACCATTTGATTCGCAAATATAATTGATTGATTTTATGAAATGGCACTTAGAGCATCAATAAAAATATTAC
      TCTGAATTGAATTTATTATATTTGTTTGTTAGCTTTGCAGTTTACAGATTATAATGTTCAATCACGAATCACATTTTTAA
      TTTTAAAGCCAACTTGAAAAAACTTCAATGGGTTCGTCTGACAACAAATTTTGAAGTGTCTCACTTGATTGAAGTGAAAA
      CTTAAGCTCACTTTTAATCGAGTGTGCTCAGCTGAAAGTATCTCCGAATTGAGGTGCATAATCACTTTGAAGTTTACTTG
      GTAAACAACTCCCATTTGCGTGCCACAAATATTGAAGGGATTGAGTTAACTGGGTATAACTACATTTCCGCCGGCATTTC
      CGAGAAACGGAGAACGCAATCACGTGCACTTGGCCCAATTAATTGATCGATTACAATCCGAGTTGACCTCATTGGTTGGT
      GGCGTCGTGCCTTTTTTCGGGGGAAATGCTAAGGGCGCACATCAGCTGATCCCTTAGGGTGCGTTCATGTTGCTGATTGG
      ATACGGATACGGCTTCTTCCACGACAGAAGCCTCCCGACTTAGACTCCTGGTCGTCCTCGCGCTGCCAATGGACATTTTC
      CGTTCCACTGAGCCGCTTTCCCGCTTCGCAGTCTGTGCCTCGTTTTGGGCCATTCTCTCAAACCGCCTGGCACATCGCTT
      CTTCTTGGCATGACTGAGATATGCGTCGGACTGATCCTTGATCTTCTGATGGTGTTCGTACGGCGGACACATCGGTGGCG
      GCCGCATGCATTTGCAGAAGCTTATGTTGTGCAGAAAGTATTCGGCAAAGTCCTCGTTGGGCTCCAATAGCTTCATGTAG
      CACTCCATTCGGTACAGATCCAAGGGATCCAACAGACGCGCCGCGCAATCCAGCTGAAGGTGTCCACTGTAGAAGTAGGC
      GAACAGCTCCTCCACCAGGTCGATAAAGAACTGAATGGGCTTGTGGAAGGCATCGCCCAGAATGAAGGGGCTCTCCTCGC
      TCCTATTCAACTTGGCACATTCACGGCGAAAGACAAGCACATACGGACGCAGGCTTTGGATGGCCCAACACTGATTCTTG
      TTTGAACTGGCTATCACCTGATAGTGGATGTAGAACTTGTTGATGATCGCATCATCCGATTCGATATCATAGATCTGCGG
      ACATGTGCAGCTGGTGTCCAGCTGCATGGTGATCTTGTAGCGCTGGATTAGCTGGTGCAGTGTTTCTGCCGCTATCCTCT
      GGAGCTCTAGCTCCTTCCTATAGCTGTCAAAGTAACTCCGATACTTCTCCTCGATCACCAGCAGAATTTTGATCACTCTC
      TTTTCTACAGCATCGGAACTTCTAAGATTTCCAATCGCAAAATTGGCCATGCTCGCGGTCACCGTGCCTCTCGACATAAA
      GCTCTGGCTCACCATCATTTGGTACAGCCGATCGCGCATTTCCATTTTCGGTTGTGTGTGTTTTAGTGTATTTCCCTGCA
      AAAACAAGGACAACTTCTGATGAATGACATTTAAGTCGACGATGATGGATACCCCTATACCAGATGATGAATCCTAACAA
      ACTGGAAATCAGTAGGCAATTTATTAAATTCTATACACCTCATATAAAATAAACGTAACTGCTTACAAAATTTAAAAACT
      TATCATACTTTCAGAGAATTTGTGGGTTCACCGACCATCTGATTACTGAATCCTTTACAGTTAGCTCGTGTCGGTTGTCG
      GGCAGAGGAGTATGGTAATCTTCCTTAGTAATACTTATTATAGACCTCTCACTGCGACGTTGGTGTCTAGAGATCCTCTT
      CAGTTCCCTTTCGTTGTCCTGGTCTAATTCCTGACCGGTGCTTATGCCAGACATCTCACTGGGACGTTGGAGTCTAACTA
      TGGACTTCTTTCGATCCAGTAAATTGCTCTCGGCCTCGGCCATCTTTTCGCATCGCCTGGCACACCGCTTCTTCTTGGCC
      TGATTGACAAAGGTGGCGTTAAAGTCCTCTTTCACCTGCGGATACTCGTGGGCAGGACAACGGCGCGGCATACGCAGGCA
      CTTGCAGAAGCTCATGTTGTACTTGAAGTAATTTGCGAAATCCTCATTGGGTTCCAATAGCTTCTGATAGTACTCGATGC
      TGTTCAAGTCCAAGGGATCCAACATGTGGGCAGCGCAGTCGAACTGTACGTGTCCACTGTAGAAGTAGGCGAAGAGCTCC
      TCCACCAAGTCGATGAAGAACTTGATTGGCTTGTGGAAAGCGTCACCCATGATGAAGGGACTATCCTCGTTCAGATTCAA
      CTTGGCGCACTCTCGACGAAAGAGGAGAACATAGGGGCGCATGTTGTGGATGACCCAACCCTGGTTATTGTTGGAACAGG
      CTATCACCTGGTAGTAGATGTAGTATTTGTTAATGATCGCATCATCCGATTCGATCTCATAGATCTGCGGACACGTGCAG
      CTCGTGTCCACCTTCGTGTTGATCCTGTAACGTTGGGTCAGCTGATTCAAGGTCAGTGCCGCCATCTTCTGCAGTTCCAG
      CTCCTTCTTGAGATCCTCAAAGTAACTGCAGAACATCTCTTCGATGGCCACCAGAATCTTGGTCACCGAGCTCTCCAAAC
      CTTCGTTGCAATCCAGATTCAAGATCGCAAACTCGGCATCACTCTCGGTGACCGTGACGTGCGACATGACGCTCTGTTGG
      GGTTTCAATTGCTGCAGCTGAGCGGTTGTTTCCATGATTAACTAGTGTGTATATATATACCTCCTTCTCTAATAACGACG
      AACCCGTCCGACTTATTCGACAATCTCAACTGAATCTTGACTGAAAAGGAAAGGCCTATTTTAGGAAGCTGGATTTATTT
      GTATTTACCATCACCGCAACTGAAATAATACAGAGAAAAACTGAAGTCGCTGACGTTTCCAATTCAATTGATTCCGTCAG
      CCAGCCGTCCGAGGAGCCTTGAATTCGGAGGAGCACTTGCAGTGCGGCGTGTGAATTGAGTTATATCGTGGCGAAATTCA
      ATTTCATCGGACTGATGTGATGGTTGTCTCGCACAAAAGACTTTCGCCACGTGGCGGCATACGCTGCGTATGAGTTTTCC
      TGGCTGGTTTGGTGAGGGGGGGGGGGGTGTAGCTTCCAGTTCGCAGCTTCTGGTGCTGAATATCCCTCGCTGGTGAATCC
      CCTGCTTTTCTGCTTCTGCTCGCGACATTATTAGTAAGCAAACGAGGCAACAAAAAGCAGCCGTACAACCATGCAACGTG
      CTAAAAATGTCGTTCTCATCGCCTGAGATGCGCCCCGAGCTGGTAATTTATATAGAAAAAGTTTCCAAGACACACGCACA
      CACACACATATGGTTTCCCGCTTTTTGGGGGCGGCATGTTCTGGCTGGGCGTGGCCGTAATGAGTTCGCAGCTAAGCAAG
      TGAGAAGTAAGTGCTTGGTGCTACCGACTATTGAATACCTGGTTTCTAAAAATCATTGCCTACATTTTGGCGTATGATTG
      CACATATACATAACTCCTCTCTAAACGAAATAGATTTCAAATTTTGTTAAAAAACTATATGCTTAAAATAGTAAGTACTA
      CAAACACGTACTGGTTTTGCCAAGCAAGTTAGTAAAGGGTATTAAAAACGAGTTAGGAATGCTTTAACGACTTTTGTTAT
      AAGGAAGCGGGGAGTAAGGATACAATCGGCAAGCAGCAAGGAAGTAAACTTGAAGTGCTCAGTGCCTTGATGTTCCAATG
      TCGATAAGTCGCTAGCACTTTTCATCTGCAGACGCAAAAGTTTAATGAGAAGATGCCACAACAGCAGCCAACACGATGAA
      GTCGCATTGTAATGCTATTTTCGTTTTGCACGGCATTCTGTGGCCCAAAGTCAGATATATCCCATGCAAATACTAGACAA
      AAACCAACAAATAGCCAAACCAAATAAATAAGACAGCCATGAATGGGGAAATATTTTGCGACTTTCGACACAAAAGTTCA
      TCGGAGGCAAGGAAATTGCAGCCTTGTGTGCAATCAAAACTTTAAGCAGTGACACAATAAATTTGCAAGAAAAATATAGG
      ATGTATGTACATTTTACAAAACTAAATAAATGAAAAATATTGATATATTTGGTAAGATATCACTAAATTTAAAGACGCCA
      ACCTTACGAATAACTCATATGTCTTATCAATTTAAAAGTCAAATAGTATGTGTCTGGGAAATGTGAAATTAATTTCGAAT
      TTTAATTTAATCCCCCGACGCCCGTAAAACGGGGCGCATTAAGAAAATAAATTATGTGCGCTGCCCCAGAGGACTAATTG
      GGGATTAAGCGGGTACAAATTGAAGACTCCGCCGCAGGACATGCCGCGGAGCACCATGGCATGGTCAATGAACTGGGAAG
      CCAGGAAGCAATTAATTTCTGAAGCGAGAAGCATCGACCATCTGACCACTGCATCCGGATGGATCAGATGTGGGTGTCCG
      TCCGTATGGTCGTAATATTTGATTAAGCCGGCAAAGTAGACCATGCAAACATTTGTCGAAAAAAGAAGAGCAATTACTGG
      TCACGAGAGCCCATGAAATGCCAGGATAAATGCGTACATACGTATACAGTCCGGTTCGTAGTTATATGTCTAAACTCGTA
      TGTGTGTGTGTGTGCGCCATAAAAAGCGCAAAAGAGCGGCCACTAAATAAACAAGGAACGTTTACACTGACAGCTCGCCT
      AATGACCGCCGCCCCGCCCCCTTGGCCACACTTCCTGCGGATTTGGCGGCTTTGCCGGTCCCTCCAACTGACCAGAAACT
      CAACGTGGCCCAAATCCCTGGCCACTTGACAGCCGACGCCACGTAGCAAGCGCTTCCGGCGTGCCGTTTTCCAGCGATGA
      GAAAACCTTGTGCGGGAACAGTGGCGGAATCAGCGTGGCTTTCAGGGGATTAAGGTTCCCGATCAGCAACAAATTCAGGC
      CAAAAACCTTTACGGTCATAACTCAATCAAACATATAGTAGATTTTTTTAAAGCAAACTGGTTTCATTTATTTTAAAGAT
      GTTCCATGTAGAAGGCCTAATTTTAAACATAATTTTAAATTTAATTAAGAAATCGTATCAAAGGCTTAAAGCCATAAGTT
      GAATACCTATACGTATATATAACATACTCCCCGCAAAACCAAACCCATTAATTAGAATCAAGGACATAAGCGGCACAACT
      TAATAACTTCGAACTGCCAACTAATTGGTCCCCAACACCCAAATCATATTGTTCGCCCTCGCCCCTGTTTTTTTTTGTTT
      TTTTTTTTTTGGATTTTTGGGCCAAGGAAAACGGAAGTGGCTAACAAAGTTGGACGTTTTGCATGCGGCTATGGCCACAG
      CTATAAATATATATCGCCCTCACACTGGACCAAAGAAACTGAACAAGAAGCTTACATTGCCGGAACAGTGGTGAAATTAG
      TTTTCGCCCCGTCGTCAGCTAGCAGTCAGGCAGGCAGCCAGCCAGGCTTCCAATGGAGCACCGCAGAGCTGAGGCGGCTT
      GACAGGCACTTGGACGTGGCATGAAGGATTTGGAACAGGGACACGTCCTCCTGCTCCAACCTACCCGCCAATGCCTGAGC
      AGGAAACTTTTGCGGCGGGCGAAACAAGCATTGGCGCTGATTGCATTTGGAGTGGCCGAGGCGTTTAACCTTGACATTTA
      GGTGGATATCCCTACTCTAGTTCCCCTCAAAGAGGATCGCGCAGGAGCCCTTCTAGCGAGGACCAGGGCCAGGACAAGCC
      GATAAATTATGCCATTGACGGTGGCCAAGTGAGATGGGCGTCTGGGGCGTCTGTTACGCCAAAGGACAAACAAATGCAAT
      TTGATTTGTGTGAGAAATGCAATTTAATTTCTCAGTCAATCGGCAAGGGCAGTCCATAAATCACAGCGATTGCCTTGGGC
      CGCGTTTGATAGATAGCTATACATAGCTATACATAGTTGCCCGCTCTAAAGACACGCCTCCTCCTCCTTTCCACTTGCAG
      GTCCGCCAGAAGACCAAGGCGCAGCAGCAGCAGCAGCAACAGCAGCACACGCTCCAGGAGACCCGGAGCTACTGCACCAG
      TGAGCCCCGGCTGAGCGAGACGGAGACGCCTCCGCAGCGCCGCAAGCTATCGCAGCGGAGGCCACAGACGCACGGTGAGT
      AAATTACGCCCGGAGATGAGCATCTACAATTGCGGTGAATTAAATAGATACCAAGTGAATGCCAAAGAAATGAAAATGCA
      GTTGATGCTAAGCTGGTAAACTATAACATTGCAGTTCATAGGATTACCTGGTAACTTTGTAGATAAGAAGCTTAGCTTGG
      TTCACTGAAATGTAGTAGTAGTAGTAGTATAAAACAAACCTCAAAAAGATTTAAAAAGTTTGATAGTTATGCTCCTTTAG
      CACTTTTTCATCCTCTTATTACTTCCTCAAATTACTTACTTAGGATATTCAAGCTACTATTATGCCTTAAAACCAAAAAT
      GACAAGCACTTAGTTGTTAGCTTGAATTTAAAACTAAAATGTATCACTCTACTCGCCCAAGCTTTTAAACCACTTCCATT
      AGTAGCAGCACAGTTCACTAGAATTTCGACCACACTTGTACATAAGTTAGTTAAAGTTGTGGCTTTTAATGGCCGGATGG
      AGCCATCAAAGCGGCGAAACAACGGCAACAAATTAGCCAAGTGCTAAGCCTGATCTTTTATGTGGCATAAACTAAGCTCT
      CAGCCAAATTGCTCGCAGCACGAGAGCGGCGGCAATGTAAAATTGACCATTAGGTCCTGGTGTGCAAAAGGAGCATGGAG
      CATCCTGCAGCAGTGCAGGTCCTTAAGGCGAGGTGTTGAAGCTGAAACAGAGCATATGGTTGTTTCATTCGTCCCTTTGT
      TAAGTACCTTTCACTAATGTTGATTCAATTAACGTGGGCGTTCGATGAACTTAACCATTGACCCAGTTTACCCGGGCAGC
      AAGTGAGCTACATACGTGTGTGGCACTTCTCACTGTCAACTCGACATGGGGAAACGGAAACCATTAAAGCTGTCCAAATG
      TCAGCCAGCTGGAGCAGGGAATACTGAATCAATAATGCAGCACGTTTAACCGAAGGGTTTCTCGCATATTTATCTACGTT
      CGGGTTTTTGCGTGCCAATGTTTATTCATATATTCAAATTCTTTTTACTCGTAGAGTTAAAAGGGTATACTAGACTTGGT
      CAAAAGTATCTAACAGGTAAAAGGTAGCTTTTCCGCTGTTTTCGCAGCTTTTCAATTAAAAGTGCATTTATCATCATCAT
      AAGAATCAAGTTTCATTTATCAGTATATTTGAGTTTAAAGTTTAAAGCATCTGTAAATTATTCAAACTAGGCAGCTTAGC
      CTAATGGTTGAACCTAATCCCTAATGCAATCCACATTAATCTCTTTCAGCACACAGAAAATCAAACGCCTTCCTGGACGT
      GCCCACCATGAACATGCATCACCTGCGCGTCAACGACGACGACGAGGATGTGGACAGATTGCGCACTTTCAGCGCCTCCA
      AGGGAGGTGAGTTGACCCGAGTGGCGCAACAAAGACCACTGAGGAGCATTTATTAATTTCGAAATTGAAAGTCAACAAAG
      CCCGAGGGCCAGATGACTGGGATTACACATCTTAACAATGCGGCCATGGGTTTGGAGGCCAACAGGGAGCCAGGGAGTCC
      TGGGACCTGGGAACACGCACATCATCTTGGGGACACACGATACACGAGACGGCATAAAATTATAGTTTCGTTCCGGGACA
      CGCAGCGCAGCAATCCTTATTGAAATCTTAAAAGGCTGTTACCCGAAGATGTTAAGGAGATATCAGTGGCACTAAATGCC
      ACTCAGCATAGAATATGAATACCCAGACCAAAAAACACATATGCATATGTACATATGCACACACACACTCACATAGCCAC
      ATAGTCCTGCGAACTTTTGCCATTACATATGTGTGTGTTTGTTTTTTTCCTCCCTTTATATTCTACATTTGTGTCACGTT
      ATTGTTACACATACGCACTGTGTGCCATCGCAACCCACTTACAGTGCGATTCGGAACTGTAAGGCACTTGGTTGAAAGTT
      TGAAGATGATATCTCGTTGAGAAAGTTTGCAACAATTTCAAGTGTCTTAAATTCAATTAAGATCGATTAGCAAGCTAAAC
      TGCTTGGCTCAGGTGAATTGGGGATTATTAGCGCATTAAAGTGTCTTTTAGTTCAGTGATTCTATAAAATAACTGATTGA
      TTAAGCCTGAAGAAACAAATCAGGTTTTGACTAACAATTGCTACTTTTGCAAGAGTGATTTCAAAATCCCTTTACTTCTC
      TGTGGTTACATAGATAGGTGGTGAGCATTATAGTTGCTATCTTTAGCCGCTCCCGCAAGCGTTTTGCATCCATAAATGCA
      CGTCAGACTTAAAGTACGTGTTTAAGCTGAATACGGAATACGGAATACGGATAACGGAGAACGGAGTACGGAACACTTGA
      GCAGACATGACAGGAAACAGACGACAAGCCTGCGTACTAACAGCACACGAGGTGTCATAACTTAGTCATGACGGAGGAGC
      CGGAACCATTTGACAGACGCAAAATAAGTAGATATATGGAATGGAACATAGCTGCGAATAGATGTGAATGAAAAACACAA
      GTTTTAAAGTTTTTCCACACGTTTTTTTTCTATAATCCCTCTTTTCCCATTTTATTCTGACAGTTAACTACGTTTAAAAA
      AGTATTTCTTTGAATAAACATGTTTCCTTTGCATATCAACCCCGCACATCCTTTTTTAAAAATTCATGCAACATCAAAGG
      GTATTAAAAGTTCACCCCAAGTCGCTTGTTAACTTCTTCTTATTGCGGCTGAGCAGCGTCCCCAAATGCAATGCATATTA
      AAATTCAATGAAGTGTCTGTGTTTGCTCAACTAAATTGCTTTCAAATACAAGTGAAAAACCTTGTAGTTGGTTGTTGTTG
      TGGCCAAGAGGTGGCAGCTTTGCTTTGCGGTTATTTCTTGCCAGGAGTCATGTGCGTTCATTTAATTAATTTCAATTCGC
      TCAAGATGTTTGGCCGATCGTCTGGGCATACTCATCCCGGCAAAAAGGGAACTGTGGCCATCCATCAAATATGCACGTTT
      ACGGTCGGCACGAGTGGGAAATTTAAAATGAGCCGCCGGAAAACTGACAGGCCGACATTCGAATCGAATATGCTTGGAGT
      GGGTGGCTTTGGATGGAATGGCTGGTTTGGTTGGTGTGTGATGATTAATTGAAATGCCCAGTGCCGAGTGTCAGTCATCG
      ATGGCAGCCACTAAAGAGGACTGAATGAATTTTCCATACAAATACATCTCCAAACAAGAGCCGACAATTGTCCTGTGGGC
      CAGGATCGTACTGTAATTGAATGAAGTTGAGCGAGTGCTGGATATGTATTTGCATTTCTGCCTGATTTTTACCAGCAATT
      GGCAATTTTCGGCCAATTGCCAAACATTCGATTGTTGTGTACAGCAGTGGGTGTATTTTCGCATAAACAAAACGCGTCTG
      ACCTTGAAGTCGGTTAATCATATCTCAAAAGTGGCAGCATATGCGAAATCTCGTGCCACACTCGCCCCACTGTAAATCAA
      TCAGCAAATAAAATGTTCGATTTATTTTCCCAAATAGTTATGCCCACCGAGCAAACAAACAGATGAGTATGCTCCGTGGA
      AAATGAAAAGTACCGAACCAACATCAAAGACAAGTGAAACGAAAACGTTTTGTTTGAGGAATGGCCAACGGAAAATTGGG
      GGAAAAAAAAAGTGCTGCAATTACTCCAGAGATTAGTCAGTTTTAATTATAGCCAATGGCTAAGAATAAATATGAACATT
      GCATATACATACACATGTAGCAATATGATGTGAGAAATTTCACGAAACTAAATCGCAATTTTTATGGCCGCCCGTTTGCA
      CCTATTCCAAAATGAATTGTTTCCCACACGCGCAGCCTCGCAATTCCCGATGGCCAAGAAAAAAAAAAAGAAAAGAAATT
      GGTAATATGGCCACCCAAAATGGTTTTATGGCTTTCCAATGATGACGGCCCATGCCTGTGTGCACAAAAACGAAAAGAAA
      AAAATAAAAAAAAAAAGGGGGAACCCTACCCCCCATCTGTGCTCGAATCTAAATGTTTAGAACGCTTTTGGCAATTAAAT
      CAATTTGCACAATTAATGACCGCAGATGAGGAGCCAGCAAATGCCAACGAATACTGAAAAATCTGCGATGTACATTCATA
      CATATAGACGCGTCGATTTCGCGCGACGACTAAATGCAATAAGGCTGGCAATAAATCTATTTATGACATTTCAAACGTAC
      ACAGCATACGCTTGCAGCGACTGAACAAGTTGTACAGTGTCGGACATGTATATATACATTCAGAATGATTACAGATACAT
      ATGTATGTGTACATACATCCATCGGCCTGAGGGATTACAAATGACAATGGCCGCGACTTGAGCTCAAAGGCTCTTGACTC
      GGCATCTTCGTTGGGTAATACCATTTTCGGTCGGGCATTATCCCTATGTGGGGCAGCTGGGGCGTTGGAAGGGTAACATC
      CGAACAGATGTGCGGATTATATCTAGATATAGTCGGCGTTTGTTTGGTCAATCGACTTGTTATGCCCTCGGCTGTGTTAT
      TAAATTATGTGTGCGGTTTTTCGCCGCAGCTAAGCAGCACGAATAGTCGAACTGCATTCAATAAATGTATCTAAATAATT
      TGATTTCGTATATTTCTTTGTTTTCTATCAATAAATTGAAAACATAATCCATGTGACTAGGCAAAAAATGTACTTAAATT
      CATAGGCACATTGTTCGATTTCCGGAACAAGGCAATGGGTTAAAATAACCATTACGCCTTGTCCCACATCATTTTCGATG
      TCTTTTTAATTGTTTTATTTTTATTTAAGAGCACATTAAATGGCTCAGAATGCTGCCATTAATATTCATTGTATATGCAA
      ATTATATTGTAAATATTTGGCATTTATATGGTGCAAAAATGCAGGAAACATCGTTTAAATTTTTGACCGCAATATGAGTT
      TTTCTAACTGCTGGCAGGAAAACCCAGACAGACAGGTCAGCGGGAGGGGGGAGGACAAGGCGGGTTGGACTGTTTCGGCA
      CGAATGAAACACAAAAGGCAGATTAACTATTGTTGATGTTGCCCTTGCGGCAGGAAGCTGTAATTTCTGCCGCGGCTACG
      TGGCGTATGCGCAACGAGTCGCGAAGTCAGCGCACGTTGCACATACGCCGCGTATGACAGGTAGACTAACAAAAGTTTCC
      CTCGTGCACTGGGAATACGAAATAGGTGACGTTTTTCTCCTTTTTTTTTGTTAGCAAACTCACCGAGTTTTTGACAACTC
      TATTCACTGTTTTCCGTTCGCTACAGGTATCATCAATCGAGGTGACTCCTTCCGTCGCCGGCGCTCGAGGAGCAACAGCC
      TGGCTCCATCCAGTCCCATGCACACACGCAATGGTGTGGGCGGCCTGGGTGGCGTGGCCGGGGGCGGAAGCAGCCTGGGA
      CTGGGTTGTGGCTACAATGGCGGCAGCAGCAGCAACGGATTCGGAAATGCCAATGCCCAGGAGAACCATCAGCCGGTGGA
      ATTCTATCGCGTCGAAATGCTTGGATCCGCGGGAGTCGGCAAACAGGCTTTGCTTTCGCAATTCCGCACCTCGGACTGCA
      TCAATGCCTACGATGGACCTGGTTAGTGGGAATGATGCGTTTGCCATAATTCAACTGAAATATTAAACCTATTGCAGAAT
      GCGACGATGCCGAGCAGAACGTCTCAATCATCTTGAATGGCACCGAATCGGAACTGAAGTTCCTCACTGGAAATCCAGAG
      AGCAAGGTAAATCATTTGTCAAGGGTCCTCAGCTTTTTCTATTTGTGTTTGTAATTGCCGTTGAATATTTCACCATTAAG
      TGGCCAGACAAATGAGCTTGTGTATCCTGGCTGCCTGACTGCCTGACTAGCAGGATTTGCCCTGGGGAGCAGGGAGTGAT
      TTGCCAACTGTGCGGGCATGTAGTGCACAAAGTGAATTAATTACAGATGCAAAATGAGTTGCTGAAATGCGAAACCTGCC
      TCTCGCACACAATAACAAAGGGTGAATGCTGGGAAACTCGAGAAAAAACTATGAAAACTTTTGCAGAAAGCTGCGAAATG
      CGGTTAATTATGGCAAAATGCACGGAATGCTGGAGGCTGCCTTGAAATTTAAGGAATTCATTTAAAATCCTGCCAGACGG
      GCGCCGCCGCCTCCAACCAAAGCAATTTGCAAACGTTGGCACAACAAAAATGTGGGTAAATGGGGGGAAAAAAAAGGCAG
      CACCCAGGGCGGGGGAATGTCGAATATAAGTACAGCGATTTGAGCCACTGTGCAATCGAAATGCCAAATTGCTGGACGAT
      TGCCAAATGGCCAACGGGCCGTTTGCCGCCGCCGCCTTTGAGGGTGGCAAACAATACAAATGAACACGATAATGATAATT
      GTAATCGCCGATGACGATTCTGTTGATGGTGATGACGACTTCAGTCGTTCGACGAGGACAAACAAAAGGAAATGGCAACA
      ATTTATCCATTCGGCAGTGCGACACTAGAATCAGCGAATTAAAGCCAAGGCGCTCGTGCATGGCGCACAGAAAAAATTCG
      TGGAAAAGCAAATAATAAATTGCTTAAGGTCTGACCTTAAGCCTCCGCCAATCCCGAGCACCTTGATGCCCGGCGCCAAG
      TGCCAAATTTACAAATGGCGGATGAGGATGTGCCACGGAAACGGAAGCCAGCACACTGGGCCGGAGTTGAAACTGCCGAC
      GTCACCGCAGGACAAAGTGTATTTGGCCAAAGGTTGGACAGCTGAAATTCCTTGGCAAGGCGAAGGAAGAACTCACATTG
      TTGGGTATTCACTTTTGCCTAGAAGTTGCGAGTTTCCCATGCAAACGAATATATAACTTTGAATCCTGATATATCTTTAC
      GAAATGGGTTACATGAAATCGTTGACAAAGATGTCTAATAATTTGCAATAAAAAGTAACAAGATCTTTGAAATTCAAGTT
      CACATGTTATTTATGCAATAGACCATTTTCAGTGATTAAAATTTGGCTAAAATGCATTTGAAAATAAAAGTGTATTCAAA
      CATGTCGCTGTATCGCAACATCGCGAAATGCTAATGAATAAACGCATTCGCACCTTTAAGAGAAGCGAAACTCAAAGGAC
      CTGGGCAATAGAGCCGTCTGGTAAATGTATGGGCCAGATAAATGAACATCATTAAAAGTCTGGGCGAGTCGAAAAGTTTT
      TCCCTTCGCTCGCCACGTTATTGCGATGCCAAGTGGCCATAATTTTAATTTTAACGAGCATAAAATGCAAAAGTAGCGGC
      TAACAAAAGGAAGCCGGCAAGGCGCTGGGTGCGGAAAATGTTGGGCTACGTTGGTTGGCTTGAGTTGTATGGATGCTCGA
      CTTTTCGCACAACGCCTGCACTTGACGGTGCGCAGTTAAGAACTTTTAATTTCGCCTCCACTGGGTTGCAATAAAACAGG
      GCATTAAATACTTTCGTCAGTCACGAAGGCCTGATGCCCAGAATGTTGTAAACTTGTTGAGTTCCGTGTTTCAATTGGCC
      CGTGTTTGCTTTTGCTGTTTTGTGTGCCTTGTAGGATGAACTGGAGCAGGCGGATGCCTTTCTGGTGGTCTACTCCTGCA
      TTGACAAGGAGTCCTTCACGCGGGCCAAGCAGATACTATCGCGACTGCAGGACATGGACCTGCTGCGCCATCGACCCACC
      ATCCTGGTGGCCAACAAAATTGATTTGGCCCGCTCACGCGCCGTTTCCGCCCAGGGTGAGTATTGCAATTAGCCACTACC
      GACAAGTCGTTGCATTCATTTGCATCGTCAATTAAGTGGCGTGACCTGACCGAATCCGTATCCACCACCATTCCACCATT
      CTGCTTCGTAGATGGCAAATGCGTGGCCTGCACGTTTGGAGCCAAGTTTATCGAGGTCTCCGTGGGCATCAATCACAACT
      GCGACGAGCTCCTGGCCGGCACGCTCACCCAGATTCGCCTCAAGAAGGACCAAGTTCAGTTGCAGGTATGTTCAAAGTCC
      CAAACAAAACTAAAAAAGAAGAGAAAACCCATAGGTCTAGCTCTAGCTCTCTATAGCTCTAGTTTGCTGGTTAGCTAGTT
      GTACTCCCATCTATCTCTGTTTTTGGTGTCTTGTAATCAATGTACATCGATCGCTTTCGCAGCTAAATCCGAAAAAATCA
      AAAGATAAAGATAAAAACAAATTTAAAGAAAACACAAACATAGAGACTGTAGAAACTGATAACTGTCTGACTGATCTTAA
      AGCCGACGACGGGGTAAGTAAAACTAAATGTACCCCCGACTAAAAATCCATTTAAAATCACCTGCTATCCGGACTGAATC
      TAATCGATGTTTAATCGGTGTGTTCTTCAAACCCCAACCCGTAATCGAAACAAGCATGATTCTATAGATAGAAGTTATAT
      ACCCTGTATATCCTATTTGGTGTCTAAAATATAATGATGAACAAATGAACACATTGTAAATCTTATAAAACCCCAAAATA
      CTTTTGGAGATTTGTAAAAGTATCCTATAGATACTTTTTCTGTGAAATCCAATAAAATCCGAGCCATAACTCCCTGTTTA
      TGCGTTGTTGATTGTATTCATAATATATATAGAAGCGCCCTGAACTTTCGCCAAAAGAACTTGTGCCTGTTTGCCAACAA
      GAAGAAAATGTGTCAAGTGTCCAAGTGTAGAGAAACTATTCCAAGCACACTGCCAAAAGTGTTTTGTTTGTTTGTTGTTT
      ATCATCCTGTGCCCACTCCCAGAATCCGCACAAAGGACATGAAAAATGCAAACTTCAATTGGCGCCCCAAAAATGGAATA
      ACCACAAAACTGCAGGGCCATAAAAATGCAGTTGAATAGAGAGCCAAATGTAAATAAAGCCCGTAAATCCCCGCCCACCC
      AAGTGAAGCATTTGTTCCTTTTGGCGAATACATAGAGTAGAGTAAATGTGATTTATCTAATATTTTGGCCCATTTCAGGG
      ACCAAGGGACGCCAATTCGCCGGCGCATTGGTACAAAAGCCGCAGCGTGATGCTGGCCAGCATGAAGGCCCGCCAGATGC
      TCACCTGGATCCTGGGCAAGGAGGACTCCAAGTTCAAGCACTGCGAGAATCTGCAGGTGCTCTAAAAGGGCAAATCGATC
      CAAAATCTATAGGTCTATACGAGTATATGTACTTAGCGGCTAAGTGTGTTGATATGTGAATATGTATGTGTAAAGCTTTA
      TCTCTAAGTGCTCCAGATGGGCTCATCTAATATGTAAACAGGTTTCGAGATTTCGAAGCTCTCCAATTCGCCTGTAAGCA
      GCCATTTGCATACCGAGGAGTGGGTGTGTGTGTGTGTGTGTGTGCGTGCAGCCAGCTATTTGTAGTGTCTAACGTAAGCC
      TGATAATCAAAAATTAAATCAAATTTAATGTAAAACCTAGGGACGTACATATGTATGTGCAACGCTTGCAGCGACTATGC
      GTATGAGCAACTTAATGGAACCAAGCGAAAGGAGCAAAACCAAAAATTCTAACTAAACCTAACTAAGCTAAACTAAACTA
      AACACAACAGAACAGAGAACAACACTACTTATGTACTTAACTAGCAACTTTAGTAACTTTTCTAAGCCAGGAGCAAGTGG
      AGGGAGGGGGGGGTCGATATTTTTCATAAGCTAGCGGCTTAGCTGTTTACAAGCAGAATAAAGGTGTGCAAAATGTTCGC
      AGCAAAAAAGATAGTTATATATACTATATATTTAACCGAAGAGTAACGATTTTCATATAATATTTATATAGAGTATGTGT
      TAAAGTCGGATTGCAGCACTTTGTTATTTTCGTTTTCAGCAGCTTAGGGAAGTCTTACAGGGAGTTAGCTAGCTGCGTAG
      ACAGATTTAAAATAAAAACATAAAAAAAAAGAAATAGCCCTCGATGATCCATCGTATATATATATACATATATATTTATA
      TTTATATTTATATTGTAGCGTTAGCAGTCAATATTCTTTGTGTCTTCCTTAGTCAAATATGTATGTGTGTGTCGGTGTGT
      TTATATTAGGAATCCTTCCAAGAAATAGTGCAATGCAAGGAATTCGCGTGTCCTCCACAAAAGCCTTTAAGTAAATGTGC
      TCAAAGTGGAAACATGAAAAGTAACTACAATAATATACCTAACTCTAATGAGAACCACATAGATCGGTGTGTACATATGC
      TTAATCACGTGTGTATATTTGCAAGGCGCGTAGGCTCAAACAAATGAAACAATAAAATATTTAAATGTTTAACAATATAA
      ATAAGTTCTATATTACTCCTTAACAGGCTAGGTTTGTATAAAAGATATCAATGGCATATGACTATCTATTGACATTAGAT
      GAGGCGATGATCTTAAGACTAAAGAGTTTAGTTAACCAAACTGCTGCTGCGGATTCTTCACCTTCACCACCTGAGATCGG
      TAACGGAAGAGTGGCCGGAAAACATTAATCTCGGCCAGTTCCATATCATCGGCCGCCTCCTCATAGGCCAACTCCTCCAG
      AGCTCTTCGTAATCTGCTCAGAGTGCGCTCGTATCTGTATAAATTTCTAAGGGTTTCACTGCTGGAAGAGATCTCTGGAT
      GAGCATCCCCTTCATTGGCATCACTTAGTTGTTGAATCTGTTCCGCTGATGTGAAACGATCTTGGGGATAACCGAGCACA
      AGCTCAATGATCACAAAACAGGCAATAAGTTGGAAAATAATCTATTATATGGATACATATATTAGCAACAAATACTTTAA
      AGGTTGCCAATCGAACATACCTTGTTGCAACGCATTTTAATGGTAAGTTTTTTAGATTTTAAGTACTGATATAAAATCGA
      CTTGTTCTTTGCTGAACTGCTGGTTGTTAAGTGTGGTTCAACTTGGCTAATTCCCACATTTTATACTATTGGCAAAGTTT
      TTTTGCCCGCCGTTATTAGCACCTGCAATTGTTCTTGTTTCCCGCCTTGATTTTCGCACTGGAAGCGGAGGAAATTAGCG
      TATAAGTGTGGAAAAATCCAGAGCATTTTCCGCTCTCAGTCGAGTCTGATTGAAAAGCCAGGTGATGTGCACGCGGTCTG
      TTGTATTTTCCCCTGCTAGTAGTCTGTTGTCAACAAGCGGAATTTCAACAATGAGTAATTTGTATTTATTCATTCAGTCG
      CGTGTCAAAAGAAATAATTAGCCAGTGATCTCAGGAAATGCGATTCCGAGATCAAGTGTCAACGTCTAATTTCTAAAGTA
      AACTTATAAGCCAAATCTATAGCTGTAGGTGGATCCCAATCGTTACCTAAACGTGTGGCTTGCAAATGCACAGATTCAAT
      ACAAATATACATATATACAAAACAGCCAAGGAGAAAGGATCTCTTGAAGTAATTATTATTCAAATGCAATTTTCAAATAT
      AACTGCAGTTTAGAAAATTAAACCAGCAATACCGCTCTGGAAACATACTAAAATATACAAGACGTAGCATCTGTGGTCAC
      ACTGGCAGCACATATCGATAGTCGCGGGCAGCAGTCGATGTTTCTCCACCTTTATTTTGTTATTTTCCGACGGAGTAATG
      TTTACTGCAGCTGTTTAGTGTGTGTTTAACGGTAATATTAAGTGGCTAAAGCTGTTTTTCAATGTCGCCGTGTTTATTCC
      CAAGCAATCTGTTAGATTCCGCAAGAAATTCCATCTGGTGGCGACAACAAACAAAGACTTAGAAATCCGACAAGCGTCGA
      CTATGAAATACTCTGTAAATTGATGAGGACAAGTGAACAGAAAAGTAAATAAACATTGATGGATTACGTTAAAAACAAGA
      GACTTCTATGATAACAGTATAGGAATAAAACGATCGGCGTTCGTTGAGATAAAAAACGTGCGGTTTCTTATCACAAACGG
      CAAAACACTATCTAAGTTGAATATTTTTCGCCAACGCAGCAGAATAGTAAAGCCAGCGGAAACGCATTTCGTTTTACGAC
      TGCGATACGAAGCTTCATTGTTTGAGCGGAACGACGACGTAAACAAGAAAACTGGGGAGCAGAAACATATGTATGGTGAT
      AAGTTCGGAAATTTTATCCGCGACCTCAGCAGAAACCGCAACCCACTCCGCTGTACCTGCACCTTCCACCCCTTAAAGCC
      GAAAATGTATCTCGAACTGAGTCACCACATCACTCACCACCTACCTGTTGATCATTGTTCTTTTAGGTAGCTGGCATTAC
      TCGCAACCGAAACGGATTCGGGAACCCAGCCACCTGGACGAGCAGCACTTGCACCTCGCCCACTGTCCGCGCCGGTCGAT
      GAGAGCTTCACTGGGATTGGGCAGAACGCGAAAGATGAGCAATAACTACAACGACGTGCCATTCGGCATCCGGGCTGTGC
      AGCGGCTGTCCCGACAATGCTGCACCCGCTTCCATGCCCGCAGAGATTTGCTGTGAGTATGCGATAACTTCTAAATATAA
      GATTTCATTGCAAATGAGTGCTGAGCGTTAAGTTGACCCCATATTATGAATAACTATATTGGGTAGATATTGATATTATG
      TCTATTTCAGCTACAAGATGTCAGTGTTTGTGCTAACTTTCCTGGCCTACGCCTGCTATCACATGTGCCGCAAGCCCATC
      TCCGTAGTCAAGTCGGTGCTGCAAGGAAACTGTTCCACAGCGCTGGCTGCATCGGGTCAGGATTGTGGATATGCGCCCTT
      TGGTTAGTTCTTCCCTTAACACTTCTAACGTGTTACCCTATAAACAAGTGGCCAATTTACAGATGTTCCCGATGCCACCA
      CACTCTTTGGAATGCTGGACTCGGCCTTCCTCTTCTCCTATGCCATCGCTATGTTCGCTTCTGGTTTCGTGGCGGAACGC
      GTTTCCCTGCGATACTTCTTGTCCATGGGCATGATCCTCACCGGAGTGTTCACTTACATGTTCGGCATTGCTCGCACCTC
      CAATATCCATAGTTTGTGGTATTTCATAATAGTGCAAATATTCGCTGGCATCTTCCAGACGACCGGATGGCCAGGTGTAG
      TGGCCCTCGTGGGTCGTTGGTTTGGAAAGTCGAAACGCGGGCTCATTTTTGGTATATGGAACAGTCATACGTCTATTGGA
      AACATTCTTGGCACGCTGATAGCGGCGCATTATGTGGAATCCGATTGGGCGCTGTCGTTTGTGGTACCCGGCATTATCAT
      TGCAGCCGTTGGATTTTTACTCTTCCTTTTCCTAGTGGATCAGCCGGAGATTGTGGGCTGTTATCCACAAGCCGGACAGC
      ATGAGCGTCGCGTGGCCAACGAGTCTGATGTGGAACAGGACGACGAGGAGCAGGTGCGCCATAACGATGCGGTAAGTATC
      AGATTCAGATTTTTCATTGATGTTCCGCATGCGATGTACATTACACCCGGTCTCCCAATATGTTGCAATTATGATTTCAA
      AAACGTACTTTGCTCGGCGTTAGTGTGTGATCAGTTTTGGGTACGAAACTTCGAGAACTGTAAGTGCATGACTATTTCCA
      TGGTTTTCTTGTTATGTCTGCCATTTTTGCTTATGTAAATCTTGCGCTTTGCACGCCACTCCATTTTAAATAGTTTAAAA
      ATTCGTCTTATTTTATTTTAGGAAATCAACTATAGATCTGCTCCCACCGAACGTACTCCAATCCTTCCACGATCTCAACC
      AGAGGCGGTGCCAAGGGGTCGCGGACGTCCCATCAGTCTGATCGATGCTTTATTCATACCCGGTGTGGTAGAGTTTTCGC
      TGTGTTTGTTCTTTACCAAGCTGGTGAGCTACACCTTCATGTACTGGCTGCCACTTTACATACAAAAATCCAGTAAGTGC
      CCAGAAAATAGTATACAAAACAGTCAATAAAGCGATTCCTCTTATGCAGGCACATTGGGTCCAGAACTGTCCGCTGATTT
      GTCCACTCTTTTCGATGTGGGTGGTATTTTGGGTGCAATAGCTGCGGGCTATCTATCAGATGTGAGCGGAATGTCGGCCA
      CCGTCTGCACAGGCATGTTGTTCGTTGCCTCGCCCATTGTAAGTACTCTAGACAAGCCACAGAAACCATTACTAGGAACA
      TGTATTCGTTTCAGCTGCTGATGTATCAACAATATGGTGCATTGTCGATGACAATCAGCATAGTGCTCTTGATTGTGGTC
      GGCATCTTTGTGAACGGACCATATGCCCTGATTACAACCTCTGTAAGTGCAGAGCTGGGCCAGCACAGCTCCTTGGAGGG
      AAATGCCAATGCTCTGGCCACGGTGACGGCCATTATCGATGGTACTGGGTCAATCGGAGCGGCAGTTGGTCCACTGCTTG
      CCGGCCTTATCTCCACCGCCGGATGGCAGTATGTCTTCCACATGCTCATCGCTGCCGACATCATTGCCATGGTGCTGCTG
      GGGCGACTGGTCTTCAAGGAGTTCGCTGCACTGCGTCGTGCATCGCATCGTATTCGGATTGAATAGCAGGAAGAAGCTGA
      AGCGGATGTGGTTTGACCATATATATATTTTTGTTTCTAGCGTTCTCTGTACATACCATAGCATTTGTATAGCTAACATA
      AAGAACGTTTTCTTTTCATTCGAGAGCATATCAGAGTGTTTCTGATCCTAGTTTTACCCATACATGTCAATACCTAATGT
      TATTTTAAATGGAATGTTTACCATCATCTTAGGCTATCCATCAAGTTTACAATTTTGATATATTACCTACATACATATAT
      ATATATATATATATATACATACATCTATGTTGTAATCTTGTGTGTGCGCGCGTGTGTCAGAGTCTCCTCGTTTTAAGTGC
      CGAACTATCATTAGTACTAGCGTAATTCTACTGCTATGTAAATACACTTTATCGTACACTTTTCGTACCAATAAAACCGA
      ATTTGACTGTTCTCCGCGGCAGTACAATTTCTCAATGGCGATGCTTAAGTTAAATCCTGCTTCCGCTGGCGATCCTTGCT
      CATTCTTCGGAAATGGTCAAGGAGTCTCTTCTGTTGCGGCGCATATAACTCTCTGATGCAATCCTCTTGAGGAACTTTAC
      GGTGGTCGCATCGTTCTGATTGACGAGCTTAAGAAGGGCTCCATCCTTGCGCTGCAGGAGCTTGTGAGGTGCTCCGAACT
      CCACAATCTGGCCAGCATCCATGACCAGGACGCTGTCATTGTCCATCACAGTGTGCAATCTGTGAGCGATCGTTAGAACC
      GTGCACTCAGCAAACTTGGTCTGGATGGTTTCTTGGATCAGGATATCAGTTCTAAGAGATAAAGTGTTAATTACGAAAAA
      AATGAAAATAATATCTTAAGAACCTACTCTGTATCCACATTTGCAGTTGCTTCGTCCATGACCAGAACTCGATTCTGTCG
      TAGAATGGCTCTGGCCAAGCAGACCAGCTGCCTCTGACCCATGCTGAAGTTGGAGCCACCGTCCTGCATGCGACAGGAGA
      GACCTCCTTCCAATGAGGCAACATGCTTCTTCAGTTTGACGTCATCCAATGCACTCCACAGGGACTCGTCGCTTTTTTCA
      TCAAATGGATCCAGATTGAAGCGCAGTGTTCCAGAGAACAGAACCGGATCTTGTGGGATAATCGAGATTCTACTTCGCAG
      GTCGTGGAGACCCAGTTTACCAATGTCCAGTCCATCGATCTCGATGGTTCCCTCATTAAGAGCCAATCGGAATAGAGCTT
      GAATTATAGAGGATTTTCCCGCTCCAGTACGTCCCACAATGCCAATCTTTTCCATGGGCTGGGATTCAAAGTTCAGTCCT
      CTAAGAATATCCTCGTCTCCCGGGGAATATCTCATGCGAAGATCCTGGAATCGAAGGTGACCCGCTTGCGGCCATTCAGC
      TGCAAGATTCACACTCTTTGGACTCTCAAGTGGTGGCTCCGATGGCGTCTGGGCGTACTCTAGCACACGTTCCACGCTGG
      TCATATTGTTCTCCATCTCGGCAGTCTGGCGCATTCCCCACTGGCACATAATCACCAATGTCATGGACTGGGTGATGGCC
      AGACCCACATCACCGCTGTAGAAGCTCTGATTGATAACCAGAAAGCTAAAGGTCACCGCCAGGATATAGATCACGCAAAT
      CAGATCGGTCCAGAAGGAAAACGCCCTGTTGGCGCTTACATAAAGAAAAAGGGCAGAGGAGTTTGTGTTCTGGTGGCCAT
      GGAAAGTCTGTTCCAGCTGCGGCATGGCGTCCATGGACCTAATGGTCGAGTGTCCATGGAAGGTTTGGTTTGTGTGCGAG
      TAGATGGGACTGCGTGCTTTTAAGTTAAATGAGAAAAGTTAGTAAGGCTAGATTATTCTGATAAATTTGAACCTACTTAA
      GCTCTCAATCCTCTTCAGACTTCGACTGGCGCCTATATAGAGGGCACGGCAGAAATACAATAGTATAACCATAATGGCTG
      CTGGGATGAGCAGCCAATAGTTGGCGATGGCCACGATCACCAGCACAGCCACCACATCTACCAGGAACTAAGGGACAAGA
      TTAAGAATTGCATGAGACTAAAGAAGAAGTGGTTGAGCTAGGTGTACTTACTTGAAGGGAATCCATCATAGCCTGTGGCA
      GATTCACATCTACATTCTGTATGTCGCTGGAGAATCGATTGAGCACTCTCCCAGATGGATTAGCATTGAAGAAGTACATC
      CAGGCGCGGATTATCCCATGGTAGAGCTGATCGTGCAATGTCAATGAGATGCGCAGGCACATGAAGAAGAATCCAAAGGT
      GCGCAGCAGGAACAATGCCAAAGTGAGCAACAGGAGCACCGTATACCAGATAACCATTTTGGTGCGAGTGGCTTCATAGT
      CATCCACCGAATCATACCCTCTATCCTCCTCCCAAGTGGCCCATCGTGAGATGAAAATGTCCATGACGGCCTGGCATCCT
      CGGGCCAGGACAAACATGGAGAGCACCAAACAGACCAGGAATGGAGCGCCAAGAGCCCGAAAGTAAGCCTTATAGGTATC
      GTAGCTCACGGCACCCTGAAGTTGCTGTTCGGCATTGCCATTCTCATCCTGGATGGTGGCAGGATCCTTTTCTTCTCCCT
      TGCTTAGCTGCTTTGACGTCCTGTCCACCTGGCTGAGCACACGCTTCACTTGCTGCTTATCCGCCTCGATGGCCTCCAGA
      TCCAGAGCAGCATGGTGGGTGATAACGTCCTTAAGTTCCTCATAGCTACCCTGCTGGGTGAGCTTTCCTCCCTCCAACAG
      CAGCAGTTGATCCACACTCTTGAGCAACTGGACATGATGAGTGACTAGAATGCGCATTTTGCCATCCAGCAATCGGTGGA
      AGCACTTGTCCATCAGCAGCTTACCCACCTGGGCATCAACGGCGGCCAGAGGATCGTCGAATAGGTAGATATCCGCCTGG
      CGGTACACTGCTCTGGCTAGCGCAATCCTGGCCTTTTGGCCACCACTCAGGCTGATTCCTCGCTCACCCACAACGGTGGC
      ATCACCGCGTGGCAGTAGTTCCAAATCTCTGTCCAACTGACACGCATGGACCACTGCTCGGTATCGCTTCTCCTCGTATT
      GCTCCACAAACAGGATGTTCTCCCTGATGCTGCCCTGGAATACCCACGGCTGTTGGGCGGCATAGCTAATCCTGCCATGA
      ACCTCAACTCGTCCCTGCATGAGCTCGATCTCACCGAGAATGGCATGAAGAAGGGTGCTCTTTCCGGAGCCCACATTACC
      CACAATGCCCACAAACTGGCCTGCGTTGATGTGAAAGGAGATACCCTCAATATGTGGCTTCCTAGGTTGCTTTATGCTCG
      GCTTGTCCCAACTCGCGCTCACTTTTCGGAAACTTAAGCACTTAGTCTCACTTTGTACGCAGTGGAGCCGCCCACTCTGT
      GCTGGTTTCGGTTTCTCTGCATCCAACTCCAGTCCGGGATTGTCTCGGCAGCAGGACTCCTCCGTCGGCTTCTCCACTTG
      CAGCAGGAACTCCACTACTCGACGCGCACTGACCAGAGTCTGAGCCCAAGTGGTGATGGCCATGGGCCAGTAGTGCAGCA
      ATGAATCATTGAGTAAGCCGTAGTAGGAAGACAGAATGAACACCTTCTTGGCCGTCACAAGGTCACCCACATACACGTAG
      GCCACCAGACTCAGGAAAAGCGATATCTTGGAGATCATATTGGTGCACTGCAGGGCGGCGTATATGCTCATGGATCCTCG
      GATGGCCTTTACCTCCGACTGCCTTACTGCGGCAATCAGGCGTCCAAAGGACTTCTCCCACGCATACATCTTAATCACTT
      GGATGGCACCGATGATCTCGTTCATGAGCTTTACCCGTGCATCCCGATGCTTGGCGGATCGGGTGCCGAAACTAGCAGAA
      GCCTTGGCGGCCCAGGCTTGCAGGGGTATCAATATCACAATGAAGGCGATTCCAATCAGTGATGTCCAGCCCACCTGGCG
      GGTCATCAAGTAGCCAAAGATACAGGCCTCCACGGGACCCTTCCACAGGTCGTGAAAGAAGTAAAAAGTCAAGTCGAACT
      GCGAGAGATCGATGGACATCACCGAAATGGCCTGGCCTCCAAGTCCTTCGCCACTGCTCGCCGAGGCGCGCAGACATTTC
      CGGTAGACCAGGCCGGCACAGGCCAATCTGACCCGCGTTCCCACCGCGAATACGTAGAACATAAATGGGTGAAACACTAG
      GGAGGTGACCAGCGAGCACAGGACAATGCCCATGGCGTACAGATAGGCACTCTCCTTGGTCACCGTCGTCTGGCCGTAGG
      CGAAGTAGGAGATCAATCCTCCGAGCAGCAAAGGCTGGAAGGAACTGCAATTAAAGCGGAAGTGAAAAGTGAGATTGCTG
      TGATTTCCGGAAGTATATTTAGATTCTGTACTCACTGAATAGCCATTTCCAACAGAGAATATAAAATGCAAACGGGAACA
      AACTGCCATCCGTAGACCTTAAAGATCAGCCGCATAAGACTCGGATTTTTCTTCTTGGACTCCTTCTCCCAGTGGGGCTG
      TAGGTTTCTGGTCAAGGACTCACTATCGAAACTGGGCAGGTGTTCGTACAGCTTACTCGCGTCCAACTCCTCCCGCCTGC
      CCTTCCGAAAAACACTGTGCATCCATCTGAAGGAGGAAAAATGATAAGTCGTTCAATATCTTATCAAAGTATCTCCAAGG
      TAGGCGACTTGCAAATGGCATGTCTGATCCAGGGCATTACTACGTGACTGCCCAACAGTCAATGGTCAATCAATATCGCG
      AAATTCCGATTTATGACCGAAATCTCATGTGGAAACTATGGGTTAAAAATAACCATTATCACTTAATGAGTTTTGAAAAA
      GATATTCCAAAGCTGACTTCTGGGCATTACAAGTATCTTAACTTTTTTGCTTAAACTTTTCGGAGATGTTGTTTATCAGC
      ACTTATTAGCAACAATTAGCACTATCCTTATCGCGAGTTGTAAACTATTCACTGATTGACCATGACCATCGTTTCCGCAG
      AGATTTTCACTTTTCACCAATAAAAAAAAAATATTGACGACTCACAGGAACAGCCACTTAGAGATTATATTGGCCTTGAT
      AAACGGATTACTCTCTCTTTTCGGACTCGACTGCTTAGAAGCATCCATGGCTCCATATGCTCGCGGCGCCAGACGGATTG
      AATATGCCCCAAAACGGACGGTCGAAGGCGCTTTTAACGACTTCAGCACTCACAGACGGAGCAGTGACGTCTGTGGATTA
      TTTGTCCGGAGAACCACCATCTTCTACGGTTTGCACTTGGCACAACGCCTGTCCAAACGGCGATAAAGTGGCCAACTCAA
      CACGTTTTTTGAGAGTTCACCGCTTTTGATAGTGATACGTAGTGATAGTGACTAAGGCGTAATCGATAGCGCAATTAGAC
      TGCAATTGAAACGGCGGCCATTACTGCAATTTGCGCTCCAAAAGTTAGCTCGCTAAGCCCAAATGGCCATATATCTTGAC
      TGGATTCTGGAGATATAGGGGAGTTTTAGCGGTCTTTGTCTTGGACCATAATCACAAGCAGATACGCCAAGCCATTTGTA
      TCCGAAGTGGGTTTTTTATGAGGTAGCATTCCCCCAGCAGCTTATCTAATCGGGATCGCTTATTATGCTGTTATATTTGG
      AACTGGCACGAGAAACTATGTTTGTCCAGGTTGACCAAGTTCAATACACCCAGAGATAAGACAAGTTTTCATTCATGACT
      AAAGCTTTAATGGCGTTAAAATACGGGGGATTTTGGAAATATTGCACAGCCTGTGGACAAGGCGATAGATGAGCGATTGC
      AGGCAATTCAAAATGCAAAATTAAAACTTACGTCTTAGGAAACGAATACTTGCAGTTACACAATCAATACAGAAAATTTT
      AGCTACATAATCTACGCCGGGGTAGACACCAGATCTGATAGAGAGTTAGATACAGTACAAAAGCATATTATAAAAGTATG
      GTATAATATCATATTATAGGCATCTTTTCTGGCTAGGGTAAAGTAGGGAAACTTTGGTATTTATCACTCTATCAGATCTT
      TTGAATGCCCCAGATGTATAGATATGGATTATGTATGTATGGATTCTAAGGCAGGCTGTGTAGATCGTATAGCGTGTAGA
      GGTCTTCTGTGCGATCGTAGTTGGTTCTCATATGCTTCAGCATGGAAGGCAGGTTCTCTTTGGCCGCCTCGACATCGGAG
      CACACTTTCTTGAGAAGATCTCCCCTAGTGGGCATCGCGTACATAGCCAGGCGCGCTCCTTTGCGGATGAGGAATGAGTG
      ATGCTTGCCCAGGGTGTCATCGTAGGCCTCCTTGCACACGTCCACAGTCTTTTGGTCGTCGGGTATCGCCTGGATCCGAT
      TGAGAAACTCGTAGACAAAGTCTAGATAAGAAGAAACCAATCAATTAGCCACTGTGGCAGTTATATGCGCATAACGCTCA
      CCAAGACCGCGATGAAGACGTAGCAGCGTTCGACTGCCAGACACGTAACCCTTCTGAGTAAGCAACTGGGCCTCCTTCTC
      GTAATCCAGCATGGTTCTGAAGGTATTAAAGTGTTCCTGCTCCTCCGCGTCCTTGGCTCTCAGGGCGTATAAGATATCTA
      TTTTACTGCGCACATCGCTGCTGACAAAACTGAAGACACTGCCCATGAGCTGGAAGAACCTAATGAACACCGAAAGCCCA
      ATAGAGCACCACTAAAAAACATAAACATCATAATCACTCAGTTTACTTCATTATTTCCTCGTAGGCTGCCAAGTATGCGT
      CTAATTGTACGTCATCCTCGTCCAGAAGGCTGGTTTCGAACAAATTAGACACTTTGAGGATATCAAAACAGTTTCCATTT
      TCCGCCGTGCCATTGGTCTGCGTCGCTAAGCTCGTTTTACTCATCTTATAAGCCTGCCTTTCCCCTTTGTTTTCCTACAA
      ACTTTAAAGTCTATTTATTTTTTTTAGGAAATCAATGTAACCGTTCTCCAAAAAATCCGGTATTAAAATACCACCCTGAA
      ATTACTTTCTTCTTATTCCAGACAGAAACCAGTCTATTGTGAATTGAATACAATTTTAATTGGAGCTATTATTACAATTA
      CATTTAATTCTTAAAGTTAAGATAATACATTTTTTATGCTGATGATAGATTCCCGCTGCCACTGCCAGCCCCCTTTTTCG
      TTGGACGATATGCAATCACATAGCGCTGTGCGACCGGCAAGGGTTCGGCATAGCCATTCGTGTACGATGAATCCTCGAAT
      AGCACCTCGTAATCCTCGGTGGCGGTTTGCGGCAGGCGATGGACAATGGCCTTGTAGAAACAGGTGGTCTGTGGATATAG
      CGCCATTACCACTGTGTCCTTGGGGAAGAGGGCGTGACCATCGGTCTCAGGATTTGCACGCATTAGAGGCAGTGGGATGA
      CCTTTCGCTTGCTCAGCACATGGCGATCCTTTTGCTCCTCGTCAATGTCAATTACGTCGTATTTGTTTTGACGGTGAAGG
      AACTGCACCACTTCCGCCAGGATCCAGTTCTCCTCCTCATCAATTCCCTTAGCTAATGCGGCAACATTGTCGCCAACCTA
      TACAGTGGCGTCCGATTAGTCAGATCATCATCCCAGCTTCTTTGTCCAATCAAAATGAATGCTTACCTTGGCCACATAGT
      TCCCCTCGGCGGGAATGGCTCCACATAGAGCTGGTGCTCGTTCTCCTAGTTTGCCAACGAATAACGGCAACGTTTGCGCT
      GAGAGCTGCACCATTTTCATAAGGGCGCCCCGTCGAATGGCCTCCTTATTTCCAGCGTTGCGAGCTGTGGAATATGCGAG
      ATTAAATCCTGTTTATACATCCCATCACTAACCCACCTTGGATGCGCCTCTCATTGCGAATGCTTCGAATCTCGTGGATT
      TTCGCCAGTGCGGCTCGGATTGTGGCCTCCTCCTGCGCAGCCTCCGTTAAACTGGCCTTGAGCAGGGGCTTAACCTTCTG
      ATTGGTGGCGTGCAGAGATCGCACCAGACTAGCAATGGAGTTTTCCGCACGACGACGCTCCTCGTCCACATTGTGAATGT
      TTTGTTGAATGTCCTTCAGGCGATCCTGTAAATGCCATATAAATATAGTATATATCGACATTTATTGTTAACATCTTTAC
      CTGAATCTGTTGGGCGGCACTCTCCGCAGTCAGTGGCATGTTGTTTCGATATTATAACAATATAATAAATTTGTTTTTTG
      AACACTTTGTTTACCTACGCAATGAAAACAAAAACAAGCATAAGCGTAAAGTCGACAACGCGTTAGTATTAACTATGCGA
      TAGTTTTATATTTTACCTCAGTATTTTTTTAATCTTAGCAAATTTTATTTTACAGAGTAAAACAGAGTAATTATTGTTAA
      GATTTTTGTACCGTATAATCTCATTATTTGACTTTAGTGGATCTTTTTCTCAAACTCGAATATTTACTTTTCAAAGTTGT
      TTACGTTTCTTACATTGGAGATGGAAGCAAGTGCGCCTAACAGCACGCAGATAACAGCACGATATCTTCACGTGGTTGGC
      GTTATTTAGTCCCTTTTCTGCGCTCTATGACAGCCTCTCTGGCTTTCCCTTCTTTTCCATCGCGTTTCCGTAAGTGTGCT
      CCGCGTTTTTCCAATTGGCTATTTTTATTTATAATATCTTCAATTGCAGCTAGGAATTC
      
      Library Information (1)
      Library: RPCI-98_BAC
      Description

      A BAC library containing genomic DNA fragments with average size of 163 kb. Generated for physical mapping of the Drosophila genome.

      Sample preparation
      Protocol

      DNA was isolated from adult fly tissue and embedded in agarose blocks. DNA was partially digested with EcoRI and EcoRI methylase, size fractionated and cloned into the pBACe3.6 vector.

      Comment

      A total of 17,540 recombinant clones were initially generated with an average insert size of 163kb (24-fold coverage of the euchromatic portion of the genome)

      Reported As
      Symbol Synonyms
      BACR
      BDGP BAC library
      RPCI-98_BAC
      References (2)
      Research paper (1)
      Hoskins et al., 2000, Science 287(5461): 2271--2274
      A BAC-based physical map of the major autosomes of Drosophila melanogaster. [FBrf0127123]
      Personal communication to FlyBase (1)
      Venken et al., 2012.4.25, Large retrofitted and site-specifically integrated duplications for the Bloomington Drosophila Stock Center collection.
      Large retrofitted and site-specifically integrated duplications for the Bloomington Drosophila Stock Center collection. [FBrf0218451]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)