Open Close
General Information
Symbol
Dmel\BACR08G07
Species
D. melanogaster
Name
BACR08G07
FlyBase ID
FBcl0297887
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    RPCI-98_BAC
    • BAC genomic clone collection for D. melanogaster, iso-1 strain, adult, 163kb inserts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Genomic Location
      3L:12,901,811..13,109,571 [+]
      Total bases
      207,761
      NCBI
      Full Length sequence dataSequence Downloader
      GAATTCGCGGGCATGCCAAACTTGAGCACCTTCAAGTTCTTGCAATGCGGCACTATGTGGCTCAAATTCTTCTGTATGCA
      GGCATAGCCCAAATGAAGACTGCGAAGATTGCCACTGGACCTGCAACATTTCACCAGAGCTGCGAGTGAAATTTTTGGGA
      CGAGCATCTGCAATTCTTCGAGATGGCAAAGTTGGCTTACACGGTCGAAGCTGCTGTCTATATAGTTCGAAAATTAGCTG
      TTAGAAAAAATGTGTTTCAGGAAATGAATTCAGAATTGAAAGGAATATAATATTTTCTTACCGTCTCTAGCACGAATTTC
      CAATCTTCTGAGCTTCGGCAAATGTCTGACGGCGGTCAATATTTGATCGAATGGCTTTTGAATCGGTGTAACTAGCATCG
      ATTCCTGCTTGACTACCAAATGTTCTAGCCTTAGCATACCGGCCAAAGTCTGGCAGAGAATTTGAAAACAGTTTTCTGGA
      GTTTCACATCCATAGGTTCTATAACATCTAGCCGTATCGAAGTGATCCAGGTCAATGGTCAAGCACTCTACTGTCTCGCG
      ACAAATACAAAATTGTATCAGTTCAAGTCGTGAACTGTCTTTATCGAGGGTATACACGCGGTATTTAGCAGCACAATGAT
      TTATAAAAAGCTGACGAAATCTATGGCATACTTGTGCGAAAATAATGCGATCTTCAGTGGTCAAAAAGTCAAATATATGG
      TATAGACAGTCGTTGTAGAGCTCTTCTATATTTGCGAGACCCATTACGGAAACAATTGAAAAAACACTGTATACGAATAT
      CCATTCTAATCAATCGCAAGCCCAAGACGCGTCGAAAGTTATGTTATGTTATGAGTAATATTGTTATTTTCCCTCAGATT
      AGATACGTTCTAGTCAGCAATTGGTTAGACAACCAGTTTTACCGGGTATACCACATACTGACCTATGCCAATGGAATGGA
      TTGTTTCGTGAAAAAAAAAGCTTCATCAGCTGATTGAAAGTATGAAGCTTTGTATTGAGTGGCGCCATCAGGCGGATAGA
      TCGGTTAGCTAGAAAAAGCTAAAATTGTCTAGCTAAATTCTATTTTATAGATTATATGTAATTAAAGTAAGTATATTCTT
      GATTTGGATTCTATTGCGATCGTATGGTCTGGTACAGGGAATTTTACAATTGATTCTCGACTCGAGATACACATAATATG
      AATTTGCCATGGGGTTATCGTTTCACGGACTTCAACGTTCGTTGATCCCCAGCTCCAGAGTGATTGGTTTGCTCTTGACT
      TTTGCGCTTCCTTCGTTTTTTTGCCTGATTATCCAAGTTGGTCGTTTTTGAAAAGAAGCGAGTCGGTTGAATGCGTAAAC
      AATTGGTCTTAGCTGGTTGGATGGCAGAGATCTTCGGTTTGGATGGCAGTAAAAGTTCGTGGCCGGTGATGCGTTTCATG
      GCTATGTACTGGCCGCAAATCTGCGGTAGAAAGATCTCCGATTCGTGGACATTACATTCTACGAGCACTACGCTGCCATT
      CGAGATGAGCTTGAGTGAAAACAGTGGACACCGGGAACCTTCCTCCGCAACTCTTCTAAATGGACTGCCATCGATGGACG
      CCGCCCAGGGGGCCAGACCTGCCGTCGCCGTCGTTATCCGAGGTTGGATCTGTGGGCGCTGGCAGATCTGACCATTGCCT
      TGACCCTGGACAGGCTCTTCACAAAATTCGACTTTTGGATTCGACCGACGATCTCGTATGATATTCCACAGTACGATGTC
      ATTGTTGTATATCTGGGGTACAAAAATCTCCGACTCGTGATGTAGGGCGTCCACGAGGACCAGATTTTGGTCCGAAATCA
      ATCGAATTTGAAAACTTGTCATAGCTTATCAGAAATATAACACACACACATAACAATTTTGTATAGTTTATCTTTTATTT
      TGAGCTATGAGCGAAAATTGATAAGTTTCTCTGGGAAACAACTGTGGAAGCGCTAAAGCCGAATATCAAAATCAATCACG
      AACTTGGCTGTTCTGGATAGTTGCATACTTTGCATTTACTAAGATCATATCTCATATCTCAAATGTGTCACCTCTGATAA
      GATAAGATTTTGAAAAAAAAAGTGCAGTGCAGTTGTGGCCACGCAAAAACCATTATAAAATTCTTATAATTGAATTTCTT
      ATAACATGCTGCGCTGGCTGAACCCTCACCTTTAGTAACCGTGGTGGCCATGCTCCCTCCTTGCACACCTCATGCCCTCT
      CCAATTTTCTTTTACCGAGCATTGGTCATAAAATACCAGCAGTGGAGGAGCTCCGGCTGGAACATTTAATAGTTGGGGCC
      ATAAATTCGCAGACTGATACAATTAGGGGAAATGTTCGGGCTATTGGTTCCTGGAACATCGCTGATAGTCAGTTCGAAGT
      CTTTTTCTTTGCTTTCTTATATATTTATATTGGTTACTTTCGGGAAAGTTAACGCAAATTGGTAGCATTAAATTCAGCTG
      GTTAAAGGAAGAACATTACCTTTAAGCCACGGATCTGAGATGGTATTTTCAATATATTTACTACTTACCACATCTGGAGG
      TTTATCAGTCGTGTTTTTCAAGTGCTCGTTAGCATAACATGTTCTTGATTTTTAGTTACCCCCAAGGATTGATTGAAGTT
      TGCGCATCACTGGTTTGTCATCGCTAGCCTCCTTGTCCAAAATTTGTATGTAATTTAATCAGACGCAGGGCCAAGAAATG
      AAGTAGGACTAATGTGCGAAAAGATGACAGGCGATGTGTTTGTAGTCCCTGCCGCAGGGCAGGACCTCTGATATTGTATA
      TGTTTTATCCTTCTTTTAGCCGTTTGTGTTGTCTTTGCTGCGCAAATGAGATGAGAACATTTGCATATGTAAGGATGTGT
      GAAAGTGACACTGGGCTGCCTTTGTTTTCTTGAAAGGCGCTTTTGCGCTTTTTGACAAATGACTTAAAGCCTTTTGGGCC
      ATCCAAGGGGCCATGAAAAGGGTTCAAGTAATTTGTTGAGACTCCTGAATATTGAATGCGAATGTGAACCACGTGCTGGG
      CCGAATAAAAATGAAATATCTTTTTGGCGAAGCAATAAACGAGCTAAAAAGAAAATGCGTTAACCGCCATGTCACAAAAT
      GCTTTATGTCCAAATATGCTGAAGTAAAAGGTATTTTGGAATTTAGGCATTACGTAAGATGTACCATAAAAGTTGAATAA
      CTCATTTAATATCCGATAAATTATTAAAATTAATGAAAGTATAGCTAGTATACTTGTAAAATAACATATGTATGTTTTAT
      AAATCAGAAAAACTTTTCTATCTGACTTCTTTAACTGGATGTTGTATAGATTGTATTATGGTCATTCGCTTATAATCCGT
      ATGAATGCACATCTGTCTTTCATGTGCGCGATGAAAATCTTCCAAATATGAGCTCAGATTGGCTCATTCGTAGTGCCTGA
      GCCCGGTTCCATTTTGGTTTTATTGCACCAACTGGCGTGGATGTCCGACCAAGAAAATGGCGACGTGGGCGGTGTGGGCT
      TAATCCGGAAACTTATTTATGTATGCCTTTCCGGTCGTTTTCTTTGCCCGACGCATTTCTCGCATGTGTAAGTTCGTTTA
      TTGTCGCACAGACAATCGCACAAACAAGAGTGTTTGACTGGATGGCCGGAGGATTGGCGGAGTGAAAGTGTGGGGTTCTG
      GGTGACTGTGGGTCTATTCCACACTTATGACACGCCCACGCACACTTTCACTTTACATAAGCTCTATGGCCGGAGGTCCT
      TAAAGGACCGAAGTCGACTTGTATGTGTGTGCTGTGTTGACAACACTTGATAATTCCTTGCATACACGCACTTTGACTGC
      AAGACACTATTATCCAATGCCATCCCATACACATGTATCCACAGGATACTCCACATCCATTGCTGTACGTACTCTGATGC
      CCCTGGGCATCTGGAGGCTTCTCGTCTGCGGCTTTGAATTATTTAAAATTGTTTTCTCACGCCCGCTTTTGCGGGTGGGT
      AGCTCTGCTATGTATGTACATGTATTCATCGATGGAATTATACGAAATATAATATTTGTCCTGGTGCATAAAGTTTGATT
      TACAATACGACTTGTGGGCTGTCGTTTAACTTTTAATCGTGCTTCGGGTTAAGTAAGTTAAATAATGGCGTCTTGGGTCG
      ACCATGATGCGGATTGCGATTCACAACTGTGGCATTAAAGATTAAAAAATAAATATAATCAATTCGTTGAAATGTGTGAA
      ACACATAGATGGCAGTTTCCTCGATGTCACCATATACTCGTATGATGATTTCTATATATTTTAGAACTACAATATCATAT
      TATCGTTTATATAAATTGTAATTCCATAGAGTATACAAAGCTTTTCTTTAACTGAAATAAATCGCTGAAGGGTATTTTGT
      TTCACAAAATTCATTTGACTCTGTAACTCAGAAGAAGTTGAGGGGAATTCCTTGCCTTGTGAATACACGGTTTTACAACA
      AGGATATGATATTGAATCGCCGATGGGTTTGGCTCACCTCTATTCTGTTCAGTGCTGCGACCGCGTGCTGTGTTAATTTA
      ATTAACGAGCAACGCAAAGAAATTACTTGCTTCTCGGCGAAAAGTTTAACAGCTGCGGATGGCGGGGTCTTTGACGGAAA
      ATTTGAGGGAAAAGGAAAATGCCTGGCAGTCAGGCCATAGATCAAAGTACGCCCGCTGAGCCGGGCTTTTCCGCTCGTTC
      TTCCCTGTATTTGTATGTGTGTTTCCTATGCGTGTGCCCCGTCAGCAGGTGTGTTTGTGTGCATGTGTTTGTGTGCATGT
      GTTTGTGTGCATGTGTGTGTGTGCTGAGCCTCCTCGGTGTTACATAAAGTAGGTCAGTAGTAGTGCCGAGCCAATAAAAG
      TTAATGCTGCCAGGTGAGAGCTTGTGTGTGTCCTCGCCTGTTGATATTTTTTAATATTTATAGAATTTTAAAATGCCTTT
      TAAGTGTAGATATTAAACATTTAAATTCGAAAACCAGTTGTAACCATCTTTCAGCACGCTTTATTTCTCGTCTTCCAACA
      CTGCACATTACAATGTAAACTTACAAACGAGGTTGTATCTGATTTAGCGATTTCCCCAGTCATGCAGTCACATCATCAGG
      AATACGATCGTTATTGTGGGTGATATTGAAACTTGGGAGTTAACACTGCTAAGCCTTATTTCAATAAATGTTAAATCGCT
      AAACATATTTGCAGATGATCTGGTTAGTTCATTTAATGACAATTACTATAAAAACAACAGGCATATTGCTTGTTGTCAAG
      ATAAGGTAGATAAATCCTCACCCGATCTCCAAACTCTTACTAAAGTCCATTGACGGCTTACCGAAAATTAAGCAACTACA
      TATATGCATTCTAAGTAAGTGTTATAATTCCGATACATAAATTTCGATTGTCTAAATGCAAAAATAGCATGAAAATCTTG
      GAAAAATATGACTACATTATTGGCGAACTCTGCCTGCACTGAGAATTCTACATCTTTCGAAGGAAGTGAGCAGTTCAAGT
      CTACGGAATATACTGACTTTTTTGCCAAACTTACAGGAACTGATATTCTGTACAGATCGACCCAGTAAGTCGCGATTGCC
      ATTTTATTCTAGAAATCAAAGAACAGAACTGACGACAATTTTCGATTTCCTGGCAAATAAGAGAACATTACAAATCCTTC
      GAATCAAGGGATCAATCATAGCCAACTATGAGGCGCAGTGCCTTGCCCATATGTATGTAAAAAATAAGGTACCCTCCATC
      ATGTAGATATATCTTCAACATATCTGGAAGTAATCCGGCAGTGCAAAGATGTTCGCTTCTTATTTATTGCAAGAAATCGT
      CGAGGTGGGCCTTACTTAGCTTATCGACCTACTTTATTCTTAAATTAAAATGTGCTTTATCCATCGAAAAAAAATCGTTA
      GAGAAAATTGTTTATTTAAATTTTCACTCGCATTTGAATGAAAGCGCCTGCGGGGCTTGAAGCCGAAAAAAGTTAAAAGT
      AAAAGCATTTTTGGGGGAGGAGTGGCATTCCCAATTATGCGAAACTCCGAACTGTTAATGAAATATGTCAGAAACAATTT
      AAATCTAAAAACAATTTATAATTAGAAAAGGCACTTAGAATGGGGGAAAAAAAACGAAATGATGGCACCTGTTGTGCAAG
      CTCCGATGCCGCAGACTTTCCTTTCATTTTGCAGTGACAGTAAGCAGGACGCAGGATAGACAGGGGCAGACAGGAAAAAA
      AAAAATGGCAAGAAAGTGCATCAAGTGTGGCGGAAGTCGGAGAAGAAGAGCAAAATGGCGGACCGGAAGCGGCCATTGTG
      TTACGGCGGTGAAAATGCGGGTGACCACGGGAATTATTGTTTCTATTTTAGATTTCACTGACTGGTTTCCGGTTAAAGTT
      TAAACCAGCGCATCATGTTTTTCTTCTGAAACAACATCGTTGAATTTAACTCCATTCTGTCAGTGTGAGTGAACGTGGCA
      AAAGTTTTTGCTTAATTTCATTGATTCAAATAAATAATAAATAAAAGCATATTCCCTTTAAAGCGAGCTGCAAGGCAAAT
      GCGTTTAACATAATTAAATTGTTCTACAAGTGTAGAAAATTGATTGCCTTGTTCCTGCCGTTTGAGAACTTAAGAAAGTA
      ATTGCATTGTTTGACAAAGGTCCAAACAGAACCGTGTGACCTTTTCACTGTTTACAGCCTTAACTTCCAAACGCCTTTGG
      GCAGAAGTCTCAAAGTTTTTGGCAAAATCCCTTGGCTTGTTGACACTTGAACTAGCCTGACATGGTGCAATTCTCTATCA
      GACTATTTCGTAATTGGATATTTCGAAACATTTTAAAATGTCGTGCGAATTTTCGATGACAAGATGCAGAACTTGGTGAA
      GTGTTTCAATTAAAACTGGCTCAGCTTGTTGACACTTATCGAACACAAAGCCATCAGTGTCGCATCCGGTTGTAACCGGG
      GGTTTTTGTCAACCTAAACGCCCATCCACAACCTGTCTGCCCCTTGACATCCTGGGGCCTGCTCAACATGATGGTAGTTC
      TTAATGTCATTGTTGAATGGCTCGTAGTTTGCTGGTAGCAGACATCTGAGATATTTTCTAAGGAAGTGCACTTGCCGAAG
      GACATTTTGCAGCAATAACCAGAAACAAAGCTCTACAATCAATGAGTGACTTTCATCTACTGGCTTTGGAACAGGATGGC
      TTACAAAATGAGGTTCAAATCTGTCTGAGTTATACCAAAAGTTTTCTTTTGACAAAAAGCTTGCTCTCTCTTTTTATTAT
      AAAAAAATCAATTTAAGACACTTGTACACAACTAAATCTGAATTCATTTCAATGACTTTTATTTATCTCATTTGAATAAT
      TTAACGAAACTCTCTAAAAAATAAATTATTTTAAAAAACTCTTTAACTGCTTTACCATGCTTTGCTATTTTTAATGTTAA
      ATTTTTTATGGATTCTATAACTATTCTATTCAATTCATTTATGTAGAACGTTTTTTTCTAACCATTGCTACTTAAAAAGT
      CATGGGTTGCGCTTAGTTTTTGTTGAACATTAACGAGTGCAAAAAAAATAAATTAATGTTTGTGTCTCATTAACTCAATG
      GCCTTGCTGGTCGATGCATTTAACATTTGTTTCACAAATAATTGACCCATTTGAAGATGGCAAAAATGAAATTTAGGCGT
      GTTTTAAAACTATTAATATTGCATGGACCATTGTGACAAATCATGGTCTGAAATTAATGTGGCAGGCAATATATATAGAA
      ATGACTGATTTGTGTTGGAGAATTTCCCGGGGACCTGAGATTTTGACACGCGTGCAAAGTGATTGCGTTTTCTTGCCATC
      AAAATACACATAAATAATCCAATTAATTGACAACGGCGACACGAGGCATCCTTTTGGGACCCCGAATAATTGGTTTACGG
      CTAAAGGACTTCCATTCGCTCAAAGTGGCGGTTTGTAGTTTCAGAAGCTGTTTCCCAGTTTCAGGTGTATTTGATGGACC
      CCTCAAGCCCTCTAGACCCGCACAAAATGGCTAATTGGTTGCGCAGAAAGGTACATAATTGGCAGGGCGGGTATCGGATG
      GGCCAATTGGACCCGGAGCGAACTGTTTAATTGAATCTGGCCAGAAGGGTTCTTCGTAATAAATAAAGCGTCGCCAGGGA
      ACAGAATGTATAGAGTTTTTCACCCTTGGCTAAAAGGAGGTAAAGTTACCAATTACAAAATATCAAGAGTTTACAAATGT
      GGCCAAAATGATAGTTTCATTTCATTTATTTTTGTTCAGCAAAAAGTTATTTTATTATATGCATTAAATGCATACCTTGT
      AAGCTTGCATTAAAAAGCAAATATGACTGAAAAAATGGGACAACTTCTCGCCAGTATCGATCCACATTTTTAACCATATT
      TTCGCTTTCACAATTTTAAATAATTAACCCAAATAAAGTTCACTTGTCGACTTCAACGGATGAATTGATGCCCAAAGTCA
      GCGAACCGATAAATACGAGTTCATAATTTCTCGGAATGCATTTTGTAATTAAGTGCACAAATATTTATGCTTGGCTTGAG
      GGAAGATATTTTTTCGCATTAAATGCATAATTAGCGCTGCTCATTTGTATAATGTATTTTAATACACTTTCAACGTATGC
      CGTAAATAAATACAATATCACACAATGCATTGACCTCCGCAGCCTTGATTAAAATAAATGCGCAACGGTCTTTTTGAGGG
      CGAGTCGTAAAAGTAGATACATTTGAATGCATTTTATTGGCCATGGCCAAAGCTTAAAGTGTTGACCAACATTTCTGTTC
      CTTTTCCATCAATATATTAATATATTCCAGCACTTTTTTGCCCGTCACTCTTATCGCAGTGTGTGAATGGAAAGCCCGCA
      CTCGAAATGTAAGAATTCATTCAATTGCAATTGCAAATTTGTGTCACTGAACTGTGAAACAATAAAGATTATCCGGGCCG
      GAGATGGGAGTGCAATGTATGAACGGGTTTCGGTTACCAATTTAAATATCAGTTGGCCTGACTTGCGAGCGAAGAATAGC
      AGAAAATTTTCAGATAGCAATGAATGTGGCTAAAAAGACTGAAAATAGAACAAATACATGCGTGTGTATTTAATGTCAGA
      CCTAAATTAATCGCAAATGAAAATGCCACAAGCATCTGGTTTTGCCTCAGCATCCGTTGACATTCATTGATTAGGAGTGA
      ACTGGCTGATTGGAGAGTTCTTTGTGTTTTCTAGACCATTGTTTGCATTGCCCTGGGCTCAGAGATTGGATTGGCTTTCG
      AACCGAGCCGATTGGCCAAGTTGTGTCTGGAATTGGCTATTTGCATGGCTCTCAACTACTTTGCAGATTTGCTCGCAATG
      TCTATATTTGTGCTGGCATATTTAATTAGCAGCAGTCTCACAAAATTGCCCGACATCTGACAAATTATGGCAATGTGTGG
      CGATGTCTGTCCTTTTGTCCATGTGTCTGTGCGACAGGACTATAGGATGACAGGAATCGGCCACTAATGCACTCGACCTA
      AATTATTAAACATTCATTGTCTCTTTCCAGCGATGCCTCTACGGTGTTTGTGTGTTTTCAACGGGTTTTCAGTGCGTAAA
      TAAAACAGAGGCTGTTCGGTGCTTAGTGTGCACATCGCCACTAGCATCACACACTGCGTATACGCAATTTGCATTGCATT
      TGAGAACGTTCCATGCACTTTCAACACCGCAACGCACGCACAGCTACACACACACACACACAGGAACAAATGCCAGCTGT
      TCTCTATTAAACGTCATTTCCACTTTGTATCTAATTGCAAAACCTTGCCAATCACGGGTACCAAATACCTAAATTCTACA
      AATATTTTAGTATTTTCATTTTCTACTTGCTCAATTCATTCTATTTCAAGTAAATGAAATACCCAAAAATCCGACGTCTC
      TCCCCCAGCTCAACATTCGATTTTCCCAAGTGTCATTATTTAATTATACCTTAAGCCGCAATCCAGCTGACAAAATACCT
      GCGTCATGAAATTCCGCTCAATTGCATTTCCTGAAAATAAACACCTGTCATTCAGGTGGGCGAATGGAAGTGTGAGGAAG
      TGTAGCCTATTTGCAAGAAAGGGGGTACAAATTATTTCCAGCAGCGGAAAGCTTGTTGAGTTTAATCAAAAAGCAAACTT
      ACTTGTTAAGTAAATACTTGTCCTTTTTGGTTTGTCAGTAAAATGTCTGCGTGTGTGTATGTGTTTAATTTATTTATTTT
      CATCCGAATGGTTCCAAAGAAAACTATAATCTGGGCCAGAATCAGAAACAGACTCAAGGCCCGAACTTGCACTGTTATAG
      TCTATCAGTTCCACACCGAGCGCTAAAAACCGGTCCAATGTCGCTTTCTCATATTTGATCATATTGTCAGGAACAAATAT
      TTTTTTAAGGTTTTTCAGTTTCAAAAACGATTCACAGTTACCCGACCGAAGAATGTCCACCTTCTCTGTAAATATACTTA
      GGGTTCCCTTAGCATTAAAAATAATTTTTGTGTCTAAATTTGAGATAGTGCATTGTTTTTCTAGCAAAGCTGCATAATCA
      TCGGTAATTATTGAAGCCTTATTGAGTGTGCTTAATCGTTTAAGATTTGGGTGTTGTACAAAATGGCTAACGCTTTTAGG
      ATCATAAAATCCGCACTCCAACCCTCGTAGTTCATTTAATTTCGAAATAAGCTGTACCATTTCATCATCAATGTTAAAAC
      CTAAACGCAATTCCCTTAGTGTAGATTTTTCCTTTTCGTGTAAAGCTTTAAGGAGCTGAAAGATTGGAATGGACCGCGTA
      TAAGTTGAGACTGCTCCAATTTCCTCGAAGTACATGCCCATATCTTCTTCTTCTTCGTGCGATTCAATGTCGATTTCCAT
      ATCATTTTCATTATTTTCAGGCAGCAGAATTATCAATTTTTGTAGCCTATTTAAACGCGATAGTCTGACGTAATCATTAT
      CCCATGCATTATCATCCAGTATAAATTTTAAATTCTTTAAATTGGAGCAGTGGGGAACGATTTGAGCTAGCTTTCCATGG
      TCGGAAAAGTGACTTTGATTCACTTCCAAGGTACTCAATTTAGGGTTATAAAGGCAAAATTTCTCAAGGTCAGAAATTTC
      AATAGATGCCGTTAGGATGAGCTTGGAGATATTTCGAAAGCCATGAAGGTTACGTATTTCACGACCTGCAATGTAAAAAT
      TATGTTATAGAAAAATATATGCGTGTAGACACGGATTCCATTTACCTGGTATATTAAGAATTAACTCAATTGGTTTGCTG
      TTACGTTTCAATTGCAATATCTTTAAAATTTCATCAGCGAAACTCGAGTGCTCCTCGTAAAAGAATGCATCGAGATTATT
      CAGTTTAAGTCTTCGAATACTGGGATTTGATACGATACTAGTTATGATGTTCACCAAATGCTTTCTTCCTTCCTCTGTTT
      CTGCATTTAGAGTTTTATACATCGCGTCAAGGTTTATGGTTATATTTCTCCGCGGAACTACATGCAACTCATGTATCGCC
      AAACGTGTGTAGAAATGTATATCCCAGTCCCTAACGATTCGTGTAAATTTAAAGCTTGCGGTAGCGAAATTAAGGATATC
      AGCGTATTTTATGATCTCCTCAGTTTCATCGCCATGCTGTGTTTCACAGTTTTTCTTCAGAATGTCGAGTATGCGAAAGA
      AAGCAAAATGATTAATGTCTGTTATTTGGGTTTTCATTTTATGGCAGGAAACTGTATATATATCTCTACATATATATGTA
      TATTAAAGTATATATGTATAAAAGTAAAAATGTTCGCTAAGAAACGTCCGATACGGTCTCGATTTGAAGGTATATTGCTC
      TTTAGCTATGAGACAATTTCATTGTGACGGCAATAATACCATACCCTATACTTTCGAGGTGGTTTAGGCTACCTAATGTT
      ATTATAACTTTTGTCTAAATTTATTTCACTGATTTTGATTTGGTATATAATTCTAGTTGCGGAGCTATAACTATGAATTA
      TATTATTTTGAACACTATTGCTAATGACAATACAACATACAGGGTATTTCCTTCTCGAGCATTGGTTATTACATGTTACT
      TGTTATTATCGCTGTTGATAATACAAAAGTCACACTTATGCAAAGTTGCGTGTATGTGGAGAGTGATGAAATTAAGAGGA
      TCATGTAAGAGAAAACGCGCTCTATTATTGTTCTCTTTGTACTCTGTCATTGTTGCCTCTTCCATGCATGTTAGAGAGTA
      ATCGTGCTATTCGCTTGCAGACAACGAGAGAGTACAGTTCTATCGTTTGCTTAAATAAAATTATTATTGAATAGTTAGAA
      CATTGAGAGTGTTTCACTATTTGGTTGATGGTCTGGCTTATAATATACATACTTAAACGTATTATATTATATTAAATTCA
      ATAATCGCGTTAAAAGAATGAGCGGATTGTTGTCCAGAAATAATTAAGGCATAAGCCGATAGTTTGTAAATAATTAAGCG
      GTATGATATCGATACATACAGAAGAGATGAGAGAAGAGTTTGAAAAGAAGCGCACGCGAAGTTTGTGAAAGCTATAGTTA
      ATTAAGTATAGTTTCACAATGTTACTGTCTTAGCCAACACACAATAAACACTCCACCACTCGAAAAGCCAGCCATATTTG
      CATTTTACACTGGCTTTTGAGGGTGTAATTAATTGATCAAATAGTTGGATAAACCAAGACAATTGGATGGGGTGTATGCA
      TGTAGAGCTCGTTATGTTAATGTGACGACGGACATCATTATTTAAAAGTTGAGGGCATCGCAGGGATTTATGATCTTCGC
      CACGCCCTGTGAATGAAAACTTAAAGCGCAGTTAAAGTTTGTTTAAAGTAGTTGCCGTGGCCAAGTGAAACTGGCAGCTG
      CACTTAATTTGCAGTCAGCTCATTTGTTTTGCCAACCACCTAGCCACCCATCCACCCCAAAAACCCCATGAAGCTGGCAT
      TTTTCTCTGCCTGTCCCCCCTTTTTATATCCCAGTTATCTCGTACTCCTTACGTCTCTATCCCATGGTATGCGGTTAAAA
      AAAAAAGAGAAGAAACTTTAGAAGCCGTTACTTCTGGTTCGTCCTTCCACCGCTCGGAAAATCCGCCCCGTAGCGTTGTT
      GTTGCGGGTGCGTGTAATCTACTCAAAGCAAATAAATTTTTAATGCTGACTAATGTAGAAAATGTGAGCAGAAATTTACC
      TGGAAAACTATAAGAGACCGTGGCGTCAACTTCCGCATTTTTACTCCATCCTTATCCTTCCAGCTTCAAGACTTTAGTTC
      TTGGTCCATCGTAATTTGCAACGCAGGATATTACAAATTGAAAACGAAGCCCGGCTCGCTGAATATTTACTTAGGGCTGA
      GAAATCATTTTTTAAAAGGTATGAGAAAATGACCCAATTGCGAATGTAAGAACTTGACAACATTTTGAGGCATCGATGGG
      TCATGCAATTATGAAAGGCAACAAAACAGCGCAACAAATTGGCGAAAATGGTAAGTCATTAAAACAAACATCACAGAAAA
      GCTTCGCACCAAAAAACTCGAAGACATTTTAAATGCGAAAATAACTGAGACAATGGCTTGGCGTGAGGGAGGTTGCAGAT
      GAAAATTGCAAGGCAGCAGCAGTCGCAACAACAAATTGGCAAAATTCATAACGAGAAAAAGAGAAGCATGGACGTAGAAA
      AAGGGAATATCTCAGGATCCCTGCCATTATTGTTAGTAAAAACTGAGCAATAAAACATCATTAAATGTTATCATACGAGT
      ATTTCGAAAAGTAAGTTACTATATTTGTTATGTTCTAATTCTAAGTTAATTTTTTCTATATTATAATTTATAATTATATA
      AAATGAAAAAAAGTAGTAATAGGTTGTCAAGTTTATTACCCCATGGAAATAACACAAAAGCGATGGGTGTTGTTGGCTGA
      AGTTAGACTACGCCCATGACCAAAAATGACCAGAGCAGAGAATAACTCGAAACAGTCGCAAGTGACAACGAGCTGAGGGC
      GCCCAAAGGATGCTGGTGCTGCTCCGTTTGCAGTTGTTTCTGTTTGCAGTTGTTTTAGTTGGTAATGAAGGCGACTGATG
      ACCAGGGGCGGTGGGGAGCCGGTTTTCGGAAACTGGCCAAACATTAACCAGCATCAGCGAAAAACTTGCAACTTGCAGAC
      GCATGCAACTGAATCAAGTTCTGCAATATAGAGGGGCAGCCTTGCATTGTTTTCAAAATGCTTCGAGTAACTTTTGCAGA
      ATGGCTGCTGAACAGCCAAAGCCAAGGCAAAAGCAAAAGTTAAGCGCCCAACAAAATGGAATTTACATTGCCTTTCACAA
      CTTGCCCGCCAATGTCTTTGTAGCGTTGTGTTGTGTGTTGTTGCATATTTGCGTTGTTTTTTAATAAACTTAATAACTTA
      GCAATTTGTTGCTGCAATCAGAGCGCGTAGCCAGCTGTTCCCGTCATGCAAATGGCCAAATGGCACGGACACTTTTGGTG
      CGGACACTTCAAAATTGCTAGAGCCACCCATGGTGTATACTTAATTTTCAGGCATATTCTGCAGGCGGCGTGTGCCAATT
      AATAAAGTAAATTTCCAAACAGAGCTACAAACTCATAAATTCAAAGATGGTCAATCAAATCCAAATAGTTTCAACTCACT
      TAAAAGTTTTTGGTTGTATCGAAAATTAACTCTGCCACAGCTTGGGACATTGGGCTCTTTAAAAACTCATGTCCAGTCTC
      ATATCAACCGCTGAATCCTCAATCGATCCCTCAGAATGGTCCTGGCATCGCAGGAGCACGAAGCAGATGTCGCTGGGGCG
      GGTCATCGAATAAACAAACATCTGTGGCAAGTGAGGTTAGGACACAAATTGAATTTGCGCCCTAAAAGAGCATAACAAAT
      AGACGACGCGCATACGCCGTGTGGTACGCAAAGCCACAAAACCCACATGCATGTCGTCGGATAACCAAGACACCGGACAA
      CGCAAAAACTCACTCACTCGCCCACACATCAAATCCCTCACCCGCACTGATGGGAACAGTCACTTGGTTGTACCCTATTG
      CAAAAATCACCAATTAATCTAATGTTTTCAAATCATTGGATCAAATGGATTAATATATTGGTTTTGAATGAACAATATAT
      ATTTCAAATTTCAGGTAATAGCTGAAATAACATAAAAAACAATTTTTCAATTTTGTTCACACTTTAGATTTTAGTACAAA
      AAATCCCTAAAATGTGGTACATATGACCCAAGTCAGCCATATGAAAGTACCTTTTTCGTCACAACTCACCTGTCAGCCAC
      ATTCAGTGAGCCATGACGCTTAGATACGTTTGGCATGCGTAGCGAGTGACAGGGAATGGCCAAAACAGGTCCACAACATG
      GTCGCAGCTGCTCCTGCACCCAAATTCCAACTACAAGGCTCACCCACATGGCTACATCACCATTACCATCATCATCATCG
      CTATAGCAATGGCGTCTGGATAATGGCTGCCCCGGAGATGACAGTTAACAGTTGCCAAAATGGCTACCCTGTGCCAGGTA
      AATAAATCAAACAAAAATGGCGACTTTCGTCTACGTGATGAACTAGCCAGTGGACGACAAAAGTCACGGAGGCTCAATAG
      CTTGACTGATTATGGGGCTAGTGTACATGGTCCCTCCAACTTGGATTTGTATTTGGGAGACCGAAACTGACGCTGAAATG
      TGCGTGACACAAATTGGAGGCCAGACAGAGAAACAGAATCAGGACGTCTGACACGCAGCCAGTGTGCTGACAAATGCTTC
      CTGTAAGATGTCTGTCCATGTCCATCATTGGGAACTCAACTGAAGAGTTCAAACAGCTGGCCAAGAGCAACAGTTAAGTC
      GATTTTGACACATGACAGTTCATTTGGCAGAAATCAATAATGTCTAGTGGAGAGTCCTTAGAAGACGCAGGAAATGCAAT
      CGAAGTACTGCTGTGGTGCGACTGCAAAGGGAATAATTTATTATGTCAGAAATGTTGTACAAAACAGTGGAATGTGCCAT
      GCATTCACAGAAAACATAGTTACTAAATAAAGCTCGAATATAGCTACGCTTATTAGCAGCATTATAAATGTTATTCTATG
      AACAAGATAAATTCAATAATAATATTGTAGCATGTTGGAAAGTGTAGTACCTATTTTCTTAATTTTTTCGACAATTACTA
      GCACTGATTTATATACTTAAAATATTTAAGTGTTATTGATTTGATATTTTCCCTTTTCCTTTGATATTTCCCCTCGAAAA
      AAAGTTTTCTTTTGAAGTGTATAACTGTATATCGTTAAATAGAATAGCACGCTGCATTTTTTTTAAAGAATGTATATTAT
      ATATGCCTATGCTCCGGTTTATGTGACCTCACCTGACCCACTAAAACTTGTGACCCCAAACGGTGGCCACCGACTGCGAA
      AACTGTGACTCCATCTGCGAGTGTGGACGCCACACAATTGAATATATTATGGAATATATATTGCGGCATATATTAGACTA
      CCAATGGATTGTGGTCCGCGGTCCATGCAGCATTGTCCATTCTGCGTGGTGGACACAACGGTGCTGTTTGCTTTATGGTG
      ATTACTCAATTTGAATTAATTTGCGGCTGTCATGTCAACCTTAAATTAGTTTGCAGCAATTTGCATAAACACAAGTGGAA
      ACTTTGCGGGAGTCTCAGCTTTTGACGTGATTTTGATTGGCTTGCCGCTCAGCGGGCGAAACGTAAGGCTGGTTATTAGA
      AGCAGAGAAATCTTCATACCCCGCACTTTTAATACCACGTTCTAATTAAATTTAATTTTTTCCTGTAAGCCATGGTGGGC
      ATTCCTTCTTTGTATTTTTTAGGAGGCACTCAATTTGACTTGAAAGTAACGTCGGAAAGTGAACAGCAGCTGTCCGAGCC
      TGAAAGCCGTTGAGGTTTTGTGGCTTTTTGGCCAAGAGCAAGGAAAGAAGAGCACAACAGCTGGACAAAACAAAAAAAAA
      AAAAAAAAGAAGGAAAAATAAATGTTTTGCCACTCTGCTTTTCTCGACTAATTCGGTTTTTGTTTATCTCCACACTCTCG
      TCTGGCACATGGAGAGATTTTCTCCTTTATTTTTTCGGTTTTTCCGGGGGCCATCTGCATTGCCTTTGTGTGACAGGCTG
      GTCAAGAGCAAGCTAACTGCAATTTGGCCGCTTTAAGGATACCCGCTGCAGATGCGTCCTAATGCCATGTGAGAATGAAG
      GATTAACAGCAGCAAGGACTTCTCTTCAGCCACCGCACCGCAATGAGTTGGCATTCTAATGGCTGCAGATGCTTTTGCTC
      CTTAAATGTACCATGCATAAAACTTCTCACGATGTCGGTGACATCACTCACTCACGGAATGTGAGTGCCTCTATTTTATA
      CGTTTAATAATCACTCTGATCAGTGAAGCCCAACACTTCCCTCTTCGGAAATAATTATTTAATAAGCTGACAGCTGATTA
      AAACGCCACTAGCCGTTAAGGCGATGCAAATGCGATGAGGGCAGGACATTACATGGACGGATGGAGTAATGTGGGAATGT
      CCTTTTTTTTTTTTTTTTTTTTATTATTTGACTTACGGTAGGAAAATTAAAATCTTCTAAAGATACCACCTACCGTCCGT
      AGGTGGCATGCACGATTCATAAGCCCTATTGGAATTATGCCTACGTACTAAAACAAAAACCTCCGCGTGCTCTACAGTCC
      TTGCTCGCTCACCGGGACTGCCAGTCAAGGTATGACTTCGGTGAGCAGGATGTGAGGCCAGGTCGCACTCCCTTCCTTCA
      GTGTAGTCCATGGGGGCTCCTCCTTCCACCCTTTAGTCGCCTTTTACGACGAGCCGGGGACGCTGAGGATGAATTCTTCG
      CCCGCCGTCACCCAGGACACCAGTTTGGGCTTAGACATCCACTCTGTTGGCCATCTCGTCTGATCGGACACGCTTCATCA
      TATTAATGATAATGCTGTGTCCCCACTCCCAAGCCCCCCTGTTCGCCATCATAGCCGCGAACAAGCCACTAGGGCTGAAC
      GGGGAACCTGACAGCGTCTTTAGCTGCTCTCTCTCCGCCGTGAACCTGGAGCAGTGCATTAGCACATGTTCTGCTGTTTC
      TTCACCGTCGACGCAGAACAAGCATTGGGCTGACTCTACGTGACGGAACCGGAGTAGATAGGCCCGGAAGCAGCCATGGT
      CCGTGAGGAACTGGGTTAGGTGGTAGTCCAAGCATTTGTGTTGGCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGA
      TAAGTCCACCTCCCCCGTCGCGACGTTTGCCATCTACTCTGCCATTCACCTAATAGCCACTCGTGTGCCTCTTGCCTGGA
      AGCGCCACTCCGCATTAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCTT
      CGGATATGGTCCTGAAACCTCTAATGAGCCTCAGAGACATTGACCGTAGCACCGAACGAGCTCCTTTCAGGTATGAGACC
      CTGCCAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGTAGCGAAGCCTTTGCTACTGACACCAGCAGTTTCCTGGCCGG
      GTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGCTGTGATTGCTGCCTTCTTGCTGGCGTGGCTCG
      CGTGGTCCTTGAACGATAGTCTGCGATCTAACATTACCCCCAGGTACTTTAGGGACTCTTGAGAGGTCACCTGTGTGCCC
      TTGACGGAGACCAGCATGTTCTCCACCTTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAG
      CCCGGCTTTCTCGAGCCAGCGGATGGCAGCACCGATCGTAGAGTTGCATTTGTCTTCCAACCCTGCGATTGTTTTCGAGA
      CAGCTGTGATTGCCACATCGTCAGCAAAACAATGCAGCTCTACTCCTACGGGCCTGTTGATGCCCAAGATCCCATCGTAC
      ATAATGTTCCATAGGATTGGTCCAAGTACCGATCCTTGGGGAACACCTGCCGAAACTCGGTATCTTTTTGGGCCATCTTC
      CGTATCGTACCATAGGACCCGGTCCCTAAAGTAGCTGCCAACGACTATCCTTAGGTACTCCGGGATCCCCATACGGTACA
      TGGCCGCGAGGATTACGGGCCATCTGGCGGTGTTGAAAGCGTTCCTTACGTCCAGAGTCACAATTGCGCAGTATTCCTTC
      CTGCCCCCTAACCATCTATCACCAGAAATAGCGGTCTTGGCGATGTTACAAACGGCCGAAAGAGCGTCCAGAGTGCTCTT
      ACCTTTCCGGAAGCCATATTGATGACTTCCCAGGCCGTTGATGCTCTCGGTGATTGCCTCTATTCTGGTATACAGGATAC
      GTTCGAACAGTTTTCCTACTATATCCAGTAGGCATAGAGGGCGGTAGCTGTTTGCAGCATGTGCTGGTCCCTTGCCTTTC
      GGCAACAGGACTAGCTTCTGGCTTTTCCACCTTGTTGGGAAGATTCCGTCCAGAAGGCATTGCTGGAAGGTGGCCCTGAA
      GATTTCAGGTCTACCCAGCGCCACTGCTTTTATAACAGCTCCAGGAATACCATCTAGTCCAGGGGCTTTGTTGGGTTTGA
      TGCGCTTGGCTGCCTCGGCGACTTCAAGTTCTGTGACGCACGGAAAATCTGGGGCAGGGGCTGCCTCTGTTGGCCTCCAT
      AGTGTGGTCTGCTTTGGGAATAGCTCCCCTACTATGTTAGCCAGGACCCCCGGGTCGGATGGGGTTGCCGCTCTCCTCCT
      TAGCTTTTTGGTAACAAGCTTGTAGGCGAGGCCCCAGGTATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCG
      CTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGACGTTTCCTTCTGAAAGCCTCCAAGAGTTCCGCGTGGTGGGTACTG
      CCTCTGGCTCGTTGCGCCATTCTCCTAGCCCTGAGGCAATCAGACCGTAGTTGGCTTAGGGAGGCGCTCCACCAGTAAAC
      GGGTGGTTTGCGCTGTGCCTTATTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCATGAGGCCTGCCG
      CCATACTCTCTGCGTCCCCACTTGGGATTTCCAGGGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTG
      TCCCATGCTTTCCCGACTGCTCTACTCTGCCGTCTCCTGGGCATGTCCTCCGGGGAGAGACTGAAGGAGATCAGGGCGTG
      GTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTATTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAA
      AGGACGTACCCCTATCGTTGTTAAACGTCGGCTTCCGTCCGTCGTTCAGCAGTATAAGGTCCAGCATTCCCATGGCGTCA
      ATCACAGCTCGGCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGCCCAGGCATTAAAGTCGCCGGCAATGACCTT
      CGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCCAGAAACTCCTCGAACTGATCGGGGGTGTCGCTCGGCGGAGCGT
      AGCAGCTGTACAAGTGCACGTGTTTTAACTTCGCATAAGCGATACCCCGCATAGGTAAAGCAGCCAGTTCCTCGACGTGG
      AGAGAGCTGCAGCATTTGATAGCTGCTTTACCTGTCTCGTCAAGGATCATGGACGATTGTCCGCTACCAGAGACGTAGGG
      TTCGCTTAGGAGCATGATGTCTACATTGCGCTCAGCCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGA
      CATTGAGCTGTACTACGCTAATATGAGTGTGCATTAAGGTGGCTCTTGGCTTCTTTTAGGGTCGCTCTGTAGGTCGGGCA
      CGCAAAGCTACCCGTCGAGTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCTGCAACGCACCCCTTTG
      CCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTTCTTGCAGGTTGCTGATCGATGCCCATAG
      CCGAGACACCTGTAGCATCTCGTGGGTCGAACGTCCTGGGTGATACGACATCTTGACCATCCAACGGTTATGGTGCCCTG
      TTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCGTGCCATCCCGCATTCTGCGAAGGCCCC
      TGATATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCAGCTGTGGAGCTCCTCTGCTGTCGTAGCCTCG
      TCCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTC
      GCTCTTAAACTTGGGGACGCTTTCCGAAGCTTTCCCCTCTACCTCGAGCAACAGCTCACCTTTCTGCGTTCTCCGGATTT
      TTCGCACGTGGCTGCCCAGTTCGCTAAGGCTCGGGTCCGATCTTAGCTTCCGAAGCATCTCTGCGTACGAAGCCTCTCCT
      GTCTTTTTTACGATGAGTGCCTCCGGTTTTTTACGCAGGCGCGTAGGCTTCACCTTGGTCCACTCTACACCCGTGCTAGC
      ATTCTTGGCGACAGATGCGTAGCTGCCTGGTTTGGACTCGTTTGGTCTGGATGTTGCCTTTTCTTCACCGTTGCCACCCA
      ACGTAGGGTTGCTCGGCTTGGGCGCCTGGATTTTTGGCACTTGCACCTTGGGTACCTGTGCATTTTGAGGAGCCTTTTTG
      GTAGGCTTTTGTACCTCCGTCTGGGTAGCACTGCTCTTCAAGCGGTGCTCGCTAGTAGTACCTTTGTACAGCTCTAACGC
      CCTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCTCGTGTCACGTGCCGTTGGGTCTCGAATGCGGATA
      GCAAGGTGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCATTCTGGAGAGCCGCGGTCAGGTCCGAA
      GACCGATGAGGGGAACCAGCTGGGGACTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACT
      TGTCGCGGTCGTAGATGCTGTAGGAGCCAAGTTCTCCACCTCTACAGCATCGCTGCAGTCGCTAGTCAACGGCGGCTGGG
      GGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGG
      GATCTCGAAAGTCGGGGGCTCCTCCTGAACGGGTCGTTCCGATCAGGGGGACTGCCCCCCACTGCACTGTCCATCAACTG
      AAAGATGGCCTAAGGTTACCTAGGCGAAGCACCAGCCTTAGAAAGGGGTTCCCACGTAGGCCACGGATTTCCCCCTGGCT
      TTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATAT
      TTGGTCTGTCCTCGACCTTTGTGCCTTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTAACCAGAATCAAAATTAAAA
      TTAAATTAAAATTCAACGGTTTAATTTTAAGTTTAATTTTGAATTTCGCGCTCTACTGTCGCAACACAACACTGATCACA
      CGGTTGATCTGGCAACGCCTCCCTCTCCAGATCGCCCGCTGCGCCAAGTTGGCAGCGCTATCAGCTGCTTTATCCGCTGC
      AATAATCGCAAGATAATAAATTACCTATTTACCCGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATG
      GCGCGACTCCACCGTGTGGTTTTGCTAGATTGCCGCGCACACCGGCCGACACAACTACTATGGTTTCGAGTATTTCGCGC
      AGCGTTGATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTCGTCCCCTGTGGGAATGTCCTGCAGGCTTCTGTCTGTG
      GTCTAAGCTGCTCTCTCTGACACACTCACATATATGTATATATATATATATATCTATACTACAATCGCTTATGTGTGTGT
      GGCTGGTTGCTGCGTTGCAAAATGCCATGTTAATGACGCTAATTGTATTACAATTTGCTTGAATGCCTGAGTGCTGGCAA
      TGGCAAATTAGAAACCGCTTAGTTTGGGTATATTCCATGGCCAACTGCTCCTACAGGAGGCACTCCTTTTGAGATCCGGT
      GCATTGGCAATTGTTGTCTTCCACCATTCCTCACAGATCCGCCTTTGTCCCATGCAATCCTAATCATGCAATCACGAAAT
      GCAACGGACTGCGTGGACGATGACGTCGAGGGAGTATTTTGTATAGTGGGCCGGCTTTCTCATCCCATAAGAATGCAGAA
      TATGCACGGAATTTACTGGAGAATGGGCGGCAGCTGAACGTGGACTTGCACAATTGAAAAGCTTTAACTTGTTCAGATTG
      CTCTAAAGGTAATTAATCTATTGAGTTAATAGAACAGAGAAAGGAATTACTATTAGCACATTGAAAAAGGAATAGGAATG
      AGTAGGACTTCACTTTTTTTTTTATAATTCCTTTCAAGTATTTAACTTATTTATCATAAAGCCAGCTTAAAGCCTACAAA
      CTGGCATTTTCAGAGACAACAGAAACGTGACAAATTCACGGCAATTGTCCTCCATCTCTGGTATCTGTGCAGCCACCAAA
      AACGTGGACCCCAACCCCAAAAGTGATCCAATGAACCCGGGAAAACCACTGTCATAGTTTATCACATTCTGTGCAGTGGG
      AGGAATTTTTTATTCCTCCGCTTGCTTGGCTACTTGTGCCATTTTCTTCTTCCCACAAAAAAAGAAAGTGTACCAGGGAA
      TATGTGCACCATCTCATATCCTCCTCCAGCGATTGTGATATACGCTTTGCCATCCCAACCAACTGTCATATTTTGCGACA
      ATGTGCGTTGGAGAATAAGCTGGGCAAGATTGGGTGGCTGGGGAAAAGTGGAAGTGGATGCCAAAGAGGCTGCGGCACTC
      GGAAAGTGCCAGCTCACTTGGATCGTCTGGATTAGCTGGATGTTGTGGTGGCAGCCGGTATGGAAGGCAGAAAAAAAGCG
      AAGGCCAAAAGTGTGGGCCAAAATAGAAATGAAAGAAAAGCAAAATGAAATTCAAGTGTTGCAGTTGCCTCGGGCAACAA
      CACTGCAATTGTCCAAGAAAATATTTATCAAGCTGGAAATTGATTAAAAAGTGTTGCCTGCACTAAAAAAAAAAAAAGCA
      AAAGAGCAAGAGCTTGAAAAAATATACATATATATTGAATCAAATTGCCGACTTGCAAAAAGCAAAAAGCAAACATAAAG
      TGTGCAGCTGACAAAGAATTATCTGGCCTCACAAAAAGCTGCAGAATGTGGAGGAGAAAATGTATATTTAACTTTAATAT
      TGTGTGGATAACTGCAGGTAGATATTTATAAAGGTGTAAATTAATTTGATGCAAACAGTAATAAAAATAACAAACCTTAT
      TAAATAAATAAAATCAAAAACGCAATGAAATGCTTGGAATTTCTAAATTTTAAAGGAATTTATATGCCTGGCTGAGTTTC
      CTATAATTTAAAATGCATTTGAGTTAACATTCCAGCTTAAATATTCAAAAGATAATCCATTTATTTTATCCTGTGTGTTG
      AAGTTGTATTTTACACCTTGCCTGTTAGCTGACAAAATAATTATAACGAACTGCTTGAGGCGCTTGGCTAAATTAATTAT
      TTATAATTTGGCTGGGTACCGCAAACGGGCAAAGTTTTTGACCACAGGGCATAATATGGTCATGTGTGCGCCGACACATT
      TATCATAGTTTGGATAAATCGAAATGAAAAATGTGAAAGCCGATGTTGTGATAAGCCTATTACTAGAGAACTTATATTAT
      CTAATTTAGTTTGTATGCAATGTATATCAAATACTTACACTGTGTCCACTAGCAAAACTAATTGAAGTAGTTTTAAGCAC
      TTGCACATGTTGATATTTGCCGAACATAAACTCTTGACACTTTGACATCGATGTTAACCAAAGCAGTTATGTGTGACCTA
      AGTTGAACTTCTGATGGAACCAAAGTTGGTATATCTAACATGTATTTCGTTGAATAATTGGGCGGCAACAATTTGATCAG
      AAATAGGAAAAACAGTTCCTTACACGGTGATTGGTTTGGCCTAACAGCGATGGTATATATCAATTTTTTAAAATTGAACC
      AAATAAATGGACAAACAATTGGGTAAATCCATTATTTTTAAGGTCGTTGATTATTCTATGCATTTTTGAAACAATTTTTA
      AAATGTAAAAGGATAATTCACGATTAACTAGAACACAAATAAATTGTTTAGCCATTACGAAATGTGTCATATGCATTTGC
      TCAATAAACGTTCTGTAATCAATTGCCAAAAAATAATGTTATTGGATATTGAAATTTTATTTAGAATTTATGGGGCCATT
      GGGCGTTAACAGTCAATTGTTTCCAAGCCAAGACACGCCCAGCTGGATATAAAATTGCACATTAGCACGCATAAATAAAT
      GTGCTGGGTGTTTAAAATTTTTAGCACAACATTTTGCCATTCGACTGGCTGCTGCTCGCATGTTTTTATCATTCGAATTT
      GGGATCATTTGCATGACTTTTATTGCGCTCGTAATTTCAGAAAAAGAATCAACCAGCACGACCATAACTGCCAGTGAATT
      CTGTTGGCTGCATTAATGGTGAATTATAGCCCCGAATGCCGAAGAACTTTTCAAATTCATTACATTTTAATTAGTTTACT
      TTCATGATGGCACTCCAGTCCCATCCTTTGTTCTTCCATTTTTTTTTGTGCTCCCCTCTCTATTCGAATCCCAGCCCGTA
      TATACCTGTGGGTAAAGGAGTAGAATGAACTATGCTTTCAATTGTTTACAACGACTTTTATCCGAGCTATACCAAACCGC
      CCATAACGCCACCGCCCGGCCACCGAGGTTCGCCACTAAAGTTCGTCCTGGGAACAGGACGTTGTTTTAGGTCGCTTGAT
      TTGTTTGGGTTGCTCGACCCTCCCATTTGCATAGGCAAGCATATTCCGTCTGGGGATTCTGCACTTAGTTAGCATATTCG
      GAAATGGTCCCTACCTTCGATAAAGTCCACGATTTCTCCTATCTATTTTATGCTAATTCCGATATTGTCTTCCGGCTCAG
      GCCAGACAAGTACTGATTTCATAAATAGTTCCTAGGGCGGAAGAATATTAAAATGTTCGCATCGAGTGCATCGAATCCCA
      TGTTTAATTCATGGGACATTAAAAGGAGAAGGTGTTGTCTGGGGCATTTACTTTTTTGCACAACTGGGTAATATTATTAT
      TGAATATGTTTTAAAATACAATTTTAAAGCATATAGTTCAATCTCTAAAATTGTGACCTACTTTCATGCATATGTATGAA
      AAACCAAAGTGCGTGTGTTGTGAACCTTAATTTCCATTAAAAACCTTTTTGCCCACACTACTTTCAGTCTTAAGTTATCG
      CTAAAGCCTAAAAGATCTTTTCCGAACCGCAGGCAGAGAGTTTTATTTTCGGCTAATCCAGCTCTAATTCCATTGCAAAG
      GTCTAACCAATTAAGATGAGTTCCATTTCGGCTTTCGCAAAAGGAAAAATGATATCCGACTTAACCCGAAAAGTCCATTA
      AAACACATGAAAATACATTTTCGGGCCAGTGTCCTAATGGCCAACGTGCCAAAAACACACATACATACACACACAAGCAC
      ACCTGGAGATGCAAAAATGTTTGGTCGAGGCAAGGAAAAATGGAAAAATGGAAAAGGTGAGCCAAAGCTCCTCAATTTAC
      ACTCGTTCACACAGACACACACGCAATAGGCAGAGGTCCGACACGGGAAAAAAAACATTCACACGTGCGAAAATGTAACA
      ATTTACAAAAGGATATGCCGAAAGGGACACTGCTACCCAAACGCACACACACTAGTGCCTAAGGATTCGCAAATGGAGGT
      GGCCGTAAGTCTGTGATTTGATCGAGGAAAACGTTAGAAAGTCACGTCGCACTCAAATTAGTAACTGAAGAAGGTCCTAT
      GTCCATGTCCTGTCGCCTGCTGACCCAATTTCCAACTCCTGCAAAGCAATCTCTAAAGTGTGAAATTTGAGAAATCTTTC
      TCGGCTTTCGCCACACTTGTCGTGTAAATTATCGCTGTAGTGAGTTTGTCACGGTTTCCAAGCGCCCAAAGTCGTGACTC
      CATTCACATCCCTAATGCAGATGCGTTGCCCTGCTGAATCTCATTCGACTGCTTTTTATTTTTGTTTCTATTTTACTTCT
      GTATGTAAATGTTTGAACTGTCTGCACGAGTGCCACGACGATGAACAACTACAGAAACAACAGTGAAAATTGCAAAAGGG
      GTCAGCAGTTCACACACAAACATAATAAACCCGAGCCCAACCAGCGTACACCCATACGTATACGCAATATGCCTGCATTA
      ATATGCAAATATTTGAGAGAGAGCACAATTTTGACTTGGCTGAAAACCCGCCTGCATCTGTTCCCCTTTCTTCCCACGAT
      TGGGTTATTTAAAGGGATTCCCCTTTGGTTTGCACAGGGATTTCCCCCATTTAGCCTTTTGTTTTGCTGGGACGAATCTT
      TTCTGATTAGCCAAATTCAAATTTGCATTCACTTAATTTAGATTGCTCGACTGGAGCTGGGTAAAGTTTCTGGAATGGTT
      TTGGCATTGATTTGTTGTTTTTTAGATTAAGTTAATCTAATACCAATCCAAAGCCTCAGGTCATGACTTTACAAAGCAAA
      CTTATTTCAACCAAAATCTTTTGGTTTATAAAAGAAGAAATGGTAGAAAGTTAACCATTCAGACTGAAGTACTAAAAATA
      AAGGAGAAGTACAAAATATTGCATAAAGGAGTCTTAAGTAAATATAAAAAAATTTTAATTTTTGTGCCAAGCATATACAG
      TATATTTACAAATGGTACTGTGTACAACAGTCTAATTATACCCGTTACTCGTACTAGATTCGTTGATAAGTATGTAACAG
      GTAAAATGAAGCGGCTTTGTTGAATGTAGTTAGCTGAGTAACGGGCATCTGATGGTGAATAAAATCGAATATAGCGCTCT
      CTATGTTCTTATTATTATTATTATATTATTTGAAGATTATTTTAAATGACTGGCACATTGCATATTTACAGGAAAGAAGA
      AAACCAAGGCTCGCTTTTTATCTTGTTGCAAGCATTTGTGAAAATCCGCAACACCGCTGTAATTTACGACTTCCCATTGA
      ACTGTGCGAATTTTCCATTACTTAGCACTTTAGGGTGACCCCATTTTGGAGACTCCACCCAGGCAGCTGGGGACATACAC
      GGAAAAGGTGTTGCTAATCAAGCAACAAAGTTAGTCCCGTGGACAAAGTAAGCCGGTGGCAAAAAGGAGCCGGTGGCAAT
      TGAGTCGAGTGTGCATTAGAGGACGTGGATTTAATGCACTCAGGCGGACCGTGTTCGACTCCTGGCCAAGGTTCTATGTA
      GCCCAACGAAACGCAGCCAGGTCAGGTCAGGTGGCAGCAACAAAAGCTGGCAGAACCCCAAAGGCACGTCTGGCGGTCTG
      TTTGAAGCGTGAAATCGATCAGCCCCCATGCCAAGAGTCCCAAGCCACCTCCATCTCCGCCCATCGAGGGCCTTGTTTTG
      GCAGCATCCGTGTCAGTGGCAATTGAATTTGCTTTCCCACCCACCGTATAACCTTACGACCCCTCACCCCCCCCAAAGAG
      AAGGGGGTTGCGATTTTGATGGCGCTTAAGTCGCAAGTCGCTGCGCTCCACTTTGCTGCTAACTGCACATTAAACGGCTC
      GATGGCAAAAGCTCCACTCAGGCGAAAGCTCCACCAGCTCACTCACACTGTAATCAATGGGCACCACCACCATCACCACC
      CCTTGATTTTCCCGTTATACCCGGCTTTCCTTCGTAGAGCAGCTTTGTGTTTGCTCTTTATTTTCTTGCTGCACTGTTTT
      CTTCATTTGTTTCCGTTTGTTGTCCGTTTCTTTGTTGTCTTCTACATTGCCAAATGTAATTACCGTGGGAAATAATTTTG
      GTTTCTTTTTTCCTGCCTCACATTCTTTTGTTCTGTTCAATTGATTGTAGTTTTCTTGTTCGGCAGAAAATTAGATAAGC
      CATTGTTTTCGATGAAAGGGAAAATAGGGAAATTAAAAAGACTGAATAATGTTTTCACAATATATATGACCAAATAATCA
      AAGACAGTTGATAACCGAAAAGAAGTAAATCTTCCGCCACTCAACATTTAACACAATGAATTAGTATTAAAATTAATATG
      AAAAACACCGCTGCGAACGGGTATCGTTGCCCTAGTTATAAATGTACATTGAATCACAATGTCACAATGTCTCCTTATTC
      AGCTCTCAAAAAATATCCAAATGGGCAGAGCTTACCTAAGGGAAGAAGTGGGCATCACTTATGGTTGAGCAGAGCAGTAA
      ACAACTTGTCTGTGGCCTTGCAAGAAGTACCAAATATGGCCCACAAGGAAAAACTCACATATATCTTGCTTAGCGCAATA
      CTCTGTTTTCTATGTGCCCCCTCAAAGATTTACATTCCCACACTTGTCGCTCATAACTTTATGGAAATGCAATTTGCGTG
      GCAAGGTGCAAAAAAGTGGCCAACAAAAACCAGTAACAGAAAATACTTCTTTTCCCTCTTAGCCACTTTTCTTCTGACTC
      GTTTTTTCAGTCTTCAATTTTGTTTGTTTTTTTTTTTTCGTTTTGTGGCTGGGTCAAATGCAATTTGAACGGTGAAATTT
      TGTGCGAGCTAAAAAGAAAATGCCTTGGAATGTGCTGAAAAGGAGGCGACGAACGGCAAAAGAAGAACGGAACCGCATTT
      GAGCCCTTTTTATCGAGCAGAAAGTGGAACGAACAGGCACAAAAAGAGCGAGCGAGATGGCATGAATTGTGGAAGAGGGA
      TGGGTAGGCAGAGCGCAGAGCGTTGGGGAAAATTTATATAGCCATGGAGATAGTTCGAATGAAGATGGTAGTGGCTGCAG
      TTTTCGGCTGTCGTTGCTGTTGTACAAAGTGGAAAATGTGGTTAAAAACCGCAATACGAAATAAATTACTTTTTCTGCTT
      TGAGCTGCAGTCCGAGACTCTCTGCCTTCTGCCTTCTGCCTTCGGCCTTGTCGTCCTCTTCGTCCTTTCGGCCTTGTCGT
      ACTCGATCCAGTTCCTGGGCCACTTGCCTGCGACTTGCTCTCTCCACTGCAGCTTGAAATTGAAAGCTTCCGTTCGGGCC
      AGGCCCAATGGAAAGGCCATTTAGCCACCCACCCAGAACGCTCACACCCCCTATGCGCTGTACATTAGGCCGCAGTTCGC
      CATTGCTCGCTTCCGTTTTCCGCCAGACGCGCACCCATTGTCCCGCTATCTCCATTCTGCAGCACCCCCTGGTAAGCCCA
      GCCCCCCCATCGCCGGCATTTGACGACCAAAAATTTGGTCAACTTAAAGCCAGCTTAAAGGCAACTAGTTCCCCTGCCTA
      TTTGCCAGATGACTAATTTGAATTATGGCCATCAAAGAGTGATTAAACTTGTTTGCTTTGCTGGCTGAATGCCCGAAGTC
      TGGCCCAAGTCGTTTTCTTGGCAGACACATATGCTATACTTGCTGAAAAGTGGCAAGGTTATTTGGCTATCGCAACCTTT
      TGTCTGGCTATGGAAGTTTTCTTGGGTTGGGGTGAAAGTTTACATGTAGCCAAGTTGGCATGTGATTAAGGAACTAAAAT
      TCCTCAGGACATTTACATGGCGCTTTAAAGGACTTCTGAAAGGCAGCTTAAGCTTGAAGTAAATAATGTGTTAGGCGTAT
      ATATATTAATTAAGATAATTTCCATTAAAGGACGCAATAAAATGAAACGTATTACAAATCATCGAAACTTAACCACTTTC
      ATTAAAATACTTTGGAGCAAAGCGCCAATTGAAACAACTCTTTCATTCACCTTAAGCTATTGTTAAAAAAAAAACAATTT
      AATGTTAGATGAAAATAGTTTTCGAACACATTTCAAAAGGTAACAATGGTGTTTGTGTAAGTCTAAAGAAAAGTCGCATT
      ACGGCAAAAGAGCGCTAAGTGGCCAACTACATACAATTACAATTACAGTGCCCCGCCGACGACCTTTCAACCCTCTGACT
      TGAAGCCCAACGATGTTGAGTCGACAGTTTTCTATGACAATTGTTGGCTGGTCAGCCATTGTTGGGCGAATCGCTGGAAA
      GGAGCAGCCGGAGGAGTTGGAGAGTGAGTAGGACCGGGATCAGAAAGCCGGAGAATGGGGCGCCAAGTTGCGTCAGTTGC
      CATTTATTTGCCGTTTGCATTCAACGAGTCTGATGAATGGCCATTTGAAGTAAGCGCAGCGCTCGCCGAGATTACCTTAA
      GTATGCGGCAATTGCACAAGCAGCTTAAGGACATCGTCGTTTGCCAACTGGAGGCGATGTAAAAAGGATGCGGATGCGGA
      GGCGGAGCAGGAGTGGTAGTGGAAGTGGAAGTCGCATTGCCATTGCTGATGGTGATAAAATAAAACACGCCGCACGCACC
      CCATGCCCATAATTTATGCAGTTGGTCGAGCTGAATTTATGGCCTACAAACAAAAGACAGCTGCCCGGAGGCGCTGGAAA
      AGCTAAGAAAACTATGCAGACCAGATCCTCCGCATCCCAGCAGGCTACTAAATAAACGCCAATTGATGATGCGTGAAAAA
      GCCAAGTTGACAATTTTAAACTGTATCGAAAACGGAGCAATGGGGAAAGGAGCCGTTGTGCCGTTCGGCTAGGAAACTAA
      GACAAAAGTTATCAATATAGGGTTTTTCCCACTTTTCGCCAGTCACATTTATCATCATCGAAAATTTGCTAAGCAGACAG
      ATGGGCAGAAGGGCAGAAGGAAAGGAGAAAACCAAAGTATGGGGCCGTCGTTTAAGCCCTCGGGCCTCCATTTGTTTCCA
      TTTTGTGCCAGCGTCAGCAGGTCGAACGCTCTGGAACAATGGAGACACAGATTCCGACGAATCCGAATCGGGATCGGCAG
      GCAAAGTTGTGAAAGTAGGCAGCGGAAGTGCAAGTGCCGTTGCATTGACATTTCCGCTTCGCAGCGCTTTTTGGCCACAC
      TGCATCGGCATGGGGGTGACGATGGCAGTGGGAATGAGGGTATGGGGAATGGGTATCAGAATGTGATGAAGCGCGTAGGC
      AACTTGCGAAAAACTTTTGCTCCACTCGGCACTTTTCTCGCAGCCGGGCCTAAGGAAAAAAATCGAAAAAAATAACAACT
      TTCGGAGTCTTAACGTATTAATGCCGGCTCATTTAATAAGGGGCTTCCGGTGAATTACATATTGGAAGCTTTTGAGAAAC
      GGAAATTAAACCTGCATATTTTTTGACTGAATCTCTGTTATGTTAAGTTGTATAACAAGTTTATGGACTCGAAATTACGA
      GTTTCTTGAAAAACTAAACTGTTCCTAATCCTACGTTTTAATTTAGCATAAAGTATCTTGTTTTTTATAGTAAATTTAAT
      TTAAAATGTATTTAACGGTAAAAATATGCATCATTCTTTAGTTTCAATCACTTTCAGAGGTGTTATTATTTGATAATAAA
      TATATATTAAAAATTTGTTTCAATGTCGAAATGCTGTTGGCCATTTCGGAATCTGTTGCCCATTTCCTTATGGCATCAAA
      CATGCAAACAAGCAATTAAAAGCATTAAATGCTTCCTTTTAAGGATATTTAAATTTCCTTGCTCCAATTTGTCGCTTTGA
      CTTGCTCTTTCGTTAACTAAGACGAGATACAGGTGAATACAATTTTCATGCAATTTGTGCTTTCCTCGTTGGAACTATTA
      CTACACAAAATTGCCTTAAAATGGTAGAAAAGCTTAAAAAAAAAGCAACCAACCAAAAGTTTCCTTCACTGGCGGACGGC
      AGAAGCCAACATCAAATGAATTTTCATTGTTTGACTTTATAGAGATGGAGGCGGCGTTTGTGCAACTACTTACAGCTGGC
      AATGATTGTTGTTCGAGCTGAGCAATGAGAATGAGACTGGGGATTATAGAGTTATTCTACAGGACAATGACAAGGATGGG
      CGGGCATTATCTGGCGCGTTTCTGTCCCCAGACATTTGAGTCGGTATTTGTGCCGCAGCTGCATCTGCATCTTCAGCTTC
      AGCTGAATCCGCACTGAATCCGAATCGGGACCAGAATCTGGATCTAAATGGTCCAGTGCTGTTGGTTCTGCTCTTGACCA
      GCAGCTCGGTTGGCCGGTTGTTTGTGAGTTTTCGCATCACGTGGCACTGACAAAACAATGGGGCCAACGACAGCAGCCAA
      GTAGCCAAATGGCAGCTGTCTGCAGACCCACACTTTCATTGTCGTCCTCGCAGAAAACCCCATAACTGCCCCATTCTCAT
      TCATTTCGTCAGTAATTTTAGCTTTTCACTTGGCGACAGGGTTTTTTTTTTCTTTTTTTTTTTTTGTTTAGTTGCTGTAT
      TGCTGTTTGTCTGCGCTCGCGTTCCTTAATTAAAAAGTCATCATAATTTTCGTGCTGCAGCTGCTGACGTCGACTTTGTT
      GTAATTTTCTAAAGCTAATAAAATTGCTTTGTAGCTGAAGTGGAAATAAAGCATTTTAAGTGCTTGGGCGCTTATCGCCG
      ACGAAGCAGTTTCCAAAATTGAACCCAATGCACTTAGGCACACACCCAGCCAGCACAGAGCGAAAGTTAAAAAGGACTTG
      TTGAAAATTTTATGACATTTTAAAACTTGGCACCGAACGGGCACGCCGGGCCATTAAAATGTTATAAAGCAACATTTAGG
      CACTCAGCTTGATATCTCTCGCAATCTCTAGATCTTCATCTATGCTAACAAAGCCTGGAAGTCTCGGAAAAAGTCATTAT
      AGCCATACCCATATATTAAACACGGCAAACTCTCTTGTTTGCATTTCTTGTCCTTGGCAAATTAACAATTAACGAACTTG
      AAGAGATCCTATGTAATCCGGGCCTCGAACTTTTTGAAAATTGTTCAATTGTCTGTGCACGATGATGGTACTTTAATAAA
      GTCGTTAGCTTAAGGGTCGTAAACAAGGGAAGAGCCAATAAACGTATTTGACTTATGAGACAGGTAATCAGGACAGCTGA
      TTTCAGGAGGGATAATAACGATTTAATCATTTAGCGAGCGATGTTACCTTTTAAAGGAATTCTAACTCAATCAACTACCT
      TGTAGAATTTTAATTTTTTGATTAATGTTACATTGCTAATCACTCTCATAAGGCATACAATCCTTACTTGCTCAACTACC
      TTTGACAAGAACTACTTTCATACACTTCTTCCCCCTTTCAAGTAGCATAATTATTTTCTGCACCCACATTTCCCATTATG
      TAAATCATTTCTTATCCACTTCCATCAACTTCGGTGGTAATGAAGACACGCGCTCGATATTTTCTCTGGGTGGAATTCAC
      AAAAATTGAATTATAAGCAAAAGTTGGTTCCTAGAACCCGTATGCAGACCCCCGTGGGCCATGCATTACATGAAAAATGT
      GCTACGAAATGAAATTGAAGTTATTGCACTGGCAAAGCCACAACCGCAGTCAAAATGGGTGCTGGCTGCTGGTAGACGGA
      AACTTTCAGCCGGCACATGGCAGGTATGCAGCTTGCTAGCAGCGCCCACCTGGCGTATGCGTAATAATATTTTGCAGCTC
      CCCACGTATTTTGCATAATTTCCACTTGCGAAACTTTCACCACACACAAACAAAGACGAACGAGAATGCAAGCGCTGCTA
      TAAAAAAATATATATATTGTAAGTCAACTCAACTTAACAAACAGAAAATTAAATTTCAACTAATATACATTTTTTGAGCA
      CCCGCCAATTGCAACAAATTATGGTGGCGAGAAAAGGGAGACCAAACATGAAGTCCAAAGACATTTGGCTCTTGAGCAGC
      TTTCAGCGGTGACATTGTTTCCTCTGAATGTCACTTTTGCCCTGCTCCTGCGTCCCTGCCACATGTTGACTGGCATAAAA
      TTGTGTCACACATAGGGCGCCCAACTCTCAACGACCATCGCCCAGCAGGGGGTGGAATTTGGGTGGTTTTAGGGTGGCAT
      CGGGGTGACTCCTGGAGTGGTTAGGAGGTGCGCCACGCGTACCATGAAATTTGCATAAATTAAAGAGCGCAGAGTCAGCA
      CTGCCAACAGTTCTACTCGACAAAGTAAACGCGGGGAAAAAGAAACCGCAATAAGTTGTTTAATTTTCCGTAACGATTTT
      ATAGCCCTTGGTTACTTGTTGCATCGTGGAGTCATACTCTTGATTATAGTGCTCCCTTCGAAATGGAAAGTTGTTGCCTA
      AGTGGTATTGCTTTCAACGCTTCCTTTAGCCATTTCTATAGAATAGTAGTATATTTATTTAGATGACCTAGTCAATTTAA
      GTTTTCTTAAATTTTTATCTATTTTTATTTGCAATCGCTTTATACAAGTGAAAGTTTCTTCGACAAACTTAACAATCTCC
      ACAAAAAACTGTATCAGCGATTTCGTTGCAAAGAGCTAAAAAAAAATGAATAAAATATTGGTTTTTCCAGAATTGTTTTC
      TGCATTTTCAGCATTTTTTCTAAGCCAATTGATTTCTTGATTGCAACAGGCAAAACCGCAAAAGAAATTTAATTTATTTA
      ATGTTTGTGGGAAAATTAAAATAAATAAGTTTCTTTGTCCAACAACTAAGTTAAAAATTGTTAATTCCATTGAATAAATG
      AAAAAACCATAGTAAAAAAATTTAAATTTACTTAAATGCATATACAACAGCTTATTCTTTTCAATTTCGGAAGATGCAAC
      TGCTTATTTTTTTTCAATTTCGGAAGAAAATTTGAATGATTGTATCCAACCATTGTCCAAATCTGTATGTTCAATATAGT
      ATAGTATACATATATATCAATATTTGGGGAAAGCCATCGCACCAAATATATATTGAAGCAATGCAATAGTCACAACAAGA
      AAATATTTTTTTACCTCAAACTGGAATTTAATATTCGTTAATTAAGTTATATGATACTTATATTGGTTCACAGTTCGTTC
      GATAGCGTTTTAATTCAATTACTGTAAAAAAAATTGTTCGAATGAATTCCCGAATAAACCTTTACAAACGGTGAAATGGA
      ATATTTAAAATCACCATAATCAGATTTACGACAAATAACGGCCAAACGCACCAAATGTTTTCCACGTGCAACGGGGCGTA
      TGCGTAATTTTCAATTAAAATCTAGAAGACCAACGCCCAAAATGCATTTGCGATGACAGTTTCAGTTTCGGTTCCATTGT
      CGTGTTTTTCTCAAATGACGGAAAACAATATTTTGAATTTGCGTGAGCGGAAAATGGCCGAGCAATAAGAGTGGAAATGA
      AGGCTCACCGAGAGCGACAAGGGTTTTCGCAATGGGAAAGGCACGCATCGCAGCGTTGATAAACTGTGCATAATTTTGCA
      TATCAAAAGCAAAAGCAGCAATTAAGCCTACATGCACTAGATGCACGAGAGCTGCATCATACAACAATTGCTTTTGATAG
      ATAATTGCTGCAGATGTGCGGGTGTATGGGTGAAATGCTCGTCCCTTTCACACATACATATATACACATCCTGTTTTGTA
      CGGCACAAAAACTCTCCACACTCCGGTAATTTTCATAAAATTAAAGCCACAACAGATTCACGAGGGCAGTCCAATGTGAA
      AAGCAATTTGTTAATATCTTTCAAATGACTAAATTACAAAATATATATTAAAAATATTACATTGCTAATGTAGCTGTGGC
      TACAATTATTTTATTTTCAGGATTTCAAAAAATTTAACTAGATTGTATTACCTGTTTTGAAAAATTATTTTCCTTTTGAC
      AAAATTCTAATGCCACACCTCGCTTCAACGCTTTATTTCGCCGTTTTCTGTTTATGTATGCATCACATTTTCCACGCATA
      AAATAATTATAATTTCGTGCGTGCTTTGATTTTGTGCCACTTGACAATTTTCCATTGAGTTTCCTGTAAATATCAAATTG
      CAAACGAGCGCAGGACGAGGTCCTTATTATTTAGCCCATATATATACATACATATGTACATATAATATAATGAGTATGTT
      TGTCATATACGGGAAAAGCCTCTGCCAGGGGGTATTATCACCAATAGCAACAGTTAATAAGTGTGGGAAATCTGCGATCT
      TTTTGATGAATTTGATTAAAGGGAAATTCTGCTGGCTTCAGTGGAGATGCAGACGTTTGTGTTTTGTGCCATAAGCTATC
      AAAATTGCCGTTCGTGGAATGGAATTTTGATGAGCAATAAAAACACCTGCTAGTGTTATTTTCACATACTTCGATTTAAG
      TATCGCTCACAAAAATCGATGTATGTGAAAATTATTCATTACCTCGATGGAACCTTTTTCAGTTTATGGCTTTTAAACGT
      AAATTAGGACAATTTATAGTTCGTGATTTTTTTTTATTATTACCTGTAATCCTTACATATCCCATCTAGACACTGGATAT
      TATTTTCTTTTCATACACAGGTAATTGCCATTATTTTGCGATTTCCCTTTTTTTCCCTTGAGAAAACACCATAGTTTTAA
      TTAGTTTTCTAATTAATTGGAACAAGTTAGGCATGGGGTTGCTTCATTCCATTATTTTAGCCTGATTATTAACGTGTTTT
      CTTAGTCCTGGATAAGGTTGCACCGAGATTGCGTGAGCTTTGTTTTACTATGAAGTATTTATTGTACTATAAAGTACTTG
      CGTATCTGCTATTAAAAATTCATTGCCTTCAAATCCAATTAAATTTCTCATTAATATGCATGCGAAGTGCAAAAGAACAC
      CTGCTCACATATTATATCACCAAAGTCGAGACTTTGATCTTAAACGCTATCCAGCACCTATGTTGATTATACAAAACGCA
      AATGTATGCTGACGTCACACAGCTCTTGACCTTTGGCCTGAGCCAATAGTTTAAAGGTGACAAGGGGGCATAAAATAATC
      ATGCCGCAGCTTTTAGCCAATTTCTGGCTCATTCATTAAAACCCGCTTAGCTGGCGAAAAACCAGTGGAAAATCTGTGAA
      ACGAGCAGAGAGTGTAACCTACATCATGCGGGTTGTTGACATAAAAATTACGCGCATGAAAGTCAACAGGGAAAATGAGT
      TAAATCAACATCATAAGCTAGCGTCATTTGAGGAGTGGAAAACGCTGGAGAGGAAAACAGGATGAAAAGCTGAAAAAAAA
      GCCGCAGCGAAATTAAATTAGTTGAACAAAATGCTGCCGAGGCTTTATTCCATTTATGTGGGTATACTTAAATAGTGCCA
      ACTCAGAGTGAAAAGACTGGTTTTCATCTATGCAAACAATACGAAACGCCCTTTTTAAATAAATTCAATTAGGTTCATAA
      GTGTAAGTACCTACTTATGAAAGGATATTCACGCTTCGCCTTTCAATTTCTGGGTTACTTCTGGTTGCTTTCGTTATGAG
      CCAAGTCAATTATTGACATAAAGCGGTAGGAAAACTGAAGTGCAAGTAGAGTAAACATAATGAAATGGAAACGGTTTATT
      TAATCAGTTAATGAGCATGAATCAAACAAATAATCATAACCAAAAGACTATAAATGGTATATTTTGACACATATGTTTGT
      ATAGAAAGTTACAGCAGTAAAACACTGATAAATGAAATAAACAATTATCAATAATCATTACTCAACTTTTTAATTTAAAT
      GAATAAACCACAGCTCAGTTAAAACTATTAAAAACAAATTAAAGTAACGCGATTTCCTTACAGTGTTTTTAAATCGAAAG
      AGAGAAATTGACAAATAAACATTTTCAAGGGGAAACAGGAAAAAGTGTCGGTTTGGGATTCAGCTAAAACGCTAAGCTCT
      TAAGCGTACTTTTATTTATTTATATAAAACGCTTTTTATGACGGTCTGTTTGCAATGCATATTGAGAACAAACTCGCCCA
      TCGTGCACAGTCATATTTATATACAGTTCTATATATATTTTTGCTAATATTTTAAGCTGATTTCCGCATGGAATTGAACG
      ATAACAAAACAAGATATGCGGCCACCATTATAAGCCTTCTTTTTTTTTTGTGCATAACCATAAACCAGGCTTATGGGCAA
      AAAAAAAAATCAAACTAAAATGTAGCCAAACAATGAATAATATTTATGCAATGGCCACAAGGATTTAACAAAGTGATTGC
      AAAGATACAAAAGTATTAAAGTTATAATGCGAAAATGAATTTGAATTTCGAGTGATGAATAAATACTTTGTCAGATCTTT
      TCATTTATTTTTGGGTGCAACTTCAAATATTTGTTTTATTCGGATTTGAGCCCAGATGAACCAGAATTCAATTGAAGCAA
      TAATTGCGCACATAAATCAATTCTTGGCATTCGAAAATGATTTAAATATTGCACAAATATTTTGGACCAAAAAACAGTCC
      AACTAATTGGACCACCTGCCAGTTGTCAAGTCATAAAACGGAGTAAAACGCATATTGAATAAATATAAAATAAATAAATA
      AAATATGGTCGAAAAGTGGGCACAGCTGAATATTTTCAATATATAAATAACAACGCACAAAATAAATCAAAAACCATTCA
      AATTCCTCTCCATCGGTGTGAGATATATACACAAATGAAGATTCGGTCCTGGCGACTGATATAAAAATATTTTGTGCCTA
      TTTTTTGGCACAGTGAAGTACATAGCAGCCGCTTTCGGTTTATTCATATTTGAGCCAAATGGATGAGAAACAAATTTAGG
      GCCAAAAATGGTTTACCATGTTTTTCCATTCTGTACACAACGTATTGATGGACACCGTTTCTGATTTGTTGATTGTGTCA
      ATTTAAAATGGCGTAAAAAATGTTTGGCCGATTTTATTGATTGCCCTATGGACCATATGTTCTAGTTTGCGGTAAATGGA
      GTCGTTTTTTTTCTTCATTTTAGTATTATTGATTCGGCACTAAGCCGAAATGAATATACATATGTATGGACATGGACAGG
      TATGTATGGATGAAAACATCAAATATGTGTAGAAATATCTAATCGAATTTCTATTTAATCCCCGGCATTAATCTGCAGTA
      TTGACTTGCTTAATTACTTTTTTGGTATATTGTTGGTAATTATGTCAGGCGCAACATGTAAACCAATTAAAAGTGATAAT
      ATCAACATTACCATAATTCCTGTTTAGAAGCGACAATGAAAACTACCCAAATGAGTTTCATTAATTTGCTTTGTAAATCG
      TTTAGAGCAAATATTGAAGGTTCATTAATATATTCATGTTTTAAATTCGCGCTATAATTAATTATTTAATAGTATTAATA
      GTAAGCCCATAAGTTCATTGATTCATATTAATAACCAAAAATAATACTTTCAATTAACAATCAGCCAATTAACGATATCA
      ATTACATAGGAATAATCAATATGTTTTATGGCAATTATGCAACTCAAATTGATTTTGAAATCGAATGTTGGATTGACACT
      TCCGTTTCCGTTCTATTAAAACACATTTCCGGCGCATTCATATGCAAGCATGTGTGTATGTTCGAAACCCACAAAATTCT
      ATGCTCAATAGTGTGTTTCTCTTATATTTGTTTTTTCCCCATTTTTGTTGTCGATGCTGTGGCAATAGAAAAGAAAGAAT
      AGAGCGAGTTTCAACTGCCGAAAAAGTCTGTAAATTAGTATGTGATATTTCGGATAGTTTGCCCTTTGGCGAAGCTAAAC
      CGGAAACGAAAGCTGTGGCGGGGAAATGGTGCAAAAGTAAGGAGGGGATTGTGTAGAAGGTGCAAGGGGGACAGTTGTAT
      GCTACATGACGACGGTCAGCCCAATCCAACCGCAACAAAACCAAAACGCAAAAGCAAAGCGCAAACTCCAATTGCTACTA
      ATTTCTGTTTTATGGCCCCTCGCATAGACACACCCACACACACGCAATCGCACACACACACACACACATGCATACATGCG
      TGCTTTCACAAACACTCTCGAACACGCACACATTCATAAAGCGAAAACTTTTGTTTGCAGCGTTGGCCGCAATGGCCGCG
      TGGTTGGATTTCGATACGCTTTCAATTTCCTTGCGGGCTCAGATCACAGCAGCGAAAACCAAAATGCTCAATGAATCCGA
      ACAAGCGAACAAAAAAGAGCCAATAACATATTCGATGTCTGGTTTTGTGTGCCAAAGAATGAAGTTTGGGATTTTTGGTT
      CGCCATTAAAAGAAATTCAAAGCCAAAACCGGTCAAAGCGTTCATAAAAAAATTGCAATTAAATGCCTGAATGATTTTGA
      AGCTTTATTAATCTGCATTTTATATTATATAATTCATTCTTAAATATTCATTGAATTTTCGAATAATTCGAATAACTGAA
      TTGTTCGCATATATGGATTACAAAAATCATTCATGTGAGTTCGATCTAGTGAAATTTGCTTGACCAACTTCTTAGTCATT
      TAGTTGCGATTTTGATTTAGTAAAAGCTTAAAAGTGTCGAAGCTTTAGTTGTTTCAATTTGAAGATATTTCTATTTCTTG
      TGACTATTTTTTTTTCGATCCCAAACTATAGTGAATGGTTATTGCAGTGGTAAATGTGACACATCATATTTCAATTGTAA
      AGTGTAGACCATAAAGTGTGGCAAATGAAGAACACTAGGACATTAATTAGATAGTAAAAGAATCCATCCTTCTCTCCTCG
      TCGCAATGCGTCAGTAAACGAGCGATTAAGTGAATGATGCAGAGCTACGGCAACACTCGGCGTATAATTAATTTTAAATG
      AGAACGGCACTACCACGTCCTGTCACATCCGTCCAAACCGCTCGTCCCCTCGTCCCCTCGTCCTGCCCCCTCATATGGGT
      TTGCCTTGTTGTCCTGTTTATCCCACATATCCTTAACTGTCCAACTCGGATGTGTCTGCATGAGCGTGTGCAGTGTTTGT
      ATCTTCCCTCCTTGCCTCTAGACGTTGACAGTTTTATAAATTTTCCATTTGTTTTATTTACAACATTTACACATTGCCAT
      ATTTAATGTTTAATTATACTGCGAAATTAATCACCGCTTTTTTCAGACTGTCCTAGTAATTAACCCTATTGGTTAATCTT
      TCGGTGGTAGTAAAAAGGTAATTATTTTGTTCGGTTCATGTGAAATCATTGAAATAACTTACGAATATATTTACATTGTA
      TAAGTATGTATAAACCGAAATAATATACATCAAAGTATCTCTTTATATATATATATGAATTTTTAAAATATTTATTATAA
      TGTTTTATAAAATGTGTTTGATAGCTAAATTAGTATAACAAACTGACTTCTTTGTTTTCAATTAGTTGTTCTATTAAGAC
      AGGTTTAAATTGATTTAAATGGTTTTTTTGTACAAACTTTTTTAACTGACTCAATCGAGCTTGCAGTTGATGAAAACAAT
      GCCTTCAAAATATTTTTGCAGTAGCTCGAATATTTTTCATATTTCGCATTTCGGCAGCCCTTGACCTGTTCCAAAATAAA
      TGTGTGTATAACGACCAAAAAGCCTTTTTGACTATTTTCGTCAGCATGTAAATATTATTTTTATACTTTGCCATGTAGGG
      AACAAGAACACACACATACACGCACAGACTCGCATGTCAAAAAAGTTTACACTGAGCAAAGAGTTGGGGGCACACAAACA
      CGCACACTTTGGGGTTGCCTGTTTATTCAATCAACAACAGGGGATGGAAGGGGAGGCTTGTACTTTTTGAGGAGGGGCTG
      GAACTCAATGCCACAATGCAGGAGGACATGACAAACGCAAGATGACAGTTGCCATGTTGAAAAGTGTCACAGATACACAC
      AAGCACACGCTCACTATCTGCTCAACTCCCATGCATTTTTGTTCCCATGCCAGACTGACTGCAAAGTTTTTCTACTATTT
      AAATCATGACAGTTTATCTAAGCAAAAAGTATCCTCATCCCACTCCAGTTTGACTTCATCTCCGACGGACGGAAGCCGCA
      ACAGTTGCCACACCTTTTTGCACAACACCCAACAGCAACCGTTCCACACAGAGGGACTATCACGGCCCACCATACCAACC
      ATACTCCACCCACCGCCACATGGACCACAGGAATTTTCTCGCTGTTTTTGGCATCTTGTCAAGTTGCCGTCAGTTGGCCG
      CAATTTTCTTGTTTCTTTTCCATTTTACCAGCCTGTTTCCTTTTCATTTTACCTAAAACTTTGCCATTTCCATTGCGTGA
      GTGGCGTCAATTTAACATTTCTTTTGGCTTTCTTTCAACTGCCTTATAAGTCCGCAACATCAGCATATACACCATAAAAA
      TTTAAGTGTATTAAGTTTGCCTAACCGAAATCAAAGGAAAATGTCAATTTTCCGTATCAGACTGGTGATGTCGTAAATTA
      ACGCCCTATGTAAATGACTCCAATACTGTATAGTATAGATGGAAAACTTTCCTTCACACCTGTGACCCCATTAACCCAAT
      AGAGTCGGAGCCCCAGTGAAAGGCAACAAGAATGGATGCGCCAACTTGGCTAATCAAATTAGCGCCTGTTGTGATTTATA
      GACCGCGCCATCGAATTTCCATAAGGCCAAAACCATATTTTAATTTATGCAACTTAATTGAAATGCCGTAAAAAATCAGC
      CAAGACGAAAGCAAAGGAAAACGTGTAACTAAATTTATGCATCCTTCATCATTTTATTGGGTTAGTTTGGCCAACTAGGA
      TTTGTAGGGTAAAAAGGGTTGTTCTGGGCCCAGGGAAATGGGGAAGTGAAGAGGTTGACTTAAATCGTTAAAAGTGATTT
      TAATGCGAGTATTTAGTATGTCAAGCCGCATGTTTTGCAGCTTAATTTTGGGAAATTTTTGTTTAACCAATACCATATAT
      TTTGGGTATCAACATTTTGACTATTGCACGAATATAGCTTCGAATTTTTCTTTGATGCGTGTTAGCAACTTTCATGCGGT
      GCGTCGCGTTAATAAACTTGACTATGTGGGTCGAAATCGATTAGCCAATTTGGCCTCCTGGGACTAGTTGAAGTTTTCAG
      CTGAATCAAGCCAAATCGTATTTCTAATTAATTAAAAACATGTCAGGAGCAGCAAGTGTAGAGCGTACCAAAAGTAAAAT
      GCCCCACACATAGGTGCAAGTCAAGCAAATTACATACATTAAGTATACGCATTGTGTACAAGATAATTCTGATGCCGGAA
      ATTACCAGGTGAGTCAACAATTCTTCGCATTTTTTCCTGGTTTCCTCTTTTGAGGGCTTACCATTTTTTTTTTCCAAACG
      TTCGCGTATCAAGGCAACCTTTTTGAAACGCATAACAATAACGAAAATTTGAAAGAGATAAAAGACTTGAACGTGGGCCG
      GAAAACGGAAATGATTATTTCAGCTCCTTCGCCATCTCATCTTCCTTCGCAAATGGTCGAATTGGGGTTCGGTGGGCGGG
      GCCATGAAGGCGTTGGCCATTGTTGTCATTGCGCCATTGTTCCATTACTGAATTTTGTGCCGTTGATGCTGCTGCAATTC
      CATTTGCCCCGGCCACATTTTTTTCATCTTGGCCGTTATCAGTGACAAACGGCCGGGGTCAGGTCGTAAACAGGGGTGGG
      GAAATGGAAGCCTCTACGGTTATTCGGAGCGGATAGGCACACAATTTACACATTTAAAATTCAAATAAAGTCATTTGCAT
      GCAGACGAAATGAGCGGTTCGGCCATCTGGACACTGTCGCAACATATGCGACACCGTCTGACCTTTGAACTCGACCCCTC
      GCCTCAGTGGATTTTTGTTTTTGTACATTTGTCATCATTAGTGACCCGACCTGGTTGGCCAAAACAAGAAAAAATAAATG
      TGCGCCTAAAACATAAAGGTGGACCAACGAATTTGCCGGAAAAGCCCCTTGCAAAGTGGCTAAATGAGCCAACGGCCAGA
      ACTGGCTTAGCAAAGTAGTTCGGTAAGGCAGCACCAAAAGCAAGGCGCTATATTATTATACAAGATTAAGAAGTGGCTGA
      AAAATTTGAATAATGTTTTTAAAGGTTCAAGTAAGGTAGCTTACTTCTCAACAGGAATTTAAACTTCACTTCATTTACAC
      TACTATGATGTTAAAACTTAATGCATTGGTTTTTTAGCAAACCAAATTGGACAACGTACCAATTTTATATATTCCATATC
      GATTGATGTGTTACTGGCATTAAACTGAAATGAAAAATTAAGCTATCCTCTCAATGTATTGACAGGCTTCTCAAGCAATT
      TCAGAGTTCGCCACTAATCCAGACAAACTCGGCTTAATTACTTACAAGCAAATTGAAACCATAAATAAATGAAATGCGTT
      GAAACAAAAACTTCAACGGCGGGCAAAAAAATATATACATATATTTGGGGCGCGGAGCTGAGAAGGAAAATCGGCCTAAT
      ACCCATATTGATAACATAAGCCGAATGATTTACGGCCTGGTCAATCAACAAGGAGCGGCGAATACGGCCATAGTCCTTGG
      CTAAGTCGTATCGATTTGACTTTTGATTGATATTTGTATTGGGCTTACCGGGTATTTGGATGGGATCAGGCCAGGTTTTC
      AGGCATCAGGCATAAATCCTTTAAATGAAGTTACAAAGTTGGTTCTACCGGGGCTTAAGAGTATCAATTTTAATAAATTT
      CCGCATGTTCTGCCATTAATTTCAGTTAATTTGCCATTTTTCATGCTTTGCCACACGACACATTCGGCACGCTACTACCA
      TTTGGCCAGGACCTTTGCATACAGGACCTGTGCCTGTACATCAATGACACACGGCGAAGAGGCACCGTAAATATCCTCGC
      AGCCAGCCAATATGTTTACACGCACAGGGAACTTGGAACTTGTGCCATGGCTTTGGCTCTTCCCTTTGGCCAGGAGATTT
      CCGTTTCCGGTGGCAGCCAGGCTGCTCAATGGATCATAAATTTCGCAATGCATCGTAATTCTTTGTCAGGTTGAAGCGGC
      TTTCCAAAAACCAGCAAAAGTGGCAGAGAAAGAGAGAGAGAGAGAGAGAGCTACAAGTTGGCCATTTGTTGGCGCTTTGG
      CTAATAGTTGGCAAAAGTTTTCGACTACCCATTCCATTCCGAGATGAAGGACATCACAATAACTGGTGGAATAAATATTG
      AAATTGCCAGAAAAGAAAACTTTCAAGGCGCTCTCTCAATATGCTACAAAGCAAAAACTTTTTTAAGACAGACGGCACTT
      GCTATTTCCAAGTTTCTGCCCCTGACCAAAGCTAATTTTCCCGGCCGGTTAATTATTCAAATGGATAAGTAATCTCTTGG
      TAGTCTTTCAGAGTTATGCTTTCCCGAAGATTATTGGGAAAATGGTTTGATACTGAAAGGAGTTTTAAGCACCTTTCTGT
      CCAGGATTTTACCTTGATCCACCTTAGTAAATTTCCAGCAGAGTTGGATTGAAACAAAGGCAAGTCGAACCACAGAGTTC
      GGTACTTAACATTGAAGTGCTTTTCGGTGCAATTGTTTCGCAAATGAGTGGAGGCTGAACTTTTTGCGGTCCGTGGCCAT
      TGACCAGCTGCTGCCCTATCGATTTTATTCCCTTTATGATGGGCTCTTACCTGCCCGGGATTATGGATGGCTCTTTGGCC
      AGAATGTAATGGAGATGAAACCAAATTGTATTTTGAGGCCTTTAAATCGGCTGCCGGAATATATAATTATGGAAACAGGC
      ACTGTTTTTAAATTGATGATGGTCATTGGATAGAAATCATAGGCAAATAAATATAGATGATTCACTATTGTTTAATAGCA
      CACTTATCCATATCCAGATTTTTAGCTTCTCTGTTACAAAAACAAGCAAACAATATTGTTGAGGTGTCACAACCAACCGG
      CGGCGTTTACAAAAAATCAAAAATCCAAAAATACACGAAACGGGAGATGGCCGCAAAAATTATGCGCAGGAAAATATTTT
      GATAGAGGCATTAAACACAGTGCCGCATGGATAGAGCAAAAAGTGTAATCGAAACGCCTGAGGGCATATGAAATGCATAC
      AAGTCACACTAGAAAACATACTCGTTTATCATACGAATTATTCAATTGAAGCAAAAGCAACTGCTGCATTTGGCAGCCGA
      GAGGATTTTTCAGGTGGCTCCTTTTTTTCCCCATTTTTTTTCAGCTGGCCCTCGATCTTTCGGCGGCATGCTAAATGTGG
      AGAACCCGATAATGACGCGGATGATGAACGCCTGCCACAGCCACATTCCCATCAGCAGTGGTTTTCGCATCCAAGTGGCC
      TTGGCGGTTAAAACTGCTCACCGACCGAGTGAAATGTAAAATCAACTTCGACTTGCCATGGAGGCAAAGAGATCGAATCG
      GAAACTGGCATTGGAAAATCCATTGACCAATGCACTCTGAAAAAAGAACCCCGCAAGTGTAATTAATGTTGAATGAAGTA
      GCACTGAATCCGTTCGTCGGGTTGTTAATCTAGCACAATTTATATAGTTTTGCCTTTAAAGATGCTCATTGCTGGTTGGT
      AAGAAAATAATTATTTAATTATTTACAAAACACTAAAATGATTTCATATTAAATGTTGATAAATTTCATTAATACTTACT
      CTATTCTTGCTGAACAGGAATTATAAAATTCAGGTGCAAATAGTATTATATTTTGGCAGCTTGCTTTTCAATGAGCCAAA
      CTCTCCATGGGTTGAAAAATCTGCGCCACAATGGCTACTAAACCATCATACCCATCAAAACGTGCCAAATTGACCACAGT
      CACAATTAATTTTGCACTCTTTCTGCTCCTTTTGCACATGTGGTTTCTAATTAAGTGTTGCAGATACTCGGGAAGTGCAA
      TTTCACAGACACAAGCACACACACACACACACACACACACACTAATGCTCAATGGGCTAACCAGCTTCAACGCCAGATGG
      CGCTAATGAACTTCCGCTGTCAAATGAAACGCTTGCCATGCAAATCGCACCATTTTCAATAATTGAAGACGCCTGCCACC
      GCATTGTTATTATCATTTTCATTTTGTGCTTCCGCCACTCGACTGTTTTTACTTTTCCTTGGCTCATTCGAATTTTTTTC
      TCATTCTTTTTGCACGGGAGAGTTCCGCACATGATTCACATCCGTTTAACGCCATTTTCTTCTCGATGGCCCCGGAAAGT
      AGGCAACAGTTTTTTCTTCGTTTCGCCCGCGTTGACGTTCATTTGCTTCTTCTTTCGGTTGAAGCCGGCAAATTGCTCGC
      ATTTAAATGCAAAAATTGTCGGCACGTCTAGGTGTTCATGATGTCCCACCTGCCCCAACACCTTTGCCCCACCACCTATT
      TCTTCCCCTCCTTTTGGCCACCGGAAAATTTACTGCTGCGCGTGCGTTTTCATTTGCTTTTACTGTCTTCGGTCTATCTT
      TCATTTTGCTTTGCTTTCTCTCCCCTTTTTTTATTTTATTTATTTGCCCAAGATTTATGTCACATGCAGGAAGACAGGCC
      TGTCGTAATATTTTCGCACGAACACACACGCACACACCTGTGGGTCACATACGCAGCCAAAAGGTGTCTGTGTACGTGAG
      CGTTATGAATATGTATGTGTTCATTATGAAACGAGTGGATGGGGAGGCTGGGCGGAGTTTTTTACAACACCGGAAATGTT
      CCACAACTTTGGACTGGCATATGAATTATATTTTAATCATCCAGCCAGATTCTGTCGGCGTTTTAACATTTGCATTGTAA
      AGGCTTTAAAAAAAAAGGGACAGAAGATCTAAGCTTTTGAGTTTATTGAACTCTGGGGTGCAGATGACATAGTGGAGGTA
      AGGTAGCCGAAGAGGAAGTATTTATATATCAACCGTTCTATATTCTTAACGTGTTTTTCATGCACGAATATTAAAAGCAA
      AAAGTACAAACACTGACCGAATTCCAGAAACAATTTCATTTGCTGATAATCGAAACACCACTAGCAATTTAAATATGAAA
      GTATGCTAATGAATTGCAGGTAAGTATTTAATGTTTAATGACAATGGCAAATGATTTTGCATATGGAAAGTGTCATAAAA
      TTTGGCAAATGAAATGTTGAAATTGGAAAATTTACGCCAAACTGCACTCGCAAATTGTGAATTGCCAGTGGCCGGGACTC
      AATTGCCTTGTATCGCAATGAAGTGAAGTGCTTTGGGGCCGGCCTCATTTGCCAGCGGGTCCTGTCAAATTTTCAGCGAA
      TTTCCCATGGCCAATTCCAGTCCGCTTGTGTTATGCGTTACGGCCGATTCAATCTGCCGTCGGAGCCCTAACAACATGGC
      CAACAATTAAGCCGTGCGTGCAAATTCTGTGCAAATTTCCCATTTATCGATGCCTCTAGTGCCAGTCATTGTTGCTCGAT
      GGCGAAAAGGACTCGATGCATTTGGTCCTTTTTCAAAACCGCAGACGCCCATTTTCAGAGCCGAAAACGACTCCTGGGTG
      CCATAGATGTCCGCTGACATTCGAAAGTATAGAATCGATACCCCTCCATCGGTCGCCATAGCTTTTAATTCAAAATACCA
      GAGTGCTAATTTATTTTCCATGTTTCGTAGCAATAATGCGTAATTAGTAAGCCCCTCTACAAAGTAGTACAAATTTTGCA
      TCTATGAGCGGGTTACTATGTGGGTCATTAGCTCTCGGATTCATCCTTATCCCTTCCATTTCCTGATTGAAGTCAAATGG
      CAAGCGGAGGCGAACTTAATGAAATGCCAGCAGTAAACGAACAAGCAAACTGGAGTGGCAGAAGGCAACATGTGAGCGGG
      AAAACCAGTGAAGCAGAAGAAAAGCAAGAAAAGTGCTGAATGAAGCAAAGGGATAAGCGTTTTCTTTTTTCTTTCAGGGT
      ATTTCTTCTTATGAATAGCTCACCTGTTGTATAAATTTTCCAACTTATAGTCGGTTAAGTCTTAATGAATTCAGCATGTT
      TATGTTCCGCACACATCCGAGTTTCACAATCTTCTTTAAAACAGTACAAGCAGTAAGGCATAAATCTTTAGATCAAACCA
      TTTTCCTAAACGGATAACAATATATTACCACTTGCCTTAACGGAAATTAAGGCATACCGAAATATTCTTAAGCAATATAT
      CAATTAGTTTTATTAAGGGGTTCGTCGTGACAGCAAAACTGCCATAAATCATAATATTAAGCCCACAAAACAAATTATAA
      CTGTCTTGCTGGACAATAATGATAGCAACCGGAAATATCAAGAGGATTCGCAATATCTGGCTAATAGCATTGCATTTAAC
      TTTTTGCTCACAGCTAATGAACATTTTGGATTAGCTTCAATTTTCAAAAAAACAAATCGTAATCAGCAAGTCATGGTCAT
      AAAAAACTTTCGCTTATAACATACGCAAAAATAAATAAATTCGTCTATTTTTTTGGCATAGTTATCATTACGAGCGCACT
      TTAAAAGTTTTTTTCTTTTAATTGTAGTATAATTAGATAATAAAAGATGTGTGCTTGAAAAGACTTGTGTTAAACATTCT
      ACCAAGTTCATGCACTCTTATTACCTTTAAAACATTTCCAATCATTAGTTCCCTTCAGGTAAACCCTAACCAACTTCTCA
      ACAAGCTGACCTTTCTGGCATCACAAATTGCAGCTCATCGTCGTCGTTGGCCATGGCTCACTGGCTTAACTGGCTTAAAC
      CAATATGAAAAGAAAGAAAAATACAAATGAAAATAAAGTAACGAACTTGTAGCAAGCAGTACAAACAAGTGAACAATAAA
      ACCACTTAAAAGGCAAGCAGCAGAAAATTTCCCTCAAACCCGAGAGCCATCCAGACACCCACATATAAAAACTAACACGC
      AGAACAGTGAATGCAGAAAAAGGAGTGGCAGGATACTGTGAAGTAGTTACAGCAGCAAACAGGAGTAGTCAGAGTGTCTG
      TCCTATATAAAAAGCAAAATAATTGGCGTATCAGACATTTTGTTACGCCCAATTTAAGTGCTTCCTTGTTGGACACTTTA
      AAAAAAAGTATCTTTTTTTTGCGAGAAGTGCGACTCTTAACCCAATCTCCTTGAAATAAATAGTTCATACACTTTAACAT
      TTAAGTTAAAAAAAAATCTTATAATTTAACTCAAAAATGTTACGTTTCATATACCTCAGAGCTTATCCTATCGGTTTGGG
      AATAAGTCGAAGAAACTGTACCGGAATATTCTGCAGAATTCGTGGCGGGCTCTGTGGGGGATTCTGGAGTCAAATTTGGT
      GTACACGCTACATTGGAATCTTGAACGGATTCCGTTTCGGAATCACCACCAGAACATGTGGTGGAGTCCGAGAAAGAACT
      TGCGTTAGAATTTGCTGGGTGTTCTGCATGAAAATTTACTTCAGTACCAGATCCGTTTTTGCAATCCGTAAAGGAATCTA
      TTGATGTGGTTGTAGAGGAGGATTCAGAAGAATCCAAATCGGAATCAAAAACGGAATGGTTTTTAGCAAGCAAATCCAAA
      TCCAACTCGACTGCCGAAGTATAAAAGGTCTGTTTCACATTAGGAGCGGCATCCAAATCTTCGGTAGAACTTGTACCTCC
      AACAGCACAGTTATATTCTCCAGGCTCCTTCAAATCTTCCGCGGAATTTTCTGATGTCCATGATTCGTTTACCGTCAGTG
      CATCACCAATTTCATATTCCATATGGTCCTTCATTATCAATCGAGCTACAAAGCTTTTAGGTGAATTTTGTATTTGCCGC
      AGATAGCGAAAAAATACATCTGGGGAGAGATCGGAGTCACCGTTTGCATTGAAAAGTGATAAATATGGACACTGTGGATC
      CTGAGCCCAGCGCCGATTGCCGCGTATTATAGATTCTGACTGAAAGGTTTCCGTATAATATTCGAATTGGCTCAGCATCG
      CATTGTGTAGAAAGTGGCATAGGACATTCGCAAGTTCTGGTCGGAGATCTTTAAGATTGCTCGTCCATTGAAGAATAAAT
      ACGGCTGGAATCATAAGAAATCTTACCAAGCTCAAAACACGTGGAATGTATTTTATGCGCATCTCATAGTTTGATATTAG
      CCAGAGCAGAGCTGAATAAAAAATCTGAATAAATAAATAAAAAAAAATTACAAATACATTAGAAAGATAAATTATATATT
      ATATAGGTATTAAAGAAACTAAATGTCAACTTTTAACTTTCTAGCTTTTATAGTTCCTGAGATCTCGGCGTTCATACGGA
      CCCCTTTACTCTACGAGTAACGGGTATAATAAAGACTCTGTAACTTTCATACCTCGATCTCGTTTTGTACAGCCAAGTGT
      CTCGATCTCAGCAGAGTGCACGCGCCGTCGATATCCATCTTAATGAACTGTCCATTGGACACTAGTACCAGGAAGGACTT
      GGTCACTCTGGACACCATCATGTCGGCTACCTGGGTCATACCCATATCTTTGGCCTTCAAATAGCAGCTAAATGAAAAAA
      GTTCGCAATGGGTTCGGTAGTCGTTAAGAAACTCAAAGATGCGCTTGATCAAGGGAATGCACTGCAAACATTTTGCGGCC
      GCGAGCAAATTTATTATCTTGTCACGTGGCAAATGTATCGCATTATTAGTCATCCAGGTATAGGCCAATTCAAAGCACTC
      ATTGCTCATCGCGTCCCTGGGAAACTTGACTATGTCACCCCGCTTGAGGTTGTTGGTAAACAGCTTGCAGTAGATGCGGA
      GTACGAACACTTGGCACTTGTAGATTGTATCGTTAACTATTATATAGGCATGGGGACCGATATTTCTTTCAAGGGCAAGT
      TTTAGTTTCTTCTGCAGGGGAATCTTCTTGTAAAACACAGCGTTACGGAGGATGTTGTATTTCATATGCTCCTTCAACCT
      ATTAGACATGAACTCGAACTGATGTGTAATGTTCTTCATTCCGCCAGCCTCATTTTCTGTTGGGCCATCTGACTGGGATA
      CATCCATTATGTAAGGCTTACTTCTAGAAAATATACAAAATCGTAGGTGCAAAATTGAAAGATGAAATTCTGGACAGTGT
      TAGAAAAGGAGAAAAGATTATATTTAACAAGTGTTTGCTGATCAAAATTCTGAACTCCTTAAAATTAGTTAAGTGCTTAA
      TGTTAACGTTAATATTTATAAACAGTGTAACATTTGTATTTTTACAACAAAGACAGCACAAATTTAAGCTGAACTAATTA
      AGTGGTTACCCATTTTCGCAAATACTTATATGAATATTTTAATAATGCCATTGACATGCCATCAATACTCATAGGTAAGG
      CTAAAGAATTCTTACAAATTAATCAAGTGCATTCAGCTGACATATTGACAATGTTCATGCATTTATTTTCGTTCACTAAA
      TGCTTCCGTGTGGTCGCTGCTCGATTGAATTAAAATTCATTAATTTCCCATATTAAAATGGCATTAATTAAATACCAAAA
      CGAACGACTGCTGAGTTGTGGCATTTATATGTTAATAGTCATTCGATGAGGAGTAATAAATGCAAGTCACACGAACAACA
      AGACCTTAACGTAAATCACCATTCTTGCATGCTTAATTTAATCAGCAATTCAATCGCAATCAATCTTTTAGGATAATAAA
      AATCCCTTACATAAAAAGCGAATACATACAAGTATTTCGTTTATTTCCAGGGTAATCCTTTTGGCCCGAATTGTGCTTAT
      TAAATTTTGAAAGTAGCGAAACATTTTCTAATATTTGCCCAATCCTCATTTAACCTCGTTCAAAAAACAAACTAGCAGCT
      TGGTAAGACCCGCTTTGCATGTCTCCGCAACATTTAGCATACCCGAGCATATAATTACACACACACACACACACTCGGAT
      ACGAAAACACAATATGTCGCTGCAACTCTGCGCACTTCCGCTTAAAACCTTTTACTTCCGGCTGACAGGACTCGAAAAAA
      CGTACACAACTAGCCCGAAATAGCCAAACTTTATCCGTACATTGCATGTGCCACGCAAATGCAAATTTTATATACCCACT
      TGCAATCCTCTTTTTGCCTAGGCTCTTCTCGATTTAAATTTTGTTAATATTAAATGCCGTGAAAGTGTGCCACACAGATA
      CGAAAGCCGACTGCCTCGGTTGCGGATCGTGGCATCAGTGGGGCATTATCGTCGTGTAAGTTATGGCGTCAAAAAGCAAT
      CAATTTTTAATTTTGCGTTTAATTAAAAATGCAGCCGGGGCGCAATTAAAATTATACCCTGCATTAAACATACGCCGTTG
      TCCGGAGACACGATAAAGGCACGATTTGGGTGTTGGCCAACTCGAAAGCTAGTCGGCGCTTAAATGACAGTAACCAAAAT
      CTGGTTTTGTTGCAATCAATCATGGCCGGGTCGGTGAGTTGGCGGGTCGGTGGGCTTGTGGCTCGGTGTATTGGTGGGTC
      GATGTTTCATTGGTGCTCGCTCAGCATCATCGGTAATTGGAAATAGGTGGCATCGTCATCGTGATTGCGCGGTCATTGTA
      TCCGCAGCAGCATAGACACGACTTGACACTCACTACTGATACAGCACTTTTTGTATTGCGGTCAAAATAATATCAATATC
      ACCAGTAAATGTTAGACCAAGTACATGCTTCTTAATATCTATACTATATTTGAATTAAAATTTTTCATTTTGTGGTTCTA
      CCCATTTTTTACTCAAAGGAATTGTGTTTTTCTTTAAGAAAAATATGTCTAGGCCTATAGGGTCTATTTTTCTGAACTTA
      GCTGTACATATCAACATTTATCAGACGCATACAAGCAAATGGTGCAACTGCGTCGCGGTTGCGGCCCTAAAAGTTCGCTG
      CGGACATGGAGCGTTCATTTCAATGGGTTTATTAGCATGCCTCTGTGGCGTATGAGTGATATTTCAATAATGAGCATTCA
      ATAAATTGACAATAATTATCGCCGGACATCATATGACCAATTTGTGTTGCTTCCGAACAACCGACAATTGCCGCATGGTA
      TATTCGATAAACAGTAGACATCACTTAAATACAAAAGCAATTGGCTTTCATATAAAGAGCATGCACTATGGTAATTATAA
      CTCCGAGAGCTGGAATAAAATTATTATAATTTTTTGTTCAGAAATCTTACAACTATCAACTGGTAAAACAAACACGCTTC
      AGGAAATGCACAATTAAATCACTTGAAGTAGTATCTACTGTATCGACAAAATCAACAACTTTTTGAACCTGATTACCACG
      TCAAGATAGATTGACAAGCATTATTCAATAGATGGGAAAGTCCTACGATGACAGTCGTTTGCATTTGCGTTTAGCCAGCA
      GATCAAAGGTGTTGACCCAGCCTTTTGTCAAATCACTTTCCATTAATTTTGTCGGCAGGCGCGCTTTGAAAAAATTTGAT
      TACCCAAAAGCTGTGGGCACGTCTGTTGGCTAGAAATTACATGGACATGAAATTTAATCATTCTAATTTGCGGAATTTAT
      GAAGTTTATTGCTCTCGCTTAATAGACACAAATGCTAACAGATTTTTTGGGAAGCAAGTGCTGGCGTTATTTCAAGTTGG
      CCGGCACAAAAAAGAATACCATCCCATTAGCCCACTTTTATAGGACAACGCAGACTTTCATATGCTCTTTAAGGTACAAT
      TAAAACAAATATTGCTTATTCCAGTTGCATAAAACTAAGAGAAAATAAAGTTAAGTTTTCAAAATGTATTTTTTTTTATA
      TTTCAATATGGAGAGCATATTATATTCCACTTCATTGTATTTAAGTTTTTTCGTTGGGGGGAAAACCACCAACATTATTT
      CCTCTCCGTCGCATTTTTTGACGTTTTCCGCAGTCGTGGTTTTTGCTCTTTGACTTGCTTTAGCTTTTGTTTTCCAGCAC
      ATGGAGCTTAGGCTGGCTCCCGACTACGTGCGGAAATGTGTCTAAATTGTGTGTAAAAATTTCACCATCCCGTTTTTATT
      ACATTTTTGCGCCCCACGGCCGCAAGTTGGGGTGACACCATATGGCCTAAACAGATAAGGCTAAGTAATTGATGGACAAC
      GGACTAGCTTTTGTAAGTGGTTCACTTAGCAGGAGCAGGGGCATATTGAAAATAAATTTATCGTTAAAGAATTTAAAACG
      AAAGAGGTCTTAAAGCTGCAGTTATAAGAATCACTAAGAAACTCCATACCCAAAACAAACTTTTTCTCCGATTGCCAAAA
      AAAGTTCTACCATTTAACACAATGTGGCTAAAGATACCCGCCTTTAAAATGAAACGAAGCATTTCCCCCAAAATTACCCC
      AAGACAAGATTGTTACCATGTAGTCTATAACTGTTGTAATTTATAATTTATATTTCCTTTCTTAATGAATAAATAAATAG
      TCAAGTTTATGTTTGAGTTTTATGATTTATATTTTAAGTTATTTCAACTGCAACACCAGCACCACGACCTACTCACAGCA
      AAAAACGTACAAGAAGGAAAGAAGGAATAAAAAGAGTGGTATTCTCTCACAATATGTTTTATGGCATAAAAGGTGTGGCC
      ATTCATATCAAATATAAAGTAGTGTTGTTTAACGTTATTTTTGTAGGTTGAATAGTATATTCCAACACGCCCCCTCAAAA
      ATAACGTCTATAATTAAAAACATAACAATAATATTCATTAGTAACTATCAAATGTGGGTGGTGTGCATTCTGGGAAGTGT
      TAACTGATCCAGCATTTGCTGCGAGGATACGGGGAAAACCCAGAAAAACCCGATCAGATCATTGTAACAAAATATGTTTA
      CAGGAATTTAAATTTGAAAAATATATATAAAAATTTCATTCAGCATTCGATTGGTCGTCTTGCAGCAAACCCAATTTGTC
      TCGTAACTCCACAAATCTCGCAGCAGGCAACGGTTTTGTAAATATGTCAGCCAGTTGATTCTCTGTAGGAATATACTCAA
      GACAAATCACATTATTCTGAACTTGCTCTCTGGCAAAATGATATTTAATATCAATATGTTTAGCTCGTTTATGACATGAG
      GGGTTGTTTGCTATGCTAATACAGCCTTGATTGTCTTCGTAAATTTTAATGGGGTTTTCTAGTTTAATGTTAATACTAGT
      TAATAAAAATTTAAGCCATAGAGCTTCTCTCACGGCTTCAAATAGGGCCATATACTCAGCTTCAGTTGATGAGGCTGCTA
      CTGAGTTCTGTCTCTTTGTATTCCAACAAATGAGATTAAAATCAAACATTTTGAATAAATACCCTGTTGTACTTTTTCTA
      TCAATTTCACTACCAGCCCAATCAGAATCCACATAACTAATAATTTTATTTTCAAATGCCAAGTTCTTTTTAAAAATCAA
      TTTCATATCGATAGTGCCCTTCAAATATCTAAGAACTCTTTTTAAGTTCTGCCATAATTCGGAGTTATTTTTGCTACTAT
      ATCTGCTCAAGATATTTACTGCAGTAGTTAAATCTGGGCGTGTACAAAGCATTATGTACATTAAACATCCTATGAGGCTA
      CGGCATGGGGTATTGCAGTCTTCATCTGAATTAAGTAATTCATAATTTATTTTACTAGGTAAAGGAGTACTAACTGCATT
      ACAATTTTCCATGTTAAATTTACTTAAAATTTTTTTAACATATGCAGATTGGCTTAAATAGATTTTATCTTCATGCATCT
      CTATCCTAATTCCAATAAAATGTTTTATTTCATTTAGGTCAGTCATCCTAAACTTTTCCATTAAATACCTTTTGAAGTTA
      TTCATTCTTGTCATATCTCCTGTAGCTATAACCACATCATCTACATATAATAATACATATATGTTTTCATTGATGTTACC
      TTTGTCTAAAATATGTATACAGCGATCAACTGAAGAGTTTACAAACTCACACTCTTTCAATGCTTGCTCAAATACTTCAA
      ACCAGCATCTAGCCGCTTGCTTGAGTCCGTAAATTGCCTTATTCAATTTACACACATTGTCACTATTACACGATATACCT
      TGAGGAAGTCTCATATAAATTTCCTCTTTTAACGTGCCATTTAAGAAAGCTGTTTTTACATCCATTTGATGGACTTTCAA
      GTTATACTGTATTGCTAATGACAATATAAATCGGAAACTTGAAATTCTAGCTACAGGAGCAAATGTCTCTTCATAGTCTA
      TTTGGTATTTTTGAGTGAATCCTCGTGCAACCAATCTAGCTTTGTATCTAATTGGATTTCCAAGTTCATTATATTTAACA
      GAAAATACCCATCTGCTATCTACAATATTTTTGTTTTCAGGCCTTTTTGTAATTGTCCAAGTATTATTAATTTTATGAGC
      ATTTAACTCTGTATTGATGGCTTCTTCCCAAGAAGATTTATCATCCCTATATTGAATTTCATCAAATGAATTTGATGAAA
      CAGTTGCACCAAACACTCTCAAATGTTTTAAGTATGGCTTCTTATTGTGCCACATCTCATATGGGGTCTTTGAACTATCA
      ACAAGTGCTCTGCTAGGAATTCTGTTGATTAAATAAGTAGCAGTTAATACTGCTTCGCCCCAAAAGCTTTTATCTAGCTT
      TGCACCACTAACCATGGTTCGAGCTTTTTCCGTAATGGTTCTTATCATTCTCTCAGAAACACCATTTAACTGAGGTGTAT
      GTGGCACTGTTAAGTGATAAGAAATTCCTTTCTTAACACAAAATTGTCTCATCTCATTTGACAAGTATTCTCTACCATTG
      TCAATGTATAAGTACACAACCTTTAAATTAAAATGAGCTTCACTCTTGGCTACAAAATCTTGAAACATGCTAAACACATC
      AGATTTATATTTAATTAAATAAGTTACACAATAATGTGTAAACTGATCAACAAAGATCACAAAATAATTTTTATCATCTA
      AAGTAACTGGAGTAATAGGCCCACAGACATCTGAGTGTACTACAAAAAGTGGTCTTTTAATATGGGTCTTATCTTTCAAT
      TGTTTAAAAGGAAGTCTTGCCTGTTTACCATTTAAACAGGGTTCACAAATTTCACATGATAACTCTAAGTTGTTTAGAAG
      ACTTTGATCACTAAACATATTCTTTCGTTTTATTTCTAATAATTTGCCATCGCTTATATGGCCAAACCTCTCATGCCATA
      AACGAAAATTATTTTTATGCTTAGCATTTATAGAATATGCTTGAAAATTGATCACAGGTACATTGTTTAACATACCTGAA
      TTTTTGACAACCATTAACCCATTTTTCGAAATGGTTACACCGCTTTTGTCAAATTCGATCGACATTCCTGCCTCTTGGAG
      ACGCTTTACGGACATCAAATTACCAGCAGCTTCCTTACAAAAGAGTACATCCTCCAGTGTAATCTCATGGTCATTCCGTA
      GTCGGACAATACCACGCTTAGTGGCATAAATAAATTCGCCTTGCTTGGCCACTGCAATCTTAAGTGGAGGCACAACCTCC
      ACACTGTCGGTATACAGCGACTCATCATTTATAAGATGGTCACTAGCACCAGAATCAAGGACAAACCCGCAGTTGTCCAT
      CACTGAAGTATTATTCACTTCTTTTACCATAAACGCAATGCCGTGTGATGTTGCAGTTTGAACTTGTTTTTCATTTTCTT
      TATTTTTATTATTTAATATTCTTTTATAATGGAAACAATCTTTTTTAATGTGGCCTTCTCTGCCACAGTGATGACACTTG
      ACTTTATACTTTGAATTTCCCTTGAATATTTTCTTTGGTTTAGTTACCCGATTTTTAAACAAATTATTTTTATAAGTGTT
      ATTATTGTTGTGCACGATCGCGTTCATAACTTTCTTGCTTGTATCGTTGTGGTCATTTTTAATTTTAATTTCTTGATCCA
      GCAATCTATTTTTCACAAACGCCAATGTCAAATTTTCTTCAGATAATGTCTCTATCGCTGTAATAATTCCATCGTAACAC
      GAAGGCAATGTGATCAGTAGATGAGAAATTTTATCCATCTCTTCTATTTTTGCACCAGCTGCCAACAATTCACTTATAAG
      TTCGTCAAAAATATGAAAATGGCTTAATAGTGACATCTCACTCGATAGCTTCAGAGAAAGCAAACGTTTTCGCAGCGCCA
      GTTGCGACGCCAAACTTTTTCGTTCATAAACGGCGTCCAAATTCTCAAGAATCTGACGCGCCGTAATGTCGCTTGTTGCG
      AAATTTAAAAACGAGTCGCTTAGGTACTCTATTATTGTACTTTTTGCACAACGCTCTGCCTTTTTCCAGGAGTCATCTAC
      CTCGTTAGGCATTAAACCATCAACTACTTTAAGCACATCTTGCTCGGCTAAAAGAGCCCTAATTCTAAATTTCCAAATCG
      CGTACTTCTCGCCATCAAACGGCTTAATATTACGTTTAGCCTTGTCCATTTTTCACTCAAATTCTGAGAAGGAAATAATT
      TCACAAGAATGTGAAAAAAAAAAGCTATTTCACAATTTATTTTCACAATCTTTAATTCACAATTTAATTGTTTATTAGGC
      ATGGTCTGGGCCCATAACCTGTTGTAATTTATAATTTATATTTCCTTTCTTAATGAATAAATAAATAGTCAAGTTTATGT
      TTGAGTTTTATGATTTATATTTTAAGTTATTTCAACTGCAACACCAGCACCACGACCTACTCACAGCAAAAAACGTACAA
      GAAGGAAAGAAGGAATAAAAAGAGTGGTATTCTCTCACAATATGTTTTATGGCATAAAAGGTGTGGCCATTCATATCAAA
      TATAAAGTAGTGTTGTTTAACGTTATTTTTGTAGGTTGAATAGTATATTCCAACAATAACTTTTAAACGGTTTCAAACCA
      AAGCCAATTATGTCCTACCTTTCTCTCGGCCACAATATAGCTTCACCCTCCACCAATATCACATAACATTTTCAATTACC
      ATTTTGGGTGAATCGGCCAAGACCTCACCCCGTCTTTCTCAACACTCGACCCCCAAAATTGGACCAAGTTTAGCTACGAA
      ATTGAGACATGTTGTTTGAGTACATTTTGTGGTTTGGTCTCTGGCAGCAGGGCTCCGGGAATTTTCGTGTTTTGTGTATG
      CAATTTTAAATGCACATCGCAGCTCAGCTCAGCCCAGTTTGGTTTGTTTTTGGTTCACCCGACCAATTCCCAAGACCCAT
      GTTGCTGTAACGAGCCGCCTTTGTTTGCTAAAAACTTATCAAGGCTATGGTCAGGACTTGGAGCCCAGGGCAAACACGAA
      GCAAATGCCTGCAATGATGATCCTGCAGTTGAATCCTGTGGTGGAGCCACCACTCCGCTTGGTCTAGTCAATTTTTATAC
      AGACTGTCGATTCTATGTGTGCGGATGACTCCCTCTGGACAGAAATCTCTATTCCTTTGGCCATTGTTATGGGCACTGGG
      TCGTGTGTCACTTCCACATGATTGGGCAATTCACAATCTTTTTCATATGGCCATCCCTGCTGTTGTCTAAGCTGATGACT
      CAATTAACTGGCAAACGTGCTTTTGTAAGCTGTCAGCTGGAAAGGCTTAGCAAAACTAAAGATGACCGATTACAATTAGC
      CCATATAATCGCTGGAATGAGCAAAAATGCTGATAGCCTGGGATTAGGGTTTTAGTTTCTAAGAAATAAATTGGCCAGTC
      AACAAAAATGTAATCTGTTCTTTTAAAAATTAAAACTCCTACTGGTAACTTTTTTAAAACCGCTCCTGGAAAGTCGTGTC
      TCTACTAAAAGAAAAGTATTAAATAAATAATAACTTCATTTTGAAGTCCGTTAAAATGTTATAAAACAAACTTATAATCA
      CACCATGTTATTTTTCCGTCAAAACGAAATATTAAATTTTTACGATGGTAAAAAGCACGAATTTCACGGCTTCGCATTTT
      AAATATTAAAACTTTAATCGAGAGAAGCGCTGGCATTAAATGGAACGTGGAAAATCCATGGCCAGCAAAAAGCTGTCATC
      GAAAGCAGGACAATAAATATGCGCTGCGCTCATGATTAATGATTTGCACGCGCAGAACGAACTAACCGAAAAAACAGCAA
      AATTCTTGGCCAACTTGAGGGCCAGAACCAAAACAAAAAAAAAAAAACAGGCTACAGCGACTGGGCGGGCTTTCGGTTTG
      TTTGGCTTTGCGAGCAGCGTAGCGTGTATTAAGGGAATTAAAATGTTATTATATAAAACAAGGACAAGGGTCCGAGCAAG
      CTGAAGAATGAGAAGTTGGTGTGCAAAATGCGATGGTAACGCTGTTGCCACTGATCCAGGATAACGACGTGATAATCACA
      CTCATCACAGCCACTCAGAGCCGGCGTATGAAGGGCGGCGATTGCCCGACTAAAGAAACCGCCAGGTGACTTGTACATAA
      TTCCAGCAATTTTTGCAAAGAACTTAATTTTACGCTCCTGCATTTCTCAAATGAAAATCTGGACACATCCCCCGAAAACC
      CACGACCCGGACAACCTTTGTCTGCCTTTAATAAGTTTGCTTAGTTCCAGCCAGAAAAGCACTGAAGCGGGCACTCAGTT
      GGCTTCCTTCAAATATCCTTTCATATTCGTGCAACCCGAGGTTTTTGTCTTTCATGGCGTCTAAAATGGCGTTGTTCATG
      GGCTTCTTTTGTTTTGCATTCCTGTGCAGCGAGTGTGAAAAAGTTAATGGGTCAACTATGAGGGTTCCCCCACAAATTTT
      AAGAATTTTTAATTAGCTCTGGGCAAAGCAGTTTACCCTATTTATTATATATTTTTTTTTGCTAAACATTTTAATAAATA
      ACTTTTCAGAGCTAAACCCCTGATTGATTATTATCTGTTTTTAAATTTTCTAATATAAATATTTGATCTACAAAGTAAGT
      TCAACACTACGACATGCACATTTATATTATTATGAGAGCTTAACTCTTGCTTGTTGCACTTTTGCCCTTTTATTTAAGGG
      ACCGCACACAGGTAAACATTTGATATGAAAACTTCAATGTCTGAAAGCCAACACATGAATTAAAATTGAATAATAAATGC
      CATGTAAGTAAGGAAAAACTCACTGCCATATATGTAGTTATGGATACAGGTGCCAGCTTGTAGGTTTTCCACATATAAGG
      TTTCGTAGCACGCATCATCAGGATGAGGAGCATCCTTCGATAAACAAGATCGCCTTCATACCAATTGTTATAAAAGGCCG
      CTGGCAATACTTTGCCACTCTGAAAAGAAAAGCTTTATATGATAAAAAGACTACTCTTTCTTAAAAAGATTTAGATGGTC
      GATATCTTCATTTTCAACCAAAAACTTATGTACACCTCGCAATAACTTATGTTAACTGGTTATCAAAAACTTACCGTTAA
      AATCAAGTGCGTACCACTGCGGCACATTGAAAAATTATATGTGATGAATAGCAAAAGTCCGAGTAAATGTTTTAGAGAGG
      TGCCAAAGTCGAACATGGTCATGGAAAATGCCAGAAAACAGTTGGATATCATGGATACCGACAGACTTATGAGAAACGTA
      AAGTTAAACGATCGATTAACTCTGTCGGCTAGATTAAGCAATTTTGTGTGATATACAATCAGATACTTCAATTGATCCTT
      GGCATGGGGATTGCGGGCATCGATGGTCTCCAGCTGCCTGGCCAAACCATCGAAGTGTATTTCTAGCTGGATACCAAAAA
      AGTTGATCAGAAACTGGATAAACATATTGACGCACATATTGGTTTGGCACGAAAAGATTTGACAGGCGACTGCAGCAAAA
      AATCCAGGAATTGATCCCTGAACCTGCCAGGGATACCAGGTATTACTCTGAATTCTATAGCCCAACTGCTGTGAGTTCGA
      GAAATGTTCCCGAATCATTAGAAGAATTGGTAGTGAGTTGTAGTAGACAACGGCAGAGGTATGGAAAATAAATGTATTTC
      GTATATGACGCGTATACTTTTCTTGATAGTGGTGTATGCGATACGCCCTGTGCTTGATTAGTTGAAATAATTCCTCGAAT
      TCATTTAGTAGGTTCTCAAAATGGGTCTTAAGGCTCAGCATCTTCCACAAGTTGAGGGTGCCCACAATGGTGAAACCAAG
      CATGCTGGCCACAGATGCCAATTCAGCTAAATACGCAATTGGATCCTTTGTTCTTCCATCACCGAAATAGCCATACATGA
      CGCAGCCAATATTGTGATAAACCAAATTTACTGCTCCAAGCCAGAAGATAATGCGTTTTGCCAAGTTGCGTTTAACTTCC
      AAGGATCGTCTGCCATTCCACGTGTATCTGGGAAGTTGGGCCGCTTGACACACGAGGTCCGGGTACCGCATAAAGTCCTC
      CAACTGCATCTAGTCCTGAATTATTACTGGGTTATGGCAACGTAATCCCAGACGTATTAATATAATCGGTTGGACGATTC
      GTGGTGAGAACTGCCAACTGCTGCAGCTGGTTAATAAGGAATTTTTGAAAGTCTTTGTGTTTAAAATTCATTATGGCACT
      TGGTCGGGACAATTTAGGAACAAATTATTAGAATATTTGAGCACCAATTAGATCCTCAATAAGGTGAAAGAAGACAAGAT
      TTTCCAAAGGCTACCTTTCCTTAAAGAAAAATATAATTTAAATGAATAAAACATAATATGGTAATAATATCTAAGCAAAA
      TTTCAATTTTAGGACGACGATTCGAGAGGACACATATATTAAAAAATCCAACTGCGACGAGCACCTGTAGCCTCTGAGAT
      CTCAGCAACGAATCTTTGGGTATCCACCGCCTTCCGTCCATATATGAACCAATCTATACAATCTATAATTACTCCAATAC
      ATTGGTAAGCCAGGCAAAAGTTACCTAGCAAAAAGAATGCCCTTCGAAACGTTGGATACAAATCTTCCTCGTGGAAACAT
      CGCCAGACGCAAAATGCTGTCAAAATACTTAAAGTAGTTCTCAAATTCCATCCTGCTCTAAAACGTGGCTGTCGTATTTG
      CCCCATATTACCGACCTTTATACGCTAGCCTGCAAAAATCGAATTAAGTAATTTGTAATCATCTATATCAGGGTTCCTGA
      GAAAACGGCAACTGCGTTTCGATTATCGTATAGTATAGTGTATACTTTGGCCTTGCCTATTAGTGTGACATCATAATCCA
      TCCCAATCAATTAGTACTGATACCTTCAATCAATCAATCAGTCAATCGGATAGACCGTCGAAGAGAAACAGTTCTTCACG
      AAGAAAGATATATGCTGAGGTAAGTTGCACATATTCTACAAAAACTATTTAGAGCAGAAGTGAGCCTGAAGGTGGCAACC
      GTTTTATTTACTATTTAGTGTAGTTATAGTATAAAAGTTATATAGAAATCTATTATGCTCATACTCACAGCTAAAGTGAC
      CTCGGTTCCCATGTAGCAGATGACAAAGTTGTAGAGGACGAATGCCACTAGACCACTGGCATATTTGAAGGCAGATGCTA
      AGTCCAGTAGCATTATAGAAACACTTGACATACAAATGGCAATAGTGGCACCTACTAGGCTAGAGCCGAATACAAAGTTC
      ATTATGTCATTGACTTGGTCGCCCAGCTGAAGGATTCGGCTGTGGTGGGCGATGAGGATGCTCAACTCCTTATGAGCTCC
      AGGACGACGGCAATCGAGAGATACTAACTGACTGGATATTCCATCGTAGTGCAACTTTAGTTGGAAGGTTAACAAACAGA
      TAAGATTCTGGGTGACAATACTGAAACCTACGCCCACAAAGGATCCCACGGTTATGCTTAGTACAGCCATACCAAATCCA
      AGTGCCGACCCATGGACTTTCCATGGAAACCAAGTGTTGGTCTGCGTCTTGAAGCTAAGATCATATTCCTCGTGCAAGTG
      TTCCCAAAGAAGCACCCATAATGGTGCACTATTGTAGTACACGTACAAGATCATATAGAAAAGAAACTCAATTCTCATTA
      TTGTCATGGCCATGTCAAAATAATGCTGGCAGCGATAGTGATTTTTCCTGTATCTCGGATATATCTGATGAAGCTCCTCG
      AGTAATGTTTCAATTTGATTGCGGTTTGTAGAGATCGCATAAACGTTACAGAATCCCACAAATGTTAGACAAAAAGAACT
      GCACATTTCAGATAATTGTGCCACAAAGGTGCCCGTTTCCGTGGCAAGACGGCCATTGCAATACCAATAGATAAGCACTC
      CAGTAATCTGGAATATCTGGCAAATGGTTCCAAGAAGGAACACTATCCTTTGCTCCGAAGCGTAGAACTGTCTTTCAGTA
      GGGCGTCCTTTCCATTGATATCTTGGTATGCATGCCATCTTGCAACCCAAGTCTATGTACTTCATATGGTCGTGCAACTG
      CATCCTGGTTTCAACTATGACTGAATTGCCACAAAGGAAACTAGTAGCTTTTGGAGGCCAGATTTGAGGACCTAATTGAG
      CAATATTAAATCAATTCTTGGGAAAACCAACTGCTGGTATAACAAGGAATCAGTGATGCGAATCTAGTGAAAAAGCGCCA
      AGTACTCAATAAAAAAAATGTTAACCGTAATGGCTTAGTGCCGAATTAAATTATTGGATGTATTTGTATAAATTATTTTC
      TTAGTAAAATCAAGGAAATTTTTTTTCGAATGACACATTTTTAAAGCCCACATTTGTGTTGAATTTATTTCGCACATTAT
      TTGTTTGTTTATTCAGTTTATATTCGTGTCAAGCTCGTAATGATGATGCCTTTGAGCTGGTTAGCAGGCTTTTATGCGCT
      TGTCTATGGCTGCTGATATCAGCAGACAAGTGCTGCTCGTTCTGCACTCCATTTCCGGCGGAAGTCCACCCAAGGAGACA
      TTTTTATGTACAGACATATATACTGTGTATATATGCCCCGTGCCTGCATGTTTCAGTATGTGTATTGTACTTGGCGCTTG
      TTTACTTCTTTGTTTATGGGCATCCTCGTGGCACCCGCTCTTTTACGAGTCCATCCTATTGCCAGTTTTTATTGTTGCCT
      TTATTCTGCGGTCTACTTGGTTGCGCCTCATGTGCTTCATGCTACATGCTCCCTGGTCCCTGCCACAGGCTCCAGTATAT
      CCAGTATATGCTCGAATATGCTGTGTTTTTGTGTGTTTTTGTTTGCTATTGATTTATGGTTTGGTGATTTCGCTCTTGTG
      CGGGATTTTCTGTTTACTGTCGACGTCTCATCAGCGTTTTGTTGCGGTAATTAAACTCTGATTGGTTTTCAATTGTTTTT
      ATTGATTGGCACTGGCGGTTGATTTCTTTTTTTTTTTTTTGCTTTAATTGAGCTGCTGTTGATTCGCAATTAACCACCGA
      AGTCCCCGAGCGTCATCGTCACGGATAAACTGACTTAAATTCAGTTGAAATTGCCTTTGAAAGTAAAATTTATGAAGACA
      AACAAAAGCAGGAAAACTTGGCAGGACTCGCGGGCGAGTACCCGGCCAATTGCCAAAGGACTCAAATCGAGCGGCAGCTG
      CGCGTAATGGACAATTTGAATTATCCTTCCGCCTTTCGTTTGGCGGAGGAGTGTGAGTAATAGTTTTGGCAGCCAGCGCC
      ATTTTGGCCAGGAAAAATTATGGAGATCCATGAGCCAAGGGCCACTACATCGACTCCGTAGCTCTTGGCAGACGCCTCTC
      CAATTCATCTCCTTCGTCCTGCCCGCTGGCAAGTGCAAAAGTATAGCAAAGTTATGGGCCACCGACTCGGACAATTCCTA
      ACTTTCAGCTCGGAACTCGCAACTGTTGGACTTATCGATTCACCGGATCGGGCCTTTTAAACTAATTAAGTCCCATGGAG
      GCGAACAACACATGCTACTAATTTGCGAAATTAACGTGTTTGTTTTGGCCATTCTCTAAATAAATTACCCCCAAAAAACA
      AAATACAGGAAGAAAACGAGCAGCCAAAGGTAAAGGCAATGTCCATAAATTCGCATCGAAAGCGAATTCCGAGCTGCAAC
      TTTGGGTTGGTTGCCTTGTTTACTGCCCACAAAAAGGATCCCCTTCTCAATATCATGACCAAAAATTACAGCCAACTGGA
      AAATTTATGTGCAGCTCCATGGAAATTAAACGCTCTGGGCCTTTAGCAATGGACCAGCTGCTCGGACTTCCGGCTTCCTG
      AGGCGCTTTCCTATTTTGACAAGGATCTATGAAAATAGTGTGAAAAATTATTGTTCAACTCCCCCTCGCTCGCTGGGCAT
      TCTAAACTGCTAAATTAAGATAAATGAGCACATTTAGCCGGAGGAATTTATTTGTTTTGATAAGCGTAAAACGACTCTGC
      TCAGATTCGCATTTCGGGTTCGCATTGGTCCGCAAAAGGGATGTGACATATAAATCTTTTTCAAAGAACATGTGTTATAG
      AAGTGCCAGCGTGCTTTAATTAGAATTAAGAAGAAGCGTTTTTATACCCTTTGGCATCATTTAGTTATTGATTGCTGCAT
      TAAATAAAAACGAAACTAAAAGCCAACCGAAACTCACCGATAAAAAACCAAGTTGTAGTATTATGATTTTGCTACTTGGC
      AACTTTTTTAATACGCCCGTAAAGATCAACAGCGAAAGTGGACTCGGGCCCAAATGACTTTGGCTAATAAATAAAGTTTT
      GCGATGCTCAGGTAAACACTTGGCATGACCCACAAAAAGTTTGTGCTTAAATAAACAGAAAGCAGGAGGGAAGCCAAATC
      AGAAATAAGAGTGCTCCCAAACTTGGGAAAAGTATTTTGCCCAGAAATTGTTTGCTGATGTGGCTTAGATTTTTTCCTGC
      AATTAGTTAACCCATAAAGAGAAAGTGTTGCATATGAAATATATGACCACAAAATGCCAACAAATTGCCCGGAGGCCAGA
      AACCGAAAATTTATGAGGTGCCAGAGAAAAGCATTATAGGCAAACGAAATACGGTGTAACTGGGGAATCATATTCGTGTG
      GAAAAGGAAATAATATATTCTATAGATTTGCATGCTAAAAAAAAAAAAGAAAATTAATATTTCATGTCTTCCGTTTATGA
      TCGTTCTCAAATCCTGAAATGCCATATTATCAACCCACGTAATGACTTGGAAAGCCACTTAACTGAGACACCTTTTTGGG
      GGCCATGTTTTGTTATTTGGAAATACATTTTCTGGCCAACATGTTGCCCGAAATGCCTGGGCTTAATTTATATGTTGTCA
      GACCGGGTGGCAGCAACAAATGCAGCCGCAATAGTGGAATTACTCATACACACACACGCTCAATCTGAAACGTGGCCAGG
      TGAACTCCTGGCGAAAGTGAAACTGGGTCGCAAGAAAGTTGTCGGGCCACCACCCACTTTCCTTTTTGGCAATGGGGGGG
      ACAACAAGATAAAATGGACACACCCAATGTGTTTTTCGTTTTACGGGCCGAGTGTGAAATAAAGTGAAGAAAATTGCTGC
      CTACTTTTGGGGGCCACACATGGGAAGGATGTTCGAGTTTTCTGGGGGGGGGGGGGGCAAAGATGGCCAAGCAATTTGTT
      AGCAGGTCGAGCAGAGATGGTCTCAGTGCAAATGTAATTTACTGCCAGACGATATACGCTGGCCCACAGAAATATTTTGG
      CCGCAATTTATTTGCGGCCATTTAAACAGAAATAAAAGCAAATGAATTTAAAGATCCTGCTATCCAATCCTTACCCAATT
      ACCTTGAAAATATTTAACTAAATGTAACCATTCAAACATTCGGTTGCCATAGAATGGTTTTTGTGCTTTGTCTAGACGGC
      TACAAAGACAAAACTGCCTGAAGGATGTAATCCAGATAAAATGCCAAATAAAATCTATACTCCTACCAGATATTTCCGCC
      AAAGATTTTCGTTAAGGCAAAATATGAAACATTCCATGCTTTTAATAAAATCTATAGATATCTTTTCTTTTATTAGTTAT
      AAGATAATACAGTAACACATATTTTATTTTTTTACGGCAAGGCCGCTGGAATGGGAGAATGTGATTGTCCACTCAAAATC
      ATTTTTGCAAAATTGACACCCTCATCAGCATTCTGTCGTAGAATAGGTAGTAGCTTTTCCAAAGCCTCCTTTTCGTAGTC
      ACTCATCTGGGGAAGTGGTATATAGCGCTTGATACCATCCTTTCCCAATTCCAATGGACTAGCAAAGAATGGGGCGTCGG
      TTAGTTTGGAGGCGACAAAAGCGCACTCGATTAGACCATCCTGTCCAGCAATTCCACGCAGCAGGGAGTTCACGAAAGTT
      GCGCCAGCATAAGCCATCGATAGGGTGGCAGATCCTTTTCCAGCTTTGGCATTCACCACCTCTGTGCCCGCCTCCTGAAT
      GCGATGAGTTAGATTCTGGATCTCCTGGAGATCACATCTATATATCGGCTGACACTGCGAAATGAGCGGTAGAATTGTAA
      TCCCCGCATGGCCACCAATAACTGGAATGTTTACGTCATCCGGTGATATGTTCATAGAATCACCAATGAACTTTTTCGAT
      CGCACCACATCCAAAGTCGTAATACCGAAGAGCCGACGAGAATCAAAAGTTCCATGGGCCATAAGAACCTCAGCTGCGGC
      GGGCACAATCATATTGACCGGATTGGTAATAAAGGCAAGATGAGCTCGTGGAGAGGCATTGCTAATGGCAGTGGCAACTT
      TCACTGCAACATTTCCATTGGCGGCCATCAGGTGATCCCTTTGCATTCCTGGCAGACGTGGCATCCCTGCCGCCACAACC
      ACCACATCAGCTCCACTCACCGCCGACTCCAGTTCCTTTTCACCGGTAAAACCTATCACCTTTCCCGTTTGGCTTATATG
      GGATAGATCCGTAGCAATTCCCTTCATTTCGCTGAGATCATGTAGAGCCAGCTCATCGATTCCAGGACAGCGACGGAGCA
      GAAGCGATAGCGGTTGTCCAATTCCTCCTCCGGCACCGACAACGGCGACCTTTAAAGTGCGGACCACAACTCCCCATGTA
      GCTGGTTTTGCCAGGCTTTTAAGACTTGTCAGTAACAACATTTTGCTCAGAATATAATGAATAATATTGTTGCCGATTCC
      AACTGTTGACAGTTAAAAGCAAAAGCCTACTAATCAGATAAAATAAACGAAAGGTATACTAAATTTTAGTAAGCTTACGA
      CATACCTTTTGATTACACTTCTTCTCGTATTGAAACCCACTTGAAATTTTAACATTTTAAAAAAAAAATTATAAAATGTT
      TTTGGCCTCTAGATTGTTAAGCCATGTTGGCAACTTGCCTCCCAAGGTCCAGCAGCTTGGATATATCAACCGAGGTCTCA
      AGGTCGCCGTTGTGGGATCGGTGGGTGGAATCGGTCAGCCGCTGTCCCTTCTTCTCAAGCATAATCCGCAAATCTCGACC
      CTGTCTCTGTACGACATTAAGAATACAACCGGTGTAGGAGTAGACTTATCTCATATCAACACCCGTGCTTCAGTGTGCCC
      ATTCGAGGGTAAGAATGGTTTAAAAAAAGCTATGGATAAGGCTGATATAGTGGTGATACCGGCGGGTTTGCCACGTAAGC
      CCGGAATGAAGCGCGAAGATTTGGTGGACGTGAATGCCAGCGTTGCCTGCGAAGTGGCTTTTGCGGCTAGCGAAGTTTGT
      CCCGGTGCCATGCTTGCCTTCATCACGAACCCCATCAACGTGATAGTACCCATCGTGGCCACGATCCTTAAAGCAAAGGG
      TACATACGATCCGAATCGACTATTTGGTGTCACCACTCTGGATGTGGTACGAGCCCAGACCTTTGTAGCGGACATTCTCA
      ACGTTGATCCCCAGAAAGTGAATATACCCGTAATCGGTGGCCATACAGGTCGGACCATCCTGCCCATACTGTCGCAGTGT
      GATCCCCCCTTTAAGGGTACCGATAAGGAGCGCGAAGCGTTGATCCAACGCATCCAAAATGCGGGCACAGAAGTGGTTAA
      TGCCAAGGATGGCCTGGGCTCGGCCACCCTATCGATGGCCTTTGCAGCCACTCAGTTTGTAAGCTCGTTGATAAAGGGTA
      TCAAGGGTTCAAAGGACGAGTGCATTGTGGAATGTGCCTATGTGGAGTCTGATGTCACGGAGGCCCAGTTCTTCGCCACC
      CCACTGATACTGGGACCCCAGGGTGTCAAGGAAAACACAGGATTGCCCGATTTGGACGATGAGGAAAGGAAGGCTCTAAA
      TGGTATGCTACCCATTTTGAAGGAGAGTATCGCAAAGGGCATCAAATTGGGCGAGGGTATGATATGCAGTTGTGCATAAC
      AATGGAGATACAATTTACATAAACATATTATTCCGATTTTGGTTTTCTTAATAAATTATTAGGTTATTTTGTTAAAATAG
      ATATCTGATGATAGGAAATGTTTATTGCAGTCTTAAAAAGTCCGGAAAATGGATTTAAATTATGAGACTGTTCCATTGTT
      AGACCACAAGTTTTATGGCCGTAATGCTGGTAAGTTAAGGAAACCCTGAGTTTGTATCTTTTTTCCTCTTTCTTTGCTTG
      ATGTCGGGGATCCAGGCGCGAAAGCCACTGACACAGCTGGAACTCGGCACCAAACAGTTTCGGATTCCCATGCCATCAGC
      GAACTCAGCGGAGCCGCAAATCTTTGCGGTCTCGTCTTAATGGCAAAGAAATTGTGATTTATGTCTCGAGATTTGTACAT
      TTGGGCTGCTTGACTCAAGCGTATGTATATATATACAATATATTTGAGATGATGCACACGATTTAGTTTCCTTGTTGAAC
      CTAAGTAGTTTGGCAAGCAAACTTTGAAGAAGTTTTTCGGTACTCCGTATCACTCATTACTTAATTAGTCGCAATTTTAT
      TTTTCAGTCAGCCGCAGGTGGCCAAATTAGTTTCCCTGTTCAACTGAATTACATTAATTGAATTCGGGTCTCGACATCTT
      TTGGGTTTTGGTTTTTGGGCAGAGGTTGAGTTTCGCCGAAGACTTCTTGCAGAAAAGTGTCTGAGACGACAGTTTTATTG
      CTGTCGGCATGAAAACTTTACGCTTTTTGGCTTGTAAGCCCCTAAAAGGCTTATAATGTAATTAGATTTGTCGTCGCCTT
      TGTTATGGCGCGACCAATGTTATTATTTTGACACTACCGTCACAAAGGTCACCGTTTTGGAAATCTAGATTTTGGATTTA
      ATTAAACAAAGTGCGGTACACATTACCATCATCATTTAATGTATACATAGATATTAAATATTCAAGATTACTTTTTTATT
      AATTTATCTGAAAGGCTTATGAATAATTTAAATACAATTCTGTAAAGGATAAAATAATATAAATACCTGTGCCTAAATCA
      TTGGCTTTACCTCTGAATTGAATACAAGTGCTTAAACATTTTAACAATGCCTATTTCGTTTGGGCCACTTTATTGTTACC
      AGTTTGTTGCATAGGTAGGCAATAATTTACAGAAATTATACATGACCACTTAAGTTGTCATTAACGTTAACGACCACCAA
      ACCGAAAGGGAGCGGTCGAAATGTGTGTCGGGCCATTATGGCCTCGTCTGAGAAACGGCTTTTGCAACTGTATGTGCACT
      TTTTGTCGATGGTGGCCTCCTGTCGACGACTCCTGGAGCTGGAGCTGGAGCGGAGCTAAGGAGCTGGTGGTCGTGGGTCC
      GGGTAATCCAAAATTAATGGTCTGTCTGTCATACTCGTGCTACAATTTTAGCCCACTTTGGGCCTGAGACGCTGATGCAG
      GCGCAGCTACAGCTGCGATTCCTTCTTATAGCCGTTTGTGTGCTTCATCCTTTCTTTGGGTAAATTTCCGCTTTCCGTTT
      TCGGCAAAGTAGACCAAGACGGGCTTAATCGAAAACGTATGAATGCAGCCCAGATCTAAAAGGCCTTTCTAGAGATGGTG
      CCTTGGTAACTAATGAACTCACGAGAAGCATAAATGCCTACTAAAATATTTTATGGTGTGTTTTGAAACGATTCCAAAAT
      TTAAACAGAGCTATCTGAAGATAGAAGATATCTAAATAGTTCTTTTTTTTTTGCAAGTAAAATATCTAGTTATTATCAAA
      TTTAAAACAATTTAAATTACTCACAAGCAAGTGTCTTCGATTTAAATTGAACTTTTCTTTACGTGATTTTCATGCTTGAT
      GAGTTTTCTTTACCCATCCCTAACCCAAAGCCACAGCACTTAAGCGCCTTTCGTGTTGCGCTTTTTGGCCAGGCCCAGAC
      TGTGGTTAGAGCAGCGAGCCAAGTTATTACAAGCGCAAAAATATTTTCACTTAAGTAGCTGCCACCATTTTGCTCAATTT
      ATTTCCAACATCAAGCTCTCTCGTTTCCTTTTTTTTTTTAATTTAACACAAAATTTTCGTGTAATGTTTGGCTTTCAGTT
      CGCTGCTCTTTTGAGCAAGAACATTTTACAATCTTCGGGGGGGGGGGGGGCACAAAAAAAACCGCTTCGTAATATTTAAT
      TTAATGTTTTTCTGTTAAATGTTCCACCGGCGTTTCTCCTCAGGCTGACTGTATACCAAATAAATCATATATTCATCGTT
      GGTGCCCCAACCAGAGGCACATAAAATTTCGCATGCAAAAATCTGTGCAAATTTGTTGGACACTTGACTGCTGCTCATAC
      ATGGATTTGTTTACTGTGGGTGGATGCACCTTTTTTCATGCCATTTACGGGTCAACTGAGCGTCGGGGCCATCCAGAGAT
      ATGAGACTTTTGGGTATAAATGAAAATCAGAAAAATTTTTTTATTTTTTGACATCGTTTTGGAAAATATATGTACGTATT
      TTCTGTACATTTGGGCATTTAACGATGTGTAAAAGCGTTTGCGATTTCGGTTAATTGAATTGTTTCTTTATGCACTTTTA
      TGGTATCTGTTGAGTGTAATGTGAACTCAATGGGAATGAATATATTTTTAAAAGGAACATTTGAAATTTACTAGCACAGA
      TTTTGTTATTTAACTGCTTGTATCTAAAATTGTATTTTATTTTTCAAAGTTAATTTTTGACATTTAAGCTGTACAACAAA
      TATTTTATTCATTTTGTGTTACTTTTTTCCACTAGTTGCTTACGTTAGCAGACTACCAATGCCTGTTGAGGCGGTAATAT
      TCAACGTAAGTACCGTCAAGAGAAAGTGTTTAAGAACACAGAGACGCCATCTACGAGCTCTGATTATCTGTAAATCAAAT
      GTAATGAGATACAGTTTGGGCTAGGATTACACTTACACGAATTCATACGAGACTCCCGAGGGAAAAAGAGCAGAAGAAGC
      GGTTATTTTTACGGCCTCAGCGGAATACGAAGTGCGAGCTGCGTTAGAAATCGGCTCCCAGGACATTCCCGGGATTTAGG
      GTCGACGGCGAAGCAAGTGACCCATAAAATATCACGTATACGCAGGCCACATGGCCGCAGGAGGGCGCTGGATGATGAAC
      TAACACGGACATATGTTCGTGTGTGGATGCGTTTTTATGATTTGTGGCATAAGGCCCGAATACCAGCTGATTGTAAATCT
      ATGCGGGCCTCAAGAACCGCCAACCCCTAAAAACCTCCATTGTGGTTACTCAGGCCTGAGTGAAGCAGCAGAGCAGAGGA
      GGGAAATCGTTTAAAAGTATGTGTGTGTGTGTGTGGAATGGGGCCAGGATGGATTATATTCGCCAGGGTCAAATCCTCTG
      CGGTTTTGCAAGCTGTCGCCTTCATCTTTAAACTTTAATGGCCAGCCAAAAGTTTTGGGCCATGTCTAAGCTTTAGTCAA
      CAAAGACTTGGGCACGTCGTGGCCACAGCCAGATGCTTCCGCTCTAGCAGAAAACATCGTTCTTATCCCCACTCCCCTGT
      CCCTGGTTAATTCCCAGTACGTGTCCTGTTAGCGAAACGTTTTCCAAATATTTATTTATTATTTACTCCCGTCCACCTTC
      TGGTTTTTGGCCTTCAAAAGTCCAGATAGGCGAAATAAAAAAAAATAAACTAAAAATGTTGCGGGAGATATTTGATTTAG
      CTGCTCTTTGACATCGGGTCTTAGTGGCTCTATTTATCTACGTGACGTTTTCGAGGCTCTTTTAGCGAGATAACAACTGA
      AAGCTGTCAAACACGACGTATACTTAATATTAATTACTGCATGCAACAAAAAATTCACCCAGAAAATCAGACTTACACAT
      CTTTCTCTATTTATTTCGTTGAAAGTAAAAGTATGTGCACAAACGACAAGTGTTGCTACAATAATAAATTCTTTGCACTT
      GTAGAAATATATTTTCATCATTTTTAGGGATTTGCGTTTGTGAACCACAAGCAAAGTTGAGTAATTGTCTAATTAAGTCA
      TTAACAAAATTGCTTGAGCCCCTTTTTGCTGAATAATGTTCGAATCGTATTCCAAACTAAGCTAATTACGTGTTATTTGC
      CAAAAAATCCTAATTGAGGGCTGTTGGTGCTGAAGGTGATTGATGTTTAGGGAAACCGTTTTTTTGCCAGTAAAAAAGCT
      TTAATTGCTCATACACTTTCTTTAAGGGTAAAAAAGGACACTCAGTTTTCTTTAAGTACATATGTGATATTGACTTTCTG
      TTTCTTTAGATGATTAATTTTATACGTATTTATACATTCGCCCCATTTTCTCGCAGTGCCAACACTTTCATTTCATGTAA
      GTAAAGGCCCAGACAGAAATCTAGGAATTATTCGCATGCATCGAGAGCGTAAACCATTCCCAACCACTTCCAATTAACAC
      TAAAATTAATTCATATTAATTAAGGCTCAGGGCCGGGACCAAATGAGAACACACTTAATGCCCGGGGCTGTTAGCTTTTA
      TGAGACTCAAATAGAATGAGGGCGTGGAAGCAGCACTCCAGTCTCCAGTCGAACAAATACTGACCTCAACAAGGCAAATG
      TAATAAATAAGAGAAAGGCACAACAAATTGGTTCGGAGTAAATGGGCAAACCCTGACCAGACATAACAACATTCATTAAT
      AAGCACAAACGAAATTGCTGCCCAGCTGGATATGGCTAGAAACCAAAAGGGAGAACAGGACCAAAAAAAAAACAAAAAAC
      AGTTAAAGCAACAAACCGTAACGACAGCACGCATAATATTAATAACATTTAATAAGTTGCTGGAATTAGTGGTAAATGGG
      TAGGGAAATGGCAAAAAATGATTTGGTAATTATGATGGATATTTAAAACGTCTCAAATTTAAGCCAACATATTCAGAGCA
      GACCCTTATGAATACAGTCCCAATTAAGCAAAATCCCTGCCATTAAACTAATTACCCAACATTTAAAATATTTCTTAACC
      ATCAAAAAAAAAGTGAATGCTGAAGGGAACCCCAAAAATTCCTTCGTATAAATAAGGGTAAACATTTTGTGCCGCAACAT
      TAACTATATACAATTTCACACCTTTTTTGGTGTCAACTTGCTTTGGATTTTGCCTTTGTTTCCGTTTGTTTCGCTGACAG
      TTGAACAGTTGTAACTGATGTCAAGTTGACATTAAGTTTTTCATAAAATGTTGCCAGAATAGTGTTGAACTGGCCTTTCA
      GAACATCAAAAGTGGTGGCAGTAAAAGTTTATGAGATTTGAGGAAGGTATAATATTGGAAAACATAAGGTGCTACAAAAA
      CGTTCGACCTCGTTTAAAGCAACTTTGCTGAAGGACAAAGTTTACAAGCACAATAATGTTACAATATTTAATCTTATTCT
      TATGTCAAAATACATAGTCATTCAAGAATTCTCTAAGCGATTAAAAAGAAAACAATCTATTTTCAATTATTCTAAAACAC
      TTTAGAATTCACAGACTCAACAAGAGCAGTCCCCAAAATTCTAAGGTATATCCTTGTTAAGAGCATTTCAAATAGTTACA
      CCTTGAGCGAACAATATCTTAATGTTGCTCCATTCAGGAATATTGTAAACATGGCACACATTTCAGGGCGTAAATTTCAA
      TCAAGCCGACTAATGTGGGCGGTTTTCACTTTGTTCGTGTCTCGCCCACCAACATTCCCTATAAATACATCCACCCACCT
      TCTGTGAAATGTAGATGCCGATATTTGGCGTTAGTTTTTAGACGCAAAAGACACAGGTGTTAGCAACTACACGACGCCTG
      ATTGCCTACTGTGAGCAGACGAATACATTAATGATAATGCTCCTTTGCCGGCGGGCAGAATTGAGCAGCCAACCACCAAG
      TGACATCATTAAACCAACTGCCAAAGTAAATCATATATGTATGAAACTTTGGGCAACAGTTCTGGGTATAACAATAATCT
      TTTGGTAGGTGGGAGAAACCAGGCAAATAAATTTATGGCAGTTGAACTCTTGGCAAAGTCGGAGACGGCTAGAGTTTGTC
      TGGGTAAGCATTACGCATATAATTCAGAAGCAGTCAATCAAATTAGGTTTAGTTAGGGAGTTCCATACTCATCAGGGTAG
      TGGCTGCCCTAACTAGGTTGTAAAATAGTTTTTAAAGACCAAATGAATGGATTTTTTAAAGAGGTTTAGAACTGAATGGT
      AAAAGTATTAAGATTTTACTTTTCTCATACATGATTTCCTTCAAAGGTATACTCGATATTCATAAATTATGGCAAACTTG
      TTTGAATTGTTTTTAAGATTTAATACAGTTCCCATTAATAATCCAAAGTTGTTTCGCTTTAAGCGTTCCTTTTATAAGCA
      CTTTAGCTTACGATGCACCCAAAGTCGCACATGGCCAATTTGCATGATGAATTTTGGCATAAATGCATAAATGCACAACC
      ATCGAGGGAGGGGAAAACCCGCGTAATGCGGCAGTGGCAGCACAATATCTTCACGCACAAGAAAAACCAGGGCAGTGCGA
      TACAGATTTTCCAGATTCCCGCAACAATTGTGCGAACCCAGAAATGGCACAGTCATGAATCATGAGCCAGGCGGAAGATG
      AAGGAAAAGTCCGAGGCAAAGCCGGAAAAAATCACACAAGGCAAACCTTTGCGAACGGCAGCAGAAAATGCCCAAAAGAA
      GAAGGTAACATTGTAAAAGAGAGCTAAAAAAAAAAAAAAATTACTTATCTGCGAGCCAAAATGATTTATTGGCCCAAATG
      GCAAGCAAATAGCATTAAAAGCATGCTGGGGCCACGACCGAAGGGTTTTCCTTGCATAAATTACCCCACCAGAGAGATGG
      CGAGATGGGGAACTCAAAAATCCTGCAGTTCTCTTCCCTTCGATATTGGGCGGGCAATCGGGGCGTGGCAGGGCGTGTCT
      TGACCGGGCTAGTAAACTATGCAAACAAATAGCCAACTTATTTTGGGGGGCCCCGAAGTAAATTGTACAGAGCAGCGCAA
      AATTCGTGCTGCAAAGCAACAGCTGTCGGAAAACTCAAAGTCTGGTCTGTAAAATATCAGTGAAATTACACAGCTCCCGA
      AATGCACAGTCATCTTATTCCAGAGAGTGGAAATCAAATGGAATATTTTATTTTAAAGCAATAATTGTGATGCACAATGT
      TTATTATTTTCAAAAATATCTTTCATCTTGTATTCCACATTGAATGAATACCAATCCTACGTAGTTCGTTATAATTTTTC
      CACTCTTTTCAGCTGGTTGGCTTTCGTCCACCTCCATGCAAATAAAGCGTAATGCATTCTGGTTGGTGAGATCTCAATTA
      AATCCGCTTATCTAGTATTTACACTAGCCAATTTCTGGTATTGTTTCATCTCCAGCTCTCGTTTTATTTTTTAAGTTTAC
      CATACAAAAGCGATTTATTGTGTGTTGTTTTAGGCAAAGGGCAAATATTTTGACTCGCCCGCTAACAAAGCGTACTATAT
      GACCCATATATACATACATCTACTATCCATGGTAATCCACTTACATAGTGAATAAAATAGTTATTTTTCCCAGGCAACAT
      GTTGCTCGTTCGCTTGGCAAGATTTTCTGGCTTTGTTGATGTTCAATCAACCGTATTCGTTAGTTCGTTAAAAAATAATA
      GTTTTCAGTTCAGCAACAGCCAGGACAGGGAGCCGTAAATATTAAAACAAGACAAACAAGTCCCTTTCATTCCCCGCCCC
      CCATCGAATATTTCGAAAGCATATTGAAACCCAATGAAATGAAATACTTCCTTTTGAAAATAAATAAAAATTTATTGGAA
      ACTTGGCGTGAAAAAATTGTGGTATGAGTTCAATCACGATACAAATTAAAGGTATGAGGTTGTGTTCTAACATGATTTAA
      CAGCAAAATAGTAAGCTAAAATAGTTGTGCTGTACAAAAATAATAACTACTCGTATCAAATCTAAACTTCATTACGTTCA
      ACAGGATATACGGAAGGTACAAGTATTTACTTTACAAAATAGAAGTATTTGGCATATTGTTTCAATGCATGGCATTTTTA
      AAATTGTTTGTACATTTCTGCCGGAATTTAAAACCAAAAATTTTCATTTGTATAACAATGAATGGCATGGAATGCCAAAG
      CATCATTTGTACTTAAAAAACTCTACCTTTGTCAGAGCATTGCAATTAATTAAATTGTAAAATATTTGCTTAACACAAAC
      ATCAAGAAGATAACAAAATATTCCAACACGAAAATATGCAGAAATCACAGTGAAAATGGGAGAAACTGTGAACACTGTAG
      AACTACTGGTTAAAGTCGCTAAAAATAAATAAAATGTCGAGTTTAAATGTATTTCAGCCATTTTAATAAAATAAAATGCA
      CGTGGGCTTAGCGGTGGAAAATGTGAATGGATCGCCAGACACGCACACCACCACCAGCCTTTGTTTTCCAGTGTGTGTGT
      GTGTGTGTGCTTGAATTTCACCCTTTACCTGAAAAGGTATGTGTGCTTCTGTGGGTGTGGGAGTGCTGAGTGTGTTTAAA
      TGCAAATTACATTTCATTTCATTACTGCGCGCGGTATTTTCACGCTGGGCTTGAAAATACGGGAATGCGCAGCGGGAAAA
      TAAAAATAAAGAGGAGACTGCAGGCGAAACGAGTTAAAAATAGCAAACGTTAACGTCGGCACTCTGTGAACTAAGCCTTG
      AGGTGTATGCATTAGGGCCAGGCTGCCAGTTGCAACCGCCACCCAGCCCAACGCCAACCCCCCCCCCCCCAAGTTCACCA
      CGCACCCCGCGCCACGACTTAAAGCCTTTCCTCACAGGCATCGGAGGCCAGACAACGGTTATGAACATTCACGCTAATGC
      GTTGTGAATGCAGTTGGCAATTTCGATACCCATTAAAAAAGAGTGTTCCCTTGGCACTTACATCATAAAAACATGTTCTA
      TAAATATACTTACTATTTAAAATAGTTTTTTCCATTACTACTCTAATAAAAGGAATATTAGAATAGTAATAACTGTCTAT
      CAGATTCCACGTAGTGACGCTTCGCACCTTTTTAAAAATATACATAAAATAAACTACAAAATTTAGAATACATTTTTTTT
      TTCAGTTCAATGAACTTGACTTCTATTTTGTAGCAGGTCATCATGAAGTCGATTGACTTGCCTGATTACTATACCATTCT
      ATATGTAAATTCGTGCCACCAAGTGTTGCACATCGCATTGCGACTACGAGGCTGGTGATATTGATGTTGTTGTTGCTGGT
      GCCGCTAATATGGAGCCCCGTCTGGGCTTAGTCTCCATCGTTTTTATCCCCTTCATCGTTCTTAACACCCTGCATTGCTC
      TTAACCCCTTCGTTTCACAATCTGCATCACAGGTGCATTGCCCGTTTTTTCCCCACTTTTCGTAGATACTGTTCATCCTG
      TACTGGCTGCACTGCATTGAAAATCAAATTAAGTTTTAAAATTTAAAGTGCAGCTTTCATTTGCCATCAGAAGCAAAATA
      TAATGAATTCTTATCGAATTGCTGCTGACAATCAAATTACTCGAGTTTGTTTAAGAAATGGAGTTCACTTCAGGCAGGTG
      ACAAAGAATTGAATCCAGAAATGTTTTTAAGAGCTTGCAACATACTTCTTTGTCTCAATTAGACTTAACTTGAAGAAGTA
      AGTATTGCAATCAAATGACAATTTTTATACAAAAGTTGCAAAAATTAGTTAGCTTCAATTTAAAGCTTAGAAAACACTGT
      ACTATTTTGACCCACAATTCGCACCAAACAGTTTAAAAGAAGTAAAGGCACCGAAATAAAACTATACAAATCCAAGGCTT
      TCAGTTAAATTACGTATACGCACAGTATTGCAAATGGAACTTGCTTTCGCCTCGGCTAATTTACAAGCGTTCACAAACAC
      TCACACATATACACTGGCTGGGAAATCCCCCGCCCCCCCCTTAAAGTATGGCATATAAAAACTTTTAGTGCTGCTAACCC
      AACAAGGCACGAAGTGCATATTTCGTTAGGAAATCCTTGTAAGCCACAAAGACTTGAAAAATTTGTGCAGAACCAACCAC
      AAATTTCATGGGAATAAAAATGCAACGCAATAAACAGTGGAGAAAATGGCAAAAGCGGGTGGCGGGGCTTTTGGATGGCC
      GGACCAGTAAGGAACAACATCCAAAGAGCACCAAAATATTCTCGAAGTGAAGTGAAAAGCTCTTCAAAATCAACGCCAAC
      ATCCAAAATCGACCGCCACTCAATGGAGTGGGCCGAAGCGTTTGGCAGAGAATCGATTCGCCATTGCGTACTAGTTTCCA
      ATTAAAAGTTTACTAATTATTTCTAAACTTTTGTACAGTGTGTGCGATCAATGAGCAGAGAGCATGCACTGCCAGCCACC
      AACTTCCCATGAATACTAAGCCACAAAAATTGGTTACGATTGCGAAATGTGGATTCCTGGCTCAGTGCGTATATATGTAC
      ATACATCCCCTCAGAAATGCAGATAGCTCCTGTTGTGGTGGCCATTGGTGTTGTTTGTAGGGCACAATTGCAAGTGCACT
      AAAAGAAAATTTCTTTAGATAATCCTTAAATTAGTAACTTATGTTTTATTGAAACAGCCATGTAATGGCTTGGTCGTTTG
      TGGCTCATAAATTTTGTGTTAATGACTATAGTTTTTTTTTCAAACAAAATTAATAGATTATTCAACTTTCATTTTATTAG
      ATTTCATTATTCCTTGAAAGCATTAAATTATTTTTCTAAACCTTCAATTATAGCGATTAATTTATTTTGAAAAGTGGATC
      TGCATCCGGCATAGCTGGATGCCAGGACATGCCAGTGCTTGTGTCCTCCTTCTGGAAGTTCCGACTCAATCAGACAAGCA
      AACGACGGCTGCAAATGATTTGGTCTGCTGGATGTTTGAAAATGCCGGGCGTGTTTGCGAATTAACAGTCATTTGCGAGA
      CCAAATCCAACGGCTCCCAAGTCGATTGTGCTTGAATTTCGGAGATCGTTAGCCATCCATATCAATTACTAAAATTTCGA
      ATAACTTAGCCGAAACTCAACTAAAGTTTTGCCGCACACACACATTGCTGGTGCAATAAGGAGGGCTTGACTTCTTCCAA
      ACCCTCAGCGAGGGCGACAATGACTTTGTGTAAATATAGGGGGAGAATTGAAATTGTGCCAGCAACCAATATTTGTTATT
      GCAATGGGTGAGTTTGTGCACCGCCCATGCATTTGTCGCTGATTTGTTGGCGTCATTATGTCGCAACTATGGAGACACTC
      TCTCCAGTCCCGCCCAATATAACTCATGACGCACTTAGGGTTTTCAATTTGCACACCCTGGCGTATACGTAATGTTAAAT
      AAATATTGCCAGCATGGGGAGTCGAATGGGGCGAAAAGGCACCTGGTAGCAGGGCGTTCAAATCCCATGCCAACCCAAAT
      TGATATCATTTGTTCCGAACATGTTTATTTTGCGAACGCTTAATTATTCTATTACCCCTGTTTAAATTATACATTTTTCA
      TTTTCCAGGCAAAAAAAGGGAGCGAAATAATGCAAAACTAAAATAAACTAAAATATTCCGCAAATTGCATAATTTGAATC
      AACAAATTTTTTGCACATCATACATTTTAATTGTGATTAATTAGAGATGTTAGTTATCAAGTAGAAGACATAATTGTTCC
      CTGTAAACGGATTTTGCCTTTTAAAGCCGCCTAACTATGCACTAAAACATTTATATATGTAATTAACTTCATTAATTATT
      TCAATGCTACATAATTCCACTGCTTAATTGTGGCAAACATTCCTAACATATACATTTCAAAATTCTACCGTCATTTGAAG
      TGGCAGAACTAAATGTATATTAAACCAAAATTGCACAAATGAAAAGTGTTACAAAAAATAATTGGGGCATTTCTAGGCGT
      CCAAAAAAAAAATTCTTTTGCATAAATAAACGTGTTTATTGGAATATTGATTGTATAATTGTGCAAATTATTACCAGCAT
      GATTCATTGAGCAAAACTGAGTGGGAAAGGTGGTAAATATAAACAAAAAGTAATTATTACGTTGAAATTCGACAAACATA
      AGGCAAAACACACATTTTTCGTTGAAATAATTAAAAATTTGGAATGCTAATGAATGACAGAATGTAGAACATGGATGCGT
      TAATATTTCTTTAAAAATATCATCAAACCAATATATTGCATATAAGGTTAATTTCTATTTAACCAACGCCCAAACAGCAC
      ATGAATGATTCAAAATGATTCTTTTTCCCCGGCCTTTGCACCATCTCAATCCCTTTTTGTTTCCGATTTTTACTGATTTA
      CCCAACATTTTCCTTTTAACTTATTCTTACACTTTTCGCATATTGTTGCTGCTATACTCGTATGGTTACAAAGTTGCTGT
      CACTGTGTCGGCCTTCATTGTGTTTAGACATTTTTACACTCGCCATCAGGATGACAGTTACTGTTTCCTATATTCTGAGT
      CCCGACAAACTGCACAGCACGTGATCGTCGAGATAATACAGATACATATGTATGTATATATCTATATGGCTGGAAGTGCG
      AACTGAAACAACCCACTCCGTGTGATATAAAAATCATATACACACGTTTCTGGCTGTGGCATTTTATTGGCAGCTCTTTT
      ATTTGCAAAGCGTGAGACGCACAACAAAATGTTTTGTTTCTCATGTTTTGCCTTATGTTTATATTTAGTGAAGGAAAAAA
      GAATGGCGGAAATTTTTTCCGTGGTGGCACGTCAACATTTAATGTGTGTTTCTTAGCAATGAAATTTTAACTCAGCTGTT
      TAAGGATTTAGCAATCAGGCAAAACTTTTTGCCTGCGAATGGCAAATATAATTAATGGATTTTATCCAATTAGCCTGCTT
      TCACAAAATGCAAAACATTTTAAAATTCACTCCGAAATTCTCAGCCACTTCTCTTGATTCATATATATATATATATATAT
      ATATGGCGGATGAAAGCGTGAATAATTTTTGCTATTCATAAACGTTTGTGGTGCTGTGTTGGTAACAACATGAATGTATT
      TTCGTGATGTTTTGGGGAAATTTCATTTTTTCATAAAACTGAGCGAAACAAGTGGGTAATAAATGTGAAATGTCAATTGG
      CTTGCCGGCGAGGGTATCGCAAAAATTTAATAAATAAATAACGAGGGCAATGTGATAGCAGCTCTGGGCGAAATGGCACA
      TGTGCGCAGAGCGGAAGACTCGATTCATTTCAATCGCAGTGCAAAAATTGAGCATACGCCCTGTCGTACGGAAAAGTGCA
      CTGCAGACTGACAGATAAAATCATTAAAGTAAGTGAGCCAAGTCAACGCTAAAACATATATCGGCATGCTGCTTGACAGT
      TCGACTATTTGACTTAAGTATCCCCGGATGCCAGCACACAGAGCCGGCTTTCCCATCCTCCCCAACCGATGCCCCACTGA
      GATCAGGAGCACGGTTTTTCCGGAGAAAATGCGGGGAAAGTGGCGGCTGATACAGATGCTGTTGCCAGTACTGAATAAAC
      TTGTAGACGATGAAAATCGCAAACATGCAGTTTTTCCCATTCCCATCCAAACCTCCGCACCATTTTTACCATAGCCTCGG
      GACAAGGCAAAAACTTTCGCATCTCGCATCTCGATATGTGTGTTCGCAAATAAAATTTGTTTAATGCCGAGGCGCAAACT
      ACAGTCGTGTTGACGTGATGCATTGTCGTTTGTTTACCCAGCCAGAGCTTTACAATAAATGCAGCCAACGAATCTGGGCG
      TTTTACATCCCACTTAAAGCGAAAACCATAAAGTTTGCATTAAATTATGTATACGGATAAGGACACATTTGGTTGAAAGG
      AGCACAAATTTTATAGAACTTCCAATACAATTGCGTTACAATAAATTTGGTAAAGATTTTTTTCATTTCATTTTTTTTAG
      TATGCTCCTGCAGTAAACATCATAAATATTATATTTATTATATAATTTCCTTAAAAAATTACTTTACTAATTTTATGGTA
      TTTACTTTCTTACAAAGGGAAATTCTGCGTTTCTTTAAGTTTTCAAGTTTCAAGTGGGTTTCTTTCTTTGCATGAACCCC
      GGAATTCTTTTTGCTTTTCTCACAACTTTCACTTGGCTGACTTTGGAGAAAGCAGACCATTTCATTATCTTGTGCTGTGG
      CAGACTTCGGAGCTTGATTAATTACTACTTGTTAACGCCTTGGCTGGATGCTCAAGGGTTAACCGGCATCAGCATCCGTC
      CATCAAGGATTCGCTTCAATTTCACAGCTTACTTCCCACAATCCTGCCAAGCTGGAATCGTGGGATGTTACTTTCAGGCA
      GTCAGGGCCAGGTCAGTGCTGGAATTGAAATGCATTTTTAATTAATTGAGAGAAGGCGAAAACTCTGCGGTAAATCGCTG
      AACTGTTTGACCTTTCGAAGGCTGTAACCGGTACTCACTACATGCCAAGGTTAACCACGATTAAAAAAGTTATGCCAGCC
      AATTGAGTATTACTGGATTTGTTTTGAGTTAAGTCAACAAAAATACGAGCAAACTTATACAGCTGCTTTAATGACAACGA
      AAGGATTGAAATGAATAAAGTTATTTACGTGTATACAAATTAAGACAATTAAATAGGATAACAAAAATTCGTATATAACT
      GTGAAGTTGGTTAATTGTAAATATGTGTAGTTTTAAAAGCTACTGTTAGTTTTGTTTTTCATTCACTTTACAATTACAAT
      TATGTTTTGCCAAATGGCATCAAAGTGCAGAGTTCTGCATATAAAAAGCTGCTTAATATAACTAAGATTAAAATCGGAAA
      CTCGTCCAAGTAGCATCCAAATGAGCTGAAAATAGCAGAGAAAGTTCTGTTTCGTGCATTTATTTTGCACTTTGAACTGG
      CACAAAGTTGTCAAGCTTTTTTGTTCAGGAGCCAAATGAAACTGAAAGCAGCAAAAGCCAACTGAAAATTGGACCCAAAA
      ATCGTGGACATTTTGAGATGATTTTGTTGTAATATTCGTTAAGAGAACTGAGCTGTCGAGCAATTTGGGGGGAAAAAGTT
      TTGAACTGTGCCCAAGTACTTCAATTTAAACTTTTTAGCCAGCCCACGAGTTCATTTTTTGTTCTCTTCTTTGGCCGCTT
      TTATTTGGCTTGAAGGACACTGAAGATTTGGCATTAAATGAAAAAGGAAATTGTGTAAGGATTTTGGATTAAGGCGCATT
      AGAAAAGGGTTGCAGCTGTAACTAAATGAATTGCTAATTAAGTTGGGACAAAACGCACTAAGTCAAGCTAAGCCTGCCAA
      ATTATTAATAATCCTGGTAGAATTTTTACTTTTACCATCTTAGAAACTAATTTGCCTTCCCCAACTTTTCCGACTTGGTC
      AACGACGCGTGTCGAACTTCATTTTGATATGGGTCCAGGTCACTGACATATCAATTTGACCACAAAAGCTTTCAAACAAA
      GGCCAGAACACAAAGTTGGCCGCAAAATTCAATTTGGACACAATGAGACACGAGCATGCGAAATGCGCAAAAATATCTTT
      CTTGCAAATAGTTTAGGGAAATTCCAGCAAGTTTTATTTGCGACTGAGATCAAAAGGTGAACATCTAGTGAAAAATTCAA
      AGTGCAAACGAAAATTCAAATGGGTTGGGAAATGGCCATTTCAATTTCTGATATGGAAAAATTCCAAGCAAGCCGAAACA
      AAGCCATTTCAAGCTGCTAAAATATGTTCCAAATATTTACTATTTACTGATGAAAAAGTCGACTACCAAAGTTGAGCAAT
      AGAAATGGAACTCAATATTGGAAGATACATATTGAGTTTAATTAAAAAGTAATAAATGAATGAGCATCATTGACAATTTA
      AATATTAGAAGTATATTCATTTACCTATTTCTTAAACATGTATGCCAAAAAGTAATAAGAGTCGATTCTAAAGGTATGCC
      ATTCAGCTTACAGTAATATTTACTTATTTACCCTTATTGTTTCTGACTTTTTACAGTGTACTTTTGTGGGTATATTTTTG
      AGTTGAAATTAGTCTAGGCAAACTCATGATAGTCTCCTAGAGAAATATTTCTAGCTTAAATTAGCATTCCGTTCGGTGAG
      CTGACAGCACTTAAAACATCCGACTGCGAATGCAAATAATGTGCACAACTTGCGGGGTGACTACGAGTGCCCATGGAAAT
      GAGAGCACTCCATGTCATAAGTCAATAACCCAATCACAAGTTCGCAAATCCTGCTAAACTTCAACGACTTTTTAAGACTA
      ATTGGTTGACGATTTGCCCATATACATATGTTGTCCTCAATGCGCTTTTCAAATTCGCACATAACCGGCTGTCAAATCAG
      TTGTTGTCGGAATGAAATGATATGTCAATCAATCATTTTCATTTGATCGATTTCGGTGGGCGTAAGTCGTGCAGTTTGTC
      AAATCGAGAAAGTTTAGCTGGCTGCTTCCTCACTGAGAAAATATAGATATATATAAGAGTCCAGTGAGCCCGGCGAAATT
      TTAGTGATTAAATTTAGTTTTTTGTTTCGGAACTTAAATCGAACTCGTTACGAAATCGATGACCTTAATTGGAAGTGAAC
      TGAAATATGTGCTCCATCATGGCGCTTTACTTCATCGTCAACGAATCCACATCCACTCGAGTCCAATCGATGATAAATGA
      TTACACATAATGACGTTGACACAAAAGGCACAAGATCCTTAGGCTGGAAAAAAGCAAGCAAATCAACTGGCTATAAAATC
      TTCAGGAATTTATATCTATATCGATGACGTCCTTCAAGGCATAAAAATTCCACTCAGCCATTGGGAAATTTTTTCGTATT
      ATTATTATTGATTTTATAAAAGAACATGTTCTATGTGCTCCTTTTATGGCGATTCTCTTTAAATCCAAGGCAATTTAACT
      GCCAGCTTGGTTAATTTTTTCACATAAACGCGCTTAATTGGCCAAATTATGTGTGCAAGCAAAGTAAAGGGGGAAAATAC
      ATCGCAAAAAGTGAGCCACAAAGCATTGAAAAACTGAGCGGAAACACAAAATTTTTTCACTTAACAATATACTAAGCCAT
      GAACACTCTTTAGTGCTAAAATTGATGGCCCTGCGGGACATGAAGTAAAAAATATATATAATAAATATATAGCTGAATTA
      TGTTTTCAGTGATGTATGCACGACTTTAAAAATTCGCATTTTTAATATTAATAATTTTCTATTATTGAATTATATATTGT
      AGAGTAAATTTGATTACTTAGAAATTTAAAAAAGGCAGTTATGTTCTGTAAAAATAATGATGTAACTATTTTTTTCTTTT
      GTGATTGCTAAAAAATGCATATATATATTTTTTATAAAATGTATTTTATATATAAATTATACCAAACTTTGTAAGGACTC
      GTCACTCCGCTGAAATGGAAAGGATACAGAAAAATGCTGCCAATTGCTGTTGGCTTGTGGCTGAAACACGATGGTTCTAT
      GTTGGCTTGGTAGCGGTGACGTTTAATTTAAAATGAAATACATCATGCTGGCCAATTATTTGAGCAATTTGGCAAATTAG
      TGGCCCAAGTCATTTCGGCTAGCCCCCCGAATAGCGGCAATTACGAGGCAGTTTTCAACTCTTCTCTTCTCTCCACGCTT
      TCCATGCAAATTATTGTAGCCCACTTTGCTGCAGTTGCCACTGCTGCTGCTAATTACGGCACAAAGACAATTGGTTGTAG
      AAAGCGAAAGTCAGAGTTTCGAAACTGCACAAATGTCGACTGCTTTTGGCAAGGTTAATAGCTTGACTTTTGTCAACGCC
      GTCTCAAGTGCAGCTCTCAACAATATCGCACGCATACAGTTAGCCCTACGAATGCCATGGGCCAAGTTAAAACGCATTTT
      TGCCAAAACAATGGCGCCAGCAAACGAAGGGTGAAATCTGAATGGGATTTAGACACTGGGCGAACGAACGGGCACAAAAA
      TACGCAGAAACGTGAAATAACAGAAGCAGTCAAAGCCGGGCCACACAATGAAATTTTAATTAAGTCTGAGCTGCGACTCG
      CTTTGTGCTGATGCAGCCAAATGAAATGCCACTGATTATGTTTGTATGCCCGCTACCCATTCATTGAATCGGGAAAGTCT
      GGTACATTCGGTAAAATCTGAAAAAAAAGAGCAGATTATGTACATGTGTGCGAAATGGAATAGAGGTTCAAACAATAGAT
      ACCATAATTGTGAAGGAGTTGAGTCATTTTAAAGGATATTAAATTCATACATGTTCATATTCTGACTAATTCATCGGAGT
      GATTATAGACTTTATATAATTCTGCTGTAAATTTATTTTCAATGAATTCATTTGTAATGAATATTTGTTAAGTTCATCGG
      ATGAATCTAAGAGGTACTTTTATGTTTACCCGAAAGCAAGAACGCGCTTGAATAGCTCGTAAAGTGCTGGCATATACACA
      TATTTGTTTGCGATTTTTCCGTATGTATAGTATGCATTTACTTTTCTACTTTTACTTAACCCAACGCCACCCATCGACAC
      CCAGCCCCTTACTACTTTCGACTTTCCCCCATTTCGCCATGCATCCGTTTGTTGCTTTGTTCTACGTCTGAATGGCTACA
      CAAATACAAAACGTCTGCACATTGTATCTTGTTTAGTATGAAACATAAATGCATTTGTGTAATTACACAACATACACAAC
      TGTATCTAGAGAGCCTTGTTTTGGTATGTCTGCTGGGCTGCTCTTAGCCCGCTGGGAGGTTGGGCAAGGATCGGGTAAGG
      GGAAGGGGAAGGGGAAGGCGAAGGGGCAGGGAGAAGGCGTGATGCAGGCTCCTCACTAATTGAAGTAAATGTGCTAAAGG
      CTTGCCGAAGTTATTCGCAATGGGAGTGTGTTTCGGCTAATGATTGTTAATGGATTCATTAGGAATCCCTATTTTTACTT
      ACAGCTAACTAGGCTAATTTAATATTAAAGCGGTGTCGAAAAGCGGAAGTAAGAAACAAGTTTGGTGAGCTTAAATAGCA
      AGCTTTTTGTCTCAGTAAATTTAAAATGAAGTTAATACTTTAAACGAACATTTCTTGGCTGAAAATCTAAAGGAGAAACA
      TTTCACCTTTTAAGTTCGCCCAATACGTATTCAGTCAATTACTCTTGTTTCTAATCCTTTTAATCCTTTTCGGACTCAAT
      AACGCAATCAGCTCGGTAACAACTAAGTGCAACAATTGCCTTGGTAATCGAATAGTTAATTATGCCCAGCATGCAACAGG
      CCAAGTCAAAGGCGCTCCCATTTAGTTTTCATTACGAGTTTTGGGGTTGCACGTGATGGGCATGGATAAATGAAGACAAA
      TAACTGGTTCAGGACCAAAACCTTCCTTCCGATTTGTATGCATAGACTGGCCACAGAAATGTAATACAAAGGAAAAATTA
      CTTGCTTACCTCTGGATCGCTTCGTTCTGTGTTCGGATCCCTATTTAATTAAGCACTTAATTATTTAATGCGCTGATTGC
      GCAATAATTCAAACGACCCCTTGCTTGGCTCAGCTTAGCCAGAGTCCTTCGAAAGTTAGCTATAAAGTGGACCATAGTAG
      TGACAGATAAAATGAACTGGACCTTAATTGTTAACGAATAAAATGGGTAGTAAGATGATTACGAAAACACGCTGTGAAAA
      TGTAATATAATTAGCTTCTGCTCTAGAAGGTCCACCCTAAAAAGGATGTAGTGAATGTGAGTGTGTTGAGGTGTCATAAT
      TATCGCATTGGGTAGCCCAAATTTAATCAGATCACCGCACCATAGGTCAAGTCAAGGTGTGGCAATGGTTTTCCATTTGA
      TTGCGTTGCTCTAGACTGAAATTAAATGAAGCGGGTAATGAATTACACTGAACTACATGCAATAAAGCAATGATATGTGT
      TATAATTTATTATCCTTTCAGTGCAATAGGTAAATCGAATTCCTTGTATTAGTTACTGGCTATAGATTTGTTTTAAAATT
      AATTCTTTTATTACCACTTTTGATTAGATTTAATAAAGACCCGTCTAATGGGTCTTACTGCACTTCTTAGTTGACAACAT
      ATGGAGCTGAATGCTACAGTAAAATTTTAATAAAGTCCACCATCGACTTGGTGACCCTTGCAATTCATTTCATTTCCATA
      TGCTGACTCTGTCAACCGCCTGTCTCTCTAATTAAACTTTATGGAGGAGCCAACATTTGTTCCTCACCAACGCCTTATTA
      AGCATTTTCATTATCCTGCACTTGACCAGCTCGGTCCCTTTAATAATGCTCATTTGCCCACAGAGTGAAACGAGAAATAT
      AAAATAGAAAGGGAAATGCAACTGGGGTTGAGTGAGCATAATTAAGGATACTTCACCCGATGCCATTAAGTGCAATGAAC
      TAAGTGGATTAAGTGCATTTAGGAGGACAAAAAAAATAAAATAAAAAACAATAGAATGATGTGCTTATTGCTTTTAATCA
      CATTGCTTATTTGTGAATAAATGAATCTGGCCCTGTCCATGCGTTCATTATGCAATCAGCCGTTTTCAATTAATGGCTAA
      GACAACATGCCCCGCTCGCCGTATCCCAATTCCATTAAAACACGAATCAATTTAATAGAGTTCTCACACTTCCATCCCAC
      TTCTTCCAAATACCCATTCTCTAGAGATAAAGCAAATATTGGTTCTCCACGCGGTGCATGTGTATCGTGGATACAAATAA
      AAAAAAAATAAGAAAAATGAGCACGGGGAAACAAAATCAATCGAAAATGTTTGCTGCACTCAAATTAAAAACACAAACAA
      ACCAATTCCAGGCTAGTGTAAGAGTGAATGTAAACAAAGTGGCAAATAAATTTGATTTGTATGCAACAAACGTGAGCTGA
      GCGAAATAAATACACTGAAAAGAAAAAACTCGAGCTGTAATTTCTGCATTTAAAATGGTAAAATAAGAGAGGGCTCACAC
      ATATACATACTTGCTCCTTTTGGCCCTGGCATACATACATATTCTCAGCCTTGTTGTGCGGCACAAAATTTGCGCTATTA
      ATATTTGCATTCAACTGGCAACAGCCCAAGCAGCCGAGCCACCACCCATACCAATCCCCTGCTGCAACTCCTTCTCCTGC
      TCCTCTCAACACTCCTTGAAACTATCAACACATCTGCCAGCGGCATTGTCAATTGACAATGGTCCTTTGGGGAGAAGGAG
      GGGACAGGGGGCATGGGTGCAGGGCGCAGGGGGCATGGGTGCAGGGCGCTGGGCGCAGGATGCAGGATTCAGGATTCCGG
      AGGCCAGTGGCTTGGCAATGGTGCGTATTATGACTGCAGCTATGCGAGGCTTTCAGGGCAGCCGTATATGGGTTTTCTCT
      ATATTTAAAAAGGCTCAAGCGACACTTAACTTCTGCTCAAAGCACGCCCTACCCAGCATGGGATGCACTGTGGAAAGATC
      CAGTTAAAAAATGCTCAAAAATGATTAAACTTTTGGTATAAATTTGCCTCGAAAAGGATTATACTGTAGTTACAGTGTTG
      CAATAATAAATTTAATTTGTTTACGCCTAATTGTTAGTAGTTCGTATGGTTTCATGCTTGTACTTTAATAATGAATCTGT
      AACAATGATAATTTATTATATTCAATAAGTTTGTCTAAATATACTATTTACTTATGGAAAATATCAAGATTTTTAAAACT
      AGTCGCAATTACTTTTTGGTAAATATCAACACATTTTAACAACTTTTCCTTATATTCAAAATTTTAGAGGATTTACTTAG
      ACGTACCTTTCAAATGAAATTTCTGAGTGATATTTTTCGTGTAGCAGATTTGTGCCAAATAGACGGAGTGCGCCAGGCAT
      GGCCTTCGTCGCACCAATCTAGCATTCCCCGTAGACTACGGATGCCTGAACAACCTGAACCGAACTACTTGGATGAGCCG
      GAGACAATCTCCGTCGGGCGATTCATCTTCAAGATCATAAGGATTGGTGCGCTTCTGCTGATTTGGGCTTTCTTTACTTA
      CATTCTGGTTCGGAATGCCACCACGCCGGATTTGACATCGGTGGTCACTGTGTTGCCCAACGAGACTGTGCTCCGCCGCC
      TGTCCGTGCCCCATGATGCGACTCAGATAACGCTGAAGGGTCCCATCGATTTGCAATTGCAGAAGCATGAAAGCGTGATT
      ATGGAGACGCCCCATGTGGGCGTACGCGTGGAGTGGCGGGATTCGGAATTGAAAACCAAATTCTGGAGTTCGGATATGTG
      GATTGTCTATCTGGCCGAGCAGAGTCAGGCTTTCACGAAGACGTCCAAAACCGTTCAGATCTCGGAGGTTAGTAATGCCC
      AGGCGGTGATTTCGCTGGAGAGCAGAAGCGAGGAGCCGGTGGCGCTGCTGATGGTGGTATCGGTGTATCCCTTGGTAACG
      GAAAATGGTGTACTCTATGCCGCTCTGCTGCTGATCGGTTTCTATATACTGATCGTCTTCGAGCTTACGGATCGTACATT
      CGCTGCTCTTATGATGGCCACCACTGGGATAGCGATTCTAACGGCGCTGGGAAATCGACCGACTCTGGAAACAATAATCT
      CCTGGATTGATTTCGAAACTCTAATACTGCTCCTCGGTATGATGATACTGGTGGCGATAATGTCCGAGACGGGTGTATTT
      GATTGGATGGCTGTGCTGGCGTACCGAATATCCAAGGGTAATCCCTGGCCAATGCTCCTGCTGCTCAGCTCAATTACCGC
      CATCATGTCCTGTATGCTCGATAATGTGACCATGCTGCTTCTGATGGCGCCAATTGCGATCCGTTTGTGCGAAGCCATGG
      CCGTCCAGACGCCACTTGTCCTGATAGTGGTGGTGATGTACTCAAATATCGGTGGCACCCTCACGCCAGTGGGTGATCCA
      CCCAATGTGATCATTGCCACCAATTCGGAAGTGATCTCCGCCGGAGTGGATTTCCTCGATTTCACCATTCACATGTTGCC
      TGGCGTTTTATTGGCGGCTGTAGCGGGCTATGCTGTCATGTATGTGACCATGAGGAAATCTTTGTTTAAACTGGAGGAAC
      AACAACTTGAGCTGGCAGCTGAGCGGGAGAACAGTAGACGGCGATCGAGTGCGGATATTACGGCTCGGGCAGAAGAAATG
      CGCATACGACAGCCGACGGGACGACAGTTACTGAAGCCGGCCGAAAACTATTTTCAGACCCTGGCCCATTTGGAGGCACA
      TCATCGGATCCGGGACAAGACGCTGCTGATCAAGTGCCTCTTCACGCTGTGTTTTGTGATCATATTTTTCCTGTTGCATT
      CACTGCCCTTTATGCACGGTGCCACATTGGGTTGGGTGGCAATTTTGGCCGCCTTCCTGCTTCTCATTCTGGCCAAGATG
      AACGACATTGAGGCGATACTTGACCAGGTCGAATGGTCAGCGCTGCTCTTTCTGGCCGCTCTATTCGTGCTCACTGAGGC
      GGTGGATAAATTGGGCTTCATTCGCTGGCTGTGTGATCTCACAGTCAAGGTGATCATGAGCGTCGAGGAGCGTTATCAGA
      CGACAGTGGCCATCCTGATAATCATCTGGATGTCCGCCATTCTGGCGGCCTTTGTCGGCAATGTCCCGGTGACCACGATG
      CTGCTGAGACTGAACATTGAGTTGCACCGTAACGATGCCATCAGCGTTCCATTAACGCCCCTCATTTGGGCTTTGTCATA
      TGGCGCCTGTTTCGGTGGTAATGGCACCCTGATCGGGGCTTCGGCCAATGTTGTCGCAGCGGCAATCGCCCAACAGTATG
      GCTATAAGATCTCCTTTGTGCAGTTCTTCATCTACGGCTTTCCCATGATGCTGACCAGTATTTTTCTCGCAACGGTTTAC
      CTGCTCATCGCGCACTCGCTATTCGCGTGGCACAAGACGTAGTTTTCCAGGATACCAAGCCTCTGGATGTTACTCCGATT
      CTAGCACATGGCTTCTGTAAGGAAGTGTATACATACATCCCAAATGTAAAGTAATTCGTCTTCCCCATTAAAGTTTACTA
      TAGTTTTTAAAGCTAGCAATTGAAATAAGTGTATATGGATGGCTAAGCAAGATAAGTAAGGTATTTTAAATAAATTTTAC
      ACACTGGAGTTGTTGGAATTGTTTTTATATATTTTTAGTTAATGATTAAGTTAATTATAAGAAATAATACAACATTTTAC
      CGATATATTTTAAAGTTGAGACCTTTCTTGCCTTTTCGCCCACTGTAACTTTTAATATAGCATACTTTGGTGCGCAACGA
      CCCCGACGACTCGAGCTGCAATGACAATGCGTAGCTTGGCTAAATTCTTCCGCTTAATCGCGCAATAATAGCTCAAGGGT
      GTTAAATATGCATAAACAGCGGCAACAAAGGCAACAACTGCTATTACAACTGACTAGATCTGTGTGCAACAGCAACTGAG
      CCACATATGCTGCAAGGTCCTTGTGGGTCTAAATATAATTCCAACTGTGAGGACTATCGGATTCAGTTAAATGAAGCTAA
      TTCAAAGATGCTCCTAAGCCACGAAAAACACCCTATCTGGCAAATTAAAGCGAAACCGGGTGTTGCTTATTTACTTAATT
      ATGGCAATCAAAAAATTCTTGGGAAAAACGCAAAACCAAAACCTCGAGGGAAAAACGAGGGCAAACCCAGAACAGCAAAA
      CATGCTGTACCCCAATAAATCAACTAATTAAATATTCCAATTCGCAGTCAAATTGTTTGATTTCTGTAAATTTAAACAGA
      CCCCTGTGCCCCTCTTTTCGTTTTTGCTCTGATTCGATGTCGCTACTTAATTCATAACGTTGGTAAATAACAACAGCCCC
      ATATATATATATATATATTTAAACATACATATTTACCAAAACACGCGACAGCTGGAAAAATTAGTGAAATATCAAATGAA
      ATAAAATAAAATAAAGCGTAATGTCTGATTGCGTTGGTGTTTCTGGCTTTTGCCAATGGCAAACATGAAAGCAGCTTTGC
      ATGTGAGCAGAGCGCCAAACAAAAATCGAAACAACAAATTGAATGTAAGCCAAAGCAACAATATGTATGTATGTGGCAAC
      AACAGGTAAGAGCAATGGCAACGTAAAGCTAATTACCTTAATTGCACGGGGCGTGTAGAAACACTTGATGAAGGCGACGA
      GGACAAAACTTTAACATGGCCTCTAGCCTCTAACGTTACTTGCTCGGAATTCTAAGCCCGGAACAGAGATGGTTCCGTGA
      GTAGAGGGTATTTTAAAATTAAAAAATCCGCACTATATAAATATAATATATCATATAATAGTATAATATATAGTATATAT
      AAAAGTATAATAAAAACACAATTATGAAATATAATAATTTGTACTTTAAAAGCCGAATTATATTATGGTTTCAATGTAAT
      TCAATGTAGTTTCATTTTTAAAACCTTATTCTAACCGTTTTACAAAAATGATTGTTAAAGGAATTTGCAAGCAATAACTC
      AGTGAATATTCTTGTAAAATACATTCTTAGAACTACAAAGAAATATATATAGTAAAAGGGTATTTTTAACAGTATTTTTA
      ATAAGTAATTCCGCGTAATTTCTCTTTGATATCTCATAAATCTATAAATTGCGATTATAACGTAATATATATGGGCAGGT
      GTACTTGCATTATATTTTTGCCAACTCTGTTGAGGCTAAAAGAACACTAGTTACCAGGTTACGCGAAAGCGTCACGTTGG
      CATCGCGTGCTGGGCAACGTGTGCTGGATAATATAACGTATACGCCAAGGCGGCCAAATGTGTAGAAATGAAACATTAAA
      TTACATTGGATTCTCGGTGCTCCCGGGCTGGCCTCTTACCCACTTATTGCAGCTGGCTGGTTGCCCATTGTCTCTCTCGT
      CTTTTGACCCCTTCTGTTTGGGGCCAGGTGTGGTTTGCACGTAGATCGCGCACGTAGCTGAAATTTTAAGCACTCCGAAA
      GGAAACCGAAGGATAGTCGGACATACCGCCGGCGGTTTTGCTCTGAAGTGCGCTTTAATAGTTGGCTGTCTGCAGCTGGC
      GCAGCTGGGAAATCGGAAAAGCGAAAAAGCGAAAAGCAACAGCACCGTGGCTGCGGCATTTGAATGTGGCGTGTCGGCAG
      GCCAGAGTGCTGTTTAATAAAATGGTGGGGAACACAGAAGTCATGGCACATTGGATCTGCAACACGAACTGAAAGTGTAA
      TTATGCAGATGTTTGAGGATCAGCCACAACAATGATTTATGTATGTCTGCTTGGCCCAAAACGCCGTCCCTAATTACATC
      TGCAGCGAACACAAGGACACCGAAGAGTGCATAGCATTAACCTTAGCTTTCCATGAAAAGCACACATGAGGAGCCTGAGA
      AAATCGGCTTTCACCTGGGCAATCATGAATTAAATCTGAAATCCCAGACTTGAGGACACAAAAGTAATTAACTTAGGCTG
      ACTTGTATGCCCAGGGCCATCATCAATTTCCCGACTTGTCACTCTCCGTCGGAAGTTGGTGTTAATTCTCGTCTAATTTG
      TATTTCACCTGTCCTCCCACACGACCAGGCCGGCAGTTAAAAATCCTTTAGGCCAACATAAAAATGACATTAAGTCTGCC
      AGTGATTATCCTTGTTTTGTGGGCGTTCCGATTGTTCCTTTGATTGGTGATGAGCATTATTAGAGATTAGTGAAAAGGAC
      AATAAAGTTCTATCAGATTATTTATACACAATCAGGTGTCTAATCAATGTTTCCTTTTCAAATTGAAAATATATACTTTA
      ACTAAATGGTAGTTACATTTTATAAGTATTCTCTTTATTACTAATTTAAGTATTTTAGTGTTACAAATAAAATTTCTTAC
      AATAATATTTACTTAATAAAGGACCTAACTTTGTTTGGTTTAGTTATCCTCATATCGTAAAGTTGCAAACAACTACTTCA
      ACTTACCAGATCTTCTTTTTCACTTATCTCTTCCAATTGTGATAAATATATATATAATGTTAAGTTTCAGCCCTTACCGC
      AATACCATCACGATGCCATCTTTGGTAGCTCAACTAAATATCCTTTGGTCACGCACACTAATGTCCGGAGTGCGGACATA
      GTTTTCCGGACTAATAGGCAGACATTGGACGATGGGTCAAGAACATATCTCAGCCGAGTTGTGCTTGGTATTATTGTTAG
      TTTAATAGTCCCATTGCATTTTTTACATAGCTCTCTAAGGACGGCATACATTGTTTACTGATGGTAATAATGATTACTTA
      TTTCGAGGATTTCGTACTCGCTCCACAGAGTGCTGCCCGGTTTTATTGGCATTGTTAATATTTGCTTTGTTGGCATCCTT
      GGTTTATTTGCTCAGGATTTGCAAGGATACCACTCCGCATCGTAGACACAGGCTCATTTAGTTTTATTGCGCATTTTGGA
      TTGTGGCATTCGGAAAATTTAGCTGAATGCTTCAGTATTTTAAAGATGTTGCCCCAAGCTGCCGAAATATGTTAGCTTTT
      TGATTCGGTTTATTCACTTGAGGTTCGCCAACCGAATGCGGCAATTAAAATTTTCGCCTTTATGCTGAGATTCCTGCCAA
      TTTTCCTGGAAATATTTTATGAAGCGGCAAACCATTCAAATGGGGCATCAAAATGGAAATGTGCGCTAAGTATTAATTAT
      AATATTTCAAAAATGTATATGAACATAATGATTTTCATAAGAAAATAATATATAGAACTTTCTACACATTTCAAGAATCG
      CGAAATATTTTGATTAATGGAATGGTGAATATCAAAATGAATGCCAAATAGGCAACCCAGAAAACACAGGATATTCATAA
      ATCACAGAGATGTTCATTAATTTGCCGCTTGACAATTGGTCAATGCTCAAGATTTTAAATGCATTAAGAATACGGATACA
      CAATCAAAAAAAATCTGTGAAAATTATACGACCAAAAAAACACAAAGCTCTCAACGGGCCGCAGAAATGATTAATGACAA
      AATATTTAATGAGGACAAGGGAAATCATAAGACTGAGTCAGGTTAAGTACATCGCATTAAATGTGTTTAAATTATTATTA
      CACAGCCAAAGTGAATGGACGGCAAAGGACCATTTGATGTGCTGTGCAAATAAGAAAAACAAATAAATCATGAATATTAA
      GTTGCCCGACAGAGAACAAAAGTCAATTGGCCAATGTTCTTGCGATGAAAGTGGGAGTTGTTAGGCCAGTTTGAGAGCTC
      AACGCCTTGGAAAATGACAATTTTCATTTCATTTGATTAGACGTCTGCCCCAAAACTCAAACTCAAGCTCCCCTAGGGAC
      GAAAATGTTTATGCAATTGGATTCAATTTTTAGATCCCAGTCCAAGCAATTGAATGATGTCAGTCAAACACACACACACA
      CACATATGGAGACAAGGTCTCTAAGGATAAGTCGATTTGTGTGTCTGTGTGGGCTGGAAAACCTACTCTGAGGGCATTTT
      TGGTTTTCGTTTATTAAATTCTGACCTATCTGGGAGGTCCTTTCCATGTACCAAACGCAATTTACAGTATTTTTCATATT
      TCTCTGGTACTCTTATTGAATTCTAACAATTTTCCTATATGTGCGAAATGGCTTAGGCATTTTGATTTAACATTTTCAAT
      ATCAGAACGTAAATTCCTTAGGTTTCAGCTTTTAAGTGCCAAAAGTTAGCTAATTTTCTAAGTAAATAATTCCTTATTAA
      TTTGTAATAAATATAATAACAAAAAAGTAGTAGCGTATATATTTATATGGACTTGCCATAATATACAATTTATTTAAAAA
      GATTCTTATGAGTAATTATAGTACTAGGATTACAATGATGATAAAAGCTTTTTCGACTTTATTTCACTGAGAGCCGGCTT
      AAATGGTTCTAGAAGAAAGACCCTCTTGATTCCACCTGTTTGTCAAGTAAATGCAACGAAAATCTTATGGTTAGCATAAA
      ACACACAATCCCCAAGCCGCAAATGAAAGGCACAAAATCCAGGCAATACTGGGGCTCAAACGAAAGGAGGGAAAAGTGAT
      GGTAAAATAAGAAACAGACGGAAAATGAAAGTGGGGGATGGCAGAGTGGAGGCGTCTCAAGCTACGTAATTTCGTCCAAG
      TGGGCGAAACAAATGTTGAGATTGCAGGCCCGAAAATTCCGCAAAGGAAAATCCAAGCAGTGGTACTTCCTCCCACTTTT
      TTGCCACACCCCTTGACCCACAGCGACTTTTTCATATTTCCTGCTTCAGACGAAGTCGAGTGCGGCTTTAAAAAAGAAGA
      AGAGGGGCGGCAAGAAGGAGCAAGCAAATGACAAGCCATAAAAATTGAGTATACGCATTGGTTGCTTAAGGGATCAAAGG
      ATGTACACACCCACACACACACACACGCACTCATGTTTATATTTGCGTTGCTGTTGTGTGCGAGTGTGGGTGTGCTTGTG
      TTTGATGGCATTCGATTGGCATTTTCAATGTATATAAGTGGCTGCGTGTGGGGTGAAAAGTTATTGCATCATAATTTCCC
      CCACTAAGCATTTATATTGCGCATAATTACATCCGCACATGCCCACGATGCCGTCTAAAAAAGGGATAAAAGATGTAGGA
      TATGACCAAGCACACGCAAACAATGCAAATTGAGGGCACTATAAATGTAAAGGACTCTCTCCGGGAAGAATTCCTTACCA
      TGAAAGGGCTGAAATCACTGGAATATCAAAGCTTCGCTGATCAGATAAAGTGCTCATTTCTAAATAATAAGTACCTACTC
      GAAATTCTTTTACATTTATTCCTGTTTATTACATTTCTTTATAAATAAATTAGATATAATATCGATTTTTTAATAGATGT
      ACATCAAAATACTTGACAAACATATTTATATAAACACCAGAAACATAAATACCCCCAATGATTATTATTTTGTAAAATAA
      TCTCTAATTTAAATCTTATTATAAGACTTATTAAACTAATGTTTGCTACCGCATTTGAATTATTATTTCTTTTGTATGTA
      ACTAACCAAACAAACCAATAAACAGATTTTGACGCAGATTATCGAAATTTTCCCAGCCCTATTATGGCAATATGAAGGAA
      ATCGGTTTTTTAATGGCAGTGGCTGCCCCACAAGGGCATTCAAATGCCATTGCAGACGGAATTCGCCGAGGAATGGGATT
      GGGGGCCGGGGCGATAAAAATGCGTGTTAATGTTTATGCCGCCGGCAAGCGAGGACAATTGTCCTGCGGGGCGTCAAGCC
      GAGCTTATGGCCGAAACCATTATGGACAACTGCAATGGCGATAATAACGCCTCGCTGATACTTCGCACCTGAGACCCATT
      GCACCGCACCGCCCCTTGCCTTTTCCTCCTCACAGGTGGTTGGCGCCGTGCCCAGAAGTATGCCATTAAGCGGGAAAAAA
      ATCCAACCGCCACACAGGACCTCCAACGAAGTGCTGCCAAATACAAAAAAAAAAAAAATTGGGAAAGAAATAATAGCTAC
      ATGTGCGAGTGGCAAAGGGGTATTACAATTCGCTGACACAGCGGCCTGCAAATGTAACACAAATTTTGCGGTTTTGCGGC
      CTTTCCGGCAACAGCAATAATACTACATAGCTTGTAAGCTTGTTAGGTGTGAAATATGCTTTTGGCAGCGATTTTGTTTG
      GCTGCATATTAAATAAATAGCATTTTCCATGGAATGGCAAATCGATTGTGGCAAAACGATTGCATAAATCGTATTTCTTT
      GCTGTTTTTGTAAGCTGAACCGTTAAAAGATTATTTATATTTTATAACATTTTAGGTTCTTTTGTTTTCAGTTTTTTTGT
      ATAGTTTATCCATCAAAAATAATTCCTCGCGGTCATTTCAGATTTTACCTGAAGACCGTCCAATGTTGTTGTTGTAGTTT
      TAGTTTGCCAACGCTAATTGATTCGTTTTCGGCCCAGAGCATTTTCACAATTCAAGACTTTATTTTTCCAGCTTAGGGTC
      AAAATTAATTAAACGATTGAATGACATAGAAATTATAATCGCTTCACTACAAACCTTTAAACTTCGAAAAATGTGAAATA
      TATTAAAGTTTAAACAAAACTAGCCGAAAAGTTATTTCATATACATATTCAAATTTAATGGTATACTGTTGTATTTAACA
      TTTTTTAAATGTTGTTCAGGGTACTGCAGGTGACAGGGAAAAAATACGCGAAGCGCTTGTTAAAAATCCTCCTTTTTTAC
      CATCCAAAAACTGGTTATAAAAGCTGAGAACCGCTTTGACAGGACATCATCAAAAGGATTTTTGAGCTACAACTTATATC
      GCCGGGGCTTCGCTTGCATTGCGGCGACAACGAGAGGTGTTAGCATATGAGAAATTGCGTCAACTAATTGTTCGCAGGGA
      TCGCTCATACGCACCGTATTCCGGTACCAGTACCGGTTACGCTGCCGAACGTCAAAGTGAATGGTTTTTCCAGATGCGTT
      TCGCTCGGCCTGGCTACATTAATTGACACGTGATAATTTAATTAACGTGGCAACCCACAGGCCTGGCAACTAGAAAGATC
      CGAAAGCGTGTATATCGAAGATTCGGAGGAAGGATGCCGACCGGCTTCCACTAATTGGGTCAGCATCGGGGTTTGTCAAG
      GGGAAAAGCCGGGCCCGGCGTGTGTTCATCCATTGTTTCCCCATCGGCCCAGGGCCAACGGCCTCGTCCCCGATGAACGG
      AATGGAGTGGAGTGTCTCTTAATTACGGTGTACGCGTGTTGGCATAGAGGGATTTTCTTGTTAGCCTGTAACACCAACCA
      AAGACCCCGCAAATGCCCGTAAAACCCGAGGGCCACCACCACCACCACTCTCATTAACCATTTTGCATTGTTCGCCACAA
      AGTATGCAACAATAATTGACAACGCGCAAAGCGGAAACAAAACGCAAACTAAACAAAAAGGGAGCTTTGAAGCAAAGTCC
      TGGTTATTTGCCTCATTATTCAATGGAAAAATGCTGTTTATGATATTAATTATAATAGGGAACTTGTCTCTTGCCTCTTA
      GATTTTTTTTGTTCGACAATAGTTTTGTAATTAGGTAAGCTTTATTTGCTTTGATTTGGACATTCAGGAATAATAATGTT
      TACTTTATAGTAATGTGCCGTGTTTTAGAAAATATCAACTTTTTTTTTATTTATTTATTATTAATTATTTATTATTTAAA
      ATATACCTAAGTAATTCATATCTTAAAATAAGACAGTATTGTATACATTTTTAGTTAAATATTTACTTTATGTATTATTT
      TATTTTATATCACCAAATTTATGTATATATTAACTACATATATGTCAGCAATTACATTTATTTGCAGATCCAACAGCCCA
      AAGAAGATAAGCAAATGCGATATATTTGGTACACTCAATTTACTTAGCAGGGCATTAAAATTAAACCTGATTTGCTCTTT
      GAACGGCTCAATTCGGTGATGTTGCAGTTGCCTGGGCCGCGATTTAATTACAAGGACCAAAGCGGCTCCTGCAGTGCCAA
      TGGCAATATAAATGGCAATGTTGAAAGCGGAGCACTGGGCCCGCATCTAAGCGCATTAAGTATGCGCCGCGTGCGCCAAT
      TAGATTGAGTCAGCTGCCTGGAATTACGGCCAGTATTGTGTGCAAACCTCCTTTGCCATCTTCTTTCACTTTTTTATTTT
      CGTCGTTTTCCATCCAATGCGCTTACAAACCAATTAACCTTTTGCAGTGCAATCGCTTCGGGTTTTATTATTAGCCGGAG
      CGAAAGGTGCGGATTTGCGAAGAAGCACTTATTTGTTCCATTTTGCGGTGATGACCACTTTAGACTGGCCCCTGCCGTGA
      GCTGGCCGTTAGCAAATCGATCGGATTGCTACAAATCTTCGGGCATCGTCGGTGATTAACTTGTGGTCAAATCATAAGCG
      ATTCAATATCCTGGCAACCAATCCAGTTCCATTATCTATGCCCTTAATTATAGGTGAGCTGTAAGGCAAAGCTCCTTTAA
      ACTTGGTTAAGTAATGGGCGTCTTAAGACTATAAATGTTAGCAAGTAATAGCACACATAAGCATTTTGACATTTTTCCGG
      AAGTAGTAATTAAAAAATGTATTTCTTATTAATAGTTAATAGAAAGTAATACAAGTGCTTTCTAAACAGACACCTCAAAT
      TAATGCTAAAGTTCAAACATTACGACTGCCACACTTTGAAATGCCACGCCCACAATTTTTTAATTTTTCCTCATTTTATT
      CTTCAATATCTATCGATATCCCAAAAAAATTATGAAATTTCGCTTTCGTTCTACTGGCTGAGTAAAGGGTATCTGATAGA
      TAGTCGGGGAAGTCGACTATAGCATTCTCTATTGATTTTTATTTAATTTTTTCAGTGTGGTGTGTGACCTGGCTAAATGA
      GGTGAGTGTGTAAGCCAACCGAGGAATGTGTATCAACTAAGTCGGAAGGTAATCGATAGTTCTGATAATTGTTGTCCTTA
      TACCATCTCGATTCCAATGTAATTCTTGATATCGATAAATTTGCTGTCGTTGTTCTTTTCAAAGCTTTTATTATCCGAAA
      AGGTTAGTTTCTATTAAAATTGGTATTTAAAGTAACTTAAGGCAAATTAGCATAAATTACAATGAACAAGAGCGATGGAA
      ACGAGAGCTTTGCTCTGGACAGTCTCCCGGAAAACATTCGTTACCCTTTCGGAAAACGAGAACTGGAAATCCTGGAGAAG
      CAACTAGATCGAATTGTTTTGATATACCAGGTGGATACCACATACCACAGTGCACTAAAGGACATAAAGGATCAGAAGAT
      CATATCGCTGCTGGTGGAGCCCAGTTTTTACGGACGACATCACCCCACGTCTATTTTGGTGGTAGCCACGTGCAATGGAA
      CGTACATTTTCGACATCAAGGCCCTTGGCTTGATATTTCTGGAACTGGCCAAGATTCTGGAGGCGGATCAGCCGCGCAAG
      GTAATCCACTACAGCCACCGGATCGCCGATCATCTGTTGCATAGGCAACGCATCTCGTTGGGAGGAATATTTGATACCTT
      TGTGGCTGTATGCCTGAGCAGCAACACAAGAATTCCGTACACCTTGCCAGAGGCTATATCTCTCGTCTTCGGACTACCCA
      TGGAGAAGGTGACTGGAGGCTGTGAGTCGCAGCGTAACTTCACTGCTCGTCCACTGACCCACAGTCAAATGAGATACTTG
      GCCAAGTTGGTCCAGCTTCAACACATAATGCACGATCATTTGAATTATAGTCACATCTTTTGCGCCGAGGTTTATCGCAT
      ATCCTTAGAGTTCAGCCACAGCTACTACGGCTTACGGTCCTGCGACGTCGCCATAAACATGGCACCTGCCAGTAGCTTCG
      GGTTCCAACTCTTAGATTCATTCTGCAAAAAGGCCGACAAGGAACTCGAGCAGATCTAGGAGAGCACCAAATGGGTCGCA
      AGGTAAGGGATTAGTTTGGCAGGAATGTAATGTAATAGCTTCTGCTGATATGTGTCTCATATATGCATATATGAGGTCAA
      GCATGATAGGTCAAGGGACTTGCATGATATGCTCTCTTATTAAATGAAAATTTTTTTTCTTAAAAGTTCTCAAAAATCAC
      GTTTTTTTATGAAACTAAAAGAATACAATATCTAAAGTGTAATCATTCGGCCACTTCATCGACTCTATATATTTATAAGA
      ATATTCTTTTATACATAAATATCTTATAAGAAGTAGGTAAGATACCTAAAAAGAAAACCGTTGCTTACATACCCTTACAG
      TTTTACATTTTAGCTAATTTAAGACCCAAATGAAACATTTATTAAAAGAAGTCCCATGTAATACAAAAAAGATCAAACAC
      AACGGAACTATATTTTATTTTTTATTATCCAATTACATTACATTACAAAAATATAATGACCCAATAATGATTTATTGTTC
      CCTTAAATTATATCGATATCGAAACGATAGAGGCCCGATCAATGAAGATCGATAGTCAAAAAACTGGTCACCTTAAAAGC
      AATGACTGATCAGCTGTCCAAAAAACCTAAATAATAAATAATTTGAATATTAATAAATAAATAAAGTTTTTAAGAAAATC
      TGGAGGAGCACAAATATTAGAAGAAAATTCAGAAAAACAAAGTCACTGTCAAAACACCATCAAATATGAACCGGACCCTG
      AAGATACAAATGAACAAATGATAAAGAATACAGAACATATTAAGGATAGATGTCAAAATTTCATAAAAACGGAAAATCCC
      ACAGATTTATCTTATTCCCAGACTGGCTTATAAGAGGGTGAGCTTAAAAACAGGAAAAAAACGTTTACATTTCTAACGCT
      TCCATCTTGCAGTAATTATGTTAGATGTTAATGATCTGGTTAAGGAGGAGTTCGCCCTGGAGGATCCAAATGAGGAAGAG
      CACAATCAAAGAGACGAGGAAGAGATAAGCTATCAATTGGCTGGCCAGCCAAAAATGTGTTCTACGTGCTTGGAGGCTTT
      TCCCATCGACAACTTTTCATCTCACGCATGCTGGGACATCAATTGCGATCGATTCAGCTGCAAAATCTTCCCTCGAAAGT
      TTCGTTACAAGTCATTGCTTAAAGTGAGTAAGTTAAGGACTAGGTGACTTAGGATTGGTTTTAACATTCCTCTTAACCTC
      CATAGAAGCCACGTCAGACGGCAAAAGGGCGAGAGCATAGCGGAACTGGATTTAGCGAAACCCACAGACTCCAGGACCAA
      GCCCAACTTCGAGTTAAACTACTCACCCACTCCAAGGTGGAAGATATCTCGACGGAGAGCTGGGATGCTGAAGCTCAACG
      AAATGCGTGTGCATCAACAACGCCTGTGCCTCTATTGCCCCATTGCCTTCTCAAACGAATCGCACCTGGAGAAGCACCTG
      AGGGATCACCATGCTGAGCGCCTTTATACAAGCGAATTAATAACCCCAGATTTCGAGACTGATGGCTCAGAACGGATATG
      CGTCAAATTAAACGAGGATGTAGCCTTTAGCTATTTAGTTCTATACAATCACTTGCAAGATTTTATCAAGGGGTATTCTC
      AAATTTATTTTAGTAATTTAATTAAAATAACTAAGCTGTAACGTTAGCAATATAAACGTTATATATATATATTGTTATTG
      TTTATTTGCTTCGTTTTGTTAATTATACAAAATATTTTTCAAATTATTAAAATCGTATACCTTCATTTTCTATACTACAA
      ATATCTGTAAATATTATAATAATTATCACGTTCCAAATATTCACGCTCCACCAGGTAGTCAAGTCTTTTCTTGATAAAAC
      TCACTTGTGGCTTTACCCGATCTTTAAGCTCCTCATAAACGAGTGAAATTAATTCCGAATATTCCAGTTGCTTTTGACCT
      TTCATAATGCGCACTATTGCAGCATCCACTTGCTTGTCTCGCCGTATTTTCAATTCAATTTCGCTTTTCTCTTCAATCTT
      TCTCATTTTTCTGGGCAGGGGCTCATTGCAGAAGAGTCGGCGTTTCCGGTTTGTAAAGTCCATGTTTATTTCTATATAAT
      TTACTTTATTTACTTCGATATAAACCAGAAACTTAATCTGTTTTAATGCCTAAAAGAAAAGAAAAAAAAATAATTTTATA
      GGTAAGTCAAGAGTAATGTCTATACATAACCTATTACTCACCTCTTGGAGGGTCTCCAGCTCGACTCCCAAAGCAGTCAC
      CAATTCCTGCTCCGTAAATCGTTCATGCCGATTGAATAGCATCAGAACGGCCATTTGCAAAGTGCTTACCTCGAGAATAT
      AGACCGACTGATTCAAATGACAGGTTATCTCACCAGAGGATAATTCGTTATTAAGTTGTATAATTGCCTTGCTTTGTAAT
      TTTCTTGCTTCGTAAAAAATACGAAACTCCTTCCAAGCTTGCTGCAGTTCGTCGGGCAACGTGAGGTTAAAATTCTCAAA
      ACTCCCATCATTTTTGAAGCATTTTGGACGAAAATCGAATCCTAACTTGATCCCCTTGCTATTCAAGTGATCTTGAAACT
      CTTTTTTTAGGGTTCTCAACTTATCTACATCTCTTAACTGCACATATATACATCTAGTTACAAAGTTTGCCATTTTTTTA
      TTCAGAAGGGAATACATTATGGACTCAACGCCGTCCGAGGTGGATGTTTCATTGATTTGTCGAATCCGAAGTGCTTTCAA
      ATACATGTCAATAAATTTGTACTCATCGCTTAAAAACTCCACGCATTTAACGATCCGTTTAAGTTCATCAATAATTGCTT
      CCTCGGACTCCTGCCTTTTGGTCATAAGTTCGTTGGCATATGTGACAAGCAGACGGGTGGGGTCAATTATCTGGCCCTTT
      CTATTAATTTCTTCTTTGCACACCGCATCCACGACTTCCGCCAATTTTGTGTGGTCCCGCAATGCTCGCTGCAAAGGACC
      GCGACAAAGTCCCAAGAAGGCTTGGATATAATCCTTGCCTGACAGCCTCGTCTCCTGCAGCCTCGCAGCGAGGTATCTTT
      TTAGTATTGCCTTAAATTGTGTCCCATTCTCAATTTCTGGCATGGCTAGGCATGCGTACCTAAGGAAATGCTTGAAATCC
      TTGTAGTCATTGGATACGACGATCTTTTGGAATTCGTGCAACGTCGTTGACTTGTAGAAATCCATCACCTTCTCAGTGAA
      AATTTTGTCTATCCTAGAAGGCAAGGACACATCTTGGTACTTATCGTTGGCGTACAGTTCCACAATGGATTGGAGCACCT
      GGTATACTTGGTATTCCAATGATTTATTGTATTCCCTGGGCATCTGACTCAAAATCAGCCTAATGGCGGCGAGAATCGTG
      ACGCTGGGCTCGAAGACCAGCTCCTTCCAGCTAATCATGGCCAAGCGATATATCGGATAAGTTTCTTTGTCTCCCTTAAG
      CCGCTCCCGTTCCACCCAGTTGCGGTTGAAGTGGTAGCAAGCTAGGTTCAGTTTCTCACATGACCTTTGATAGGGTACCC
      AGTGCTCTAAATATTTGGCGATCAGTCGAATTGGTTTGTTGTCGTCGAGTTGGTTCTCCATTACCCATGCTATGTTTTTT
      AGTCGCTTCATCAGGCAGTCGGATAGCACAATGTAAAGACTTCTCCCGTTCTTCTGGGCTGGATTATTCCAATTGCGCTC
      CGCCGCGCACTGCTTGTAAATGAGGTGGTATAAGTGCATGAGCTTTTGGCCATCAAAGGAAGTGTAATCATCGAAGATCT
      GATTCACTACTTGCAAAATATTATCGATCAGGGGTAGCATAGAGTCAAAGTAATTAGATATTCTTTTAACCCGATTCATT
      ATTGTTAATGATAGTGTTGCAATTTGAAGTTGGTTTTCTAGGGGAAGTCAATCAGCGTACCGCGATTGTTTGCGCTGTTG
      TACGATCTTATTACTGATACATTCTATTAATGGGTCTTATCGGTTTAGGGATGTTATAATTTCCAGCGCCTGACATTAAC
      CATTCAACGATTCTTATCGATAGCTCTACGCAAAAACATACTAGCTCCACTAACTAAACATAATAATAATATATCACAGA
      ACCGAAGTAATAATTAAAATGTGTGGGAGCTTTGTGTTTTTTAAGGTTAAGATTTAGAATTTGTAACTGATTAATTCGCT
      TCTGTTTTATTTTAAAAATTATTATCCCAGAGTTATATAGTAATATGATTCGCATTCGTCGTTCTCAATCCAAAGTTCTG
      TTGCTAAAGGAAAATATATACTTTATTTATTGAAATGCTCACATATGGCAATAGAAACTTAATAGGTTACAAATTTATAT
      AAAATAAATTTCAATTGTTCGATGCGTAAACACTTCAACTCAACCAGCCCCCAACTACATTTTCAAAAAGAACAAGTTTC
      GCTTCTTTTTAACCTTTTCCAAAGCTGGTGCCTGTTCGGACTCATCGACGTCCTTGTCGAGGTCCGACTTTTTGCCCTTG
      CCCAGCTTATTTTCCTCCTTAAGTTTTTTTCGTTCCTTTTTAGACAGCTTTTTGGATGATTTGTCAGCGCTTCTCGGATG
      TGCTGGTGGTTCCTCGCGCTCAGAATTGTATATATGAAGCCGATTCTTGATGCTCATATCCTCTCGCGCCTCGCGAACTC
      GGTCAGTCTCTAGGCTATCAATTACTTCGTTACGCATTTCAACCACCTTCACAAGGCGATTGATTAATACTTCCTCATGG
      GCTTTATCCGAATCGGTTTTGTTGTGCTCCGGTTGCCCCATTAATACTCGTATCTCATGCTCTATGTCCGCCTGCTCCTG
      CTCCAGGCGATGCTGACGTCGAAGGTACATCAGTTCCGCTTGTCTGCGGAACAATTCGTTTTTCTCGTTGACCAGCTCGA
      ACAGTTGCAATATAAGATCTTCCACTTCCTTTGAGTTGGTTAGCACTTCTGCGGATTCGGGACCATCAGTATCGGTGGCA
      TCTAAGGAACGCTCACAGCGATCCCTGATCATTTTCTCCAGAATAACGCCTTGTTTCTCAAGACCCAGCTGCTGTACCGC
      AATAATTTCGAACTCGTGGCGAATTTCTTGCAGCGGAAGCCTTTGTAAGACTTTGCGCGGTGGTATTGGAACCGCTGGTG
      CTGGTCCCTTTCGCCTCTTCCATTTCCCATGAGTGGATTTATTGTGCCCCAATGGGCTTACGTTTCTATCGAAGTCGTTA
      TACACGATAGGCGATTTTTGATCCTCCTTGCTACGTTCAACAGTGTTTTCGGGTTGAGTTGGCGGCACCAAAATGCGTCG
      GTATACCACATTTACCTCCTCGTCGGCATTGGATGTACTTAAGCTCTCGTCGTAATTACTCGACTCGGTTGCCTCATCGG
      ATAGCAGACTCTGGTCAAGTGGTATTAGTCTTCTGGTTGAATCACCCAGATTTGGGGCCTTAAGCTGAGTGTGCAACAAT
      GCCTTTTGTTCGTCGGACAATTTTGAAAATCCAGGATCACTGTCAAAGTCCGTTTGTATTGGGGGCAAAGGTGCCTGGCG
      CTTCTTCCGCATCGGAGAGGTAATAGAGCTAAGACTGGTAGTGGGACTCGATTCTTCGCTTCGCAGCGGACTCCCCACTG
      AGGCGCGAAGTGGCTTGCGAGGCCCATTTGCAGATGGCAAGGAGATGCTTGAGCCACGGTCATCTGCTCCGCGATCGAAC
      GTTCTTATGCTATTCAAATGCTCCGAAGACGAAGAGGAAATACTACTTTTCTGGCCTTGATGCGTCATTGGTTTTGCTGG
      AGTCTGGGTTTTTGATATAGATATTCTCGGTGTTGGCATCGGCATTTTTTTCCCATGCGAAAGTGTAGGGCTGGAATGTG
      GTTTCTCTGACGGATTGGAGATGGATGAAAGGCCAATTTTAGGTGGCGGTGGACGGGGCGGTACAACTTTTCCTTTGCTT
      TGTTGGGCTGGAATGGCTTTAAGAAGCTCCACTTCATCATCAGAGCTGTCGAATGGGTTGGCACCTTTAGATGAGTCATC
      ATCTTTAAAGGGATTTAGATCCTCTGGATAGTCAGTTTCAGATGCTTTTGTCTCAATTACCTTGTCCTTGGGAGACTCGA
      GATCCATTTGTTTTGGGAGAACACCTTCCTGCTTAGAGCAGCTTTCTGTGTTTGAGAAAATTTTATTTTCTTTACGCGGG
      CTTATATGGTCTTCTGGTTTAATGGCTACTTGAGTGTTATTTTCAGGAATCGGTGCTTCCTGTGATTCTGGAATGAGTGC
      GTCTGATGTATTGTTCAAAGCTTCTTGTTTATCTAAATTATCCGGATGTATTGCATCTACAACAAGGCGGTCATCTTCAA
      GATATATTGAGACCGAAGAAATCTTAAGTTTCTCTTTTGGAATGTCATTTTCCGGACTAACCGCCAGATCATTGTTTTGT
      TCAACGCCAGCATGTTGTTCATCGTCTAGTGGAAGAGTAGAGACTTTTGGTTTCTCTGGTATAGCGGGCTTTACAGGAGT
      TGTTGATTTATTATATTGTTCAATAAGGCCACCATCTTCTTCGTCTAGTGGAATAAAAGAGATTTTACGCTCCTCTGATA
      ATATAGGGTTTACCGGATTAATAGTTAGTTCATTATTTTGTTCATCTTTGTTGGACGGCGGTTGGAAGTTTTCAGGCTTA
      TCAGTAGTACGTATATCATTATCTTCCAGGTCTTCTTGTTTATCTTCAGCTTCAGAGTAATCAGAACTTTGTGCCACCAT
      TTGTTTATCATTCGGAGAATCAGTAGTGGTTGTCTTTAACTTTAAAATGTCAGATTCCGGTTCACTTTCTTCATCGGGAC
      AAGTCTCGCAACAGTATATGTTATTGACCTCCGTTTCATAAAAACTCCCGGGTGTGAGCAATGACGAACATCTTGCACAT
      TTTAAGCATGTGCGATGATAAGCCCGTTTGCCGACAAGGACCCTTTCGGCGAGAAAAACAGGAAGGTTGCATTTCTGGCA
      CTTATCACGTCGAGGCATCCCAACAATGTGCATCACCTTTTGCGGTGGCTCACTCTCTTCGCCAAGTGGCTCCTCTGGCT
      TCGGGTGCTTCAGGCTCTTGCCGAGCACCTTGTAAAACTGGGATAAATACGTTAGTATGGAGAGTCTATCAGGTACTTCA
      TACGAAACCATGTCAGCTGCATCGAGCAGTGCGGGAATTCCCAAATATTTCTCGGCCGTTGTAAAGGCCAAATCGTTGTT
      CTCATAGATATCGTCTGCTTTAAGTCGGTCGAAATCTATAAGATCCGGCCGAAAGTGGTGTATTATGGCGCAGAAGGCAA
      GTCCATTTCGCCAGGAAGTGGTCATGTTCTCCACCTTGACCCCATTATATCCTTGGGTCACAACTCGGCACCAATACTCC
      AAAGCCTTCGTACCAGTTCCAACTTTTGTGCCACGACGATCAGACATTTTAGTGGGTTAATTGCTGGCTTATTGGCGAAT
      ATAACTAAACGAAAATAGCAGTCACAAACTGTAAACTAAGTGAACAACAAAAGCACATCGTGCCACTTGACTTGAGTAAA
      ATCAAATAAGATTTATCTGGTACAAATTACATTAAATGTAAACAAGGCAAAACGGTGACTCAAATAAATCTCCCAATCAG
      ATTTAGTGGTGGGAGTGTCAGCAGCTATCGATAGTTGTTTCGTGCTATTTTCCCTTCTTAAAAACAAGATGTTTAGAAAA
      TTCTGAAATTTTTTAATTTTTCTCAGGAATGCCACACTTTTCAATTATTTTGTTGCTTGTCTTTATTGTCTTGCACTTTG
      CAACAGGGTGTAGTGTGAACAATCCGCTGCCAGAGTCAATCGATTTAAATCGCTAGTATCAATAGCAACTCCTTGGTTTG
      AACATACCTAATTTCGAGGAAGTAAACAAACAATTCTGTTTTATGTTTATTTTATATTATATTATATTTTAATATTAGTA
      AATTTGAAAAAATTAAAACACCAGTAAAGCCCAGAAGATTTCTGGGCTTCTGATTTAATTTCTTAAAAAACGATTATTTA
      GCTCAACAAAGATGAGAACAGAAAATTGCACAACATGTTTATTATAAATTAATGGAAATTAAATTAATATGTTTAAATTG
      CATATAAAAGGAGTAATTCCTGAAATTGGTATACAAGTTATTATGGAAGTCCACCCACCAGACTCATTTTCATCTTCATG
      TTTTATAGGAAATCAACTCGGCAATTACTTGGCGAAAAGTTTATTACCATTTTAAAAGTTATACACAACTATTAATTTTT
      GCATTGACTTCTCTCAGTGTATTCGAACAGAAAAAATTATTTCTCAATGTTATATCCGTGAAATAGCCTGGTCACACCGA
      CGATAAGCAGTCCCGCATCTAGCGAGAATAGTTACGCCGGCACGTGTAGTTGAGTAAAAAGTTCACTCATTAACTTTTAT
      CAACCGCTCCAGTTTGCATTTAAGAATTAAAATGGTAAGTTAAAAGTGCATTGCCCCATATGAGGTTTAGAAGACAGTTT
      GAAATCGAAGGATGATATCGGTTTTTCGAGAAGGTTCCACGGCTTTCGGTCCACATCCCATTCGCCGGGCTGTTGTGTAA
      TCAATGAGAGAAACATGAAACATTGAAACATGGGTTAATTGTTGGGTCTTTTTTAATGATCCTCAGGCCGCCGCTATCAA
      GAAGATCATCCCCATGCTGGACCGCATCCTAATCCAGCGTGCCGAGGCGCTGACCAAGACGAAAGGAGGCATTGTTTTGC
      CGGAGAAAGCGGTGGGCAAAGTACTTGAGGGCACCGTTCTGGCCGTAGGCCCTGGCACCCGTAATGCCGTGAGTATTTCG
      CCATTATCAATGCAGAGATGGTCATCTAATCACTGAACATCCCACTTCATCCGCAGTCCACTGGCAACCACATTCCCATT
      GGCGTGAAGGAGGGCGATCGTGTTCTGCTGCCCGAATTCGGTGGCACCAAGGTGAACCTAGAGGGTGACCAGAAGGAGCT
      GTTCCTCTTCCGCGAGTCCGACATCCTGGCCAAATTGGAGTAGATCTCGCCTCCGGACACTGTCTCACAATTCTATGAAT
      TCTATGCTTTTTATTAGTATGTAACACACCCACAAACCCGAAACTAAAAACTACAATAAAAGCTCATGCAATATTTTTGT
      TTGCATTGCGCATGGACCGTCATTGAATAAATTTCGAGTTACTTGTTAAAACTAGCAGCACAGGTGTTTTGTCATTAATC
      ACATTTGTCATTTTACTCGAAAAAATATTGGATTCATTCGCGGAAAAGGTAGTTGCAGTAAATAAATTAATGATTTAGTA
      TCAAATTTCATTCAGCAAGCAGAAGTTACGAATTATGTAACTAAATGTAAATACGAATTCGGAGTTAAAAACTAATCTAA
      AGAACAAATCCCAAACGATTTTACTCCCTTCAAAGTGAAAATTAAAGATTACACGTTTAAAACATACAAATATCTATATT
      TGAACTCCTACTTAAGGCTATGTTAATCCAACTTCAGGTTGCTCAGTCCATAGACCTGGTTAAATGCCGATCTCCGTTTG
      ATGTCTGGCATTCCCTCCACAGCTGCCCGCTCTCGAGAGATCTTTACTAGAGCTTCAAAAGATCGCGGCTCCCAAATGGC
      GAGGTCGGATAGGACTTTTCTGAAAGATGTTATAGGTTGTTAAAGGATATGGGAATTTTCCGGTGGTACCCACTTGTTGA
      GCAGAATATCGGAGCGCGCGAGGCCCTCTTTGAAGGTTTCCAGACCTACTCCATACTGCTGACAACCCGCCTCCACGCGT
      GTGCTCCACAGTTGCGCCATGTCCAGTTTCTTTAGCTTTCGCCCCTTGGTGGCATAGGCCAGTGCCCTATGGACACTCCG
      GATGGCGAAGGAGTAGACATTGCGAGTGCGGCTTCTATAATGCTGCAGAAATTAAGCACTAAGAGCTCATTATTTTTATT
      GTGGCCACGATATTCGGAAACATACCGCTGCCAGCTTGAAGATGCGTCTCTTCCGCCAGAATTCGTCCGGACCACGGGAC
      CGTACCAGCAAGGGAAGGTTCAGGAAGACCATGGCTTGATATTAACAGAATATCGGTCGAGTTTTTATATATTTTTAATT
      GATCTCAACGACTCTACTTGTTATTTTACATAACCTGCACGGCGCTAAAATGAGCATGTTATCGATAAAATATCGATGCA
      AGGCGTGCAGTTAAGAAATTTATTTAAAAAGGTATAGGTGAATACCTACAAATGTAATTCATTTAAGTTACTATTAAATT
      TTTTCTGACTATATAAAATTAAATTAAATCCTCAGAACTCGATATGTCGATATGTAACAGTGCATAACTATCGCTTATTG
      TTACAGGGGGTATAGGCTAAAGAGAATTGCCCGCATAATTTATTTTTAAAACCATTTTCTGCTAAACGTGGTGTTAAATA
      TTTATTTATTTAATTTAATTTATGATTTATGATTTATTTTATTAAAAGCTGTAAGAATTATATTACTGATTTCTATGATA
      ATCACGAGCCTATACTTTAGCGGTTATTCACTGTGCTGCCTATCGTTATCGAAAGCTTTGCCGGTTTATTTACATTTTGG
      CGCATTAAACCAAGCAAATGTTTTAAAAAACCTCAATTTCCGTGTTTTTGCGCACAGCAGCAGCACAAAAAGAATCCCGA
      TTCCCCAGTTATGTGTGCAAAGAGCCGAGTGGCTTCTCCTGGGGCCGGTGGCACCAGCCTGTGTTCCGAAGGCCGCATCA
      GTTTATATTGCTTTCTGATTACTGCAGCTCTAGTCCTGATTCCCTCGGTGCCCCAGAATCTTTATGGAGTGGTGCCACAG
      GTGTGGGGCGCCGTCCTCTGGGGTCCATTTTTGTACTACGCCCTTATTAACATGATCATACGGTTTGTGCTGCGGAACCA
      CGACTACCAGGTGAGTCAATCGATGAGACGCGATAAACCTTATCAGTGCTATGGCGCTAACTATTCTTGCACCACAGGTG
      GCCATTAGGGCATCCTTCCTGGGCTTTGCCATGGCCGTGAGTGTGCTGGTCATCTGCTTTGCTCCCACCGAGTGGCAGCA
      ATTTGGCGCCTACGGATGCTTCATGTCCCTTTTCCACTACTCGGAGTTCCTCGTTATCGCCTTTGCCAATCCGCGCACTC
      TCAGTCTCGACTCCTTTATGCTGAACCACTCTGTGCACTATGGACTGGCGGCGGCAGCCAGTTGGATCGAGTTCTCACTA
      GAGGTGTACTACCTGCCGCAGTTCAAGAGATACGGATACATTTGGGTGGCGGGCGTGGTCCTGTGCCTGCTGGGCGAGAT
      GGTTCGCAAGGCAGCCATCATCACAGCTGGCCGGAGCTTCACTCACTTGGTTAGTCGTGATGATTTGTTAATACATGGAC
      ATATAAATATTATTGCACTTAAGGAATTATCACACTATTATTAATTAAAACTAACTAAATAGCTTGTAAACTTCTCATCA
      CACATCTATTCCTACAGGTCCAGAATGAGAAACACTCGGAACACAAGCTAATAACAAGCGGGATCTACGCCTACTGCCGC
      CACCCGTCTTATGTCGGCTGGTTCTGGTGGTCCATCGGAACCCAGATCGTGCTATTGAATCCCATCTGCATATGCATTTA
      CACACTGGTCAGCTGGCTGTTCTTCCACGATCGCATCTACGTCGAGGAGTACTCCCTGCTCAACTTCTTCCAGTCGGACT
      ATGTGCGCTATCAAAAGCGGGTGCCAACGGGCCTGCCCTTCATCCGGGGCTATCTGGTCGATTAGTGCCTCTGATCTGGG
      GTTCAATGTCACAAGTCGCCATGGCAAACAAAACAAAATTCTATTTTAGGTTTAGGTATACAAGGTATACAGCAGTTCTC
      TTTTGTATAGCAAAAAAAAAAGATTTACAAGCACATTGTTTTTTCCAAATAAGTTTTCTAATATTTAGCATGTTGTTTTG
      TATTCATAAACTAGTCAAAGCATGTTGCTGAACTGATAATCTAATCTTCTTTTTTGGGTTAATTGTGAATTTATGGGCCG
      CATTAGCAAGCAAATGAAACAGCTGCGTGTTTCACAAGTTTTATTTAATGTTTAACTCGTCTATCTATCGTTGTTGATAA
      TCTTATCTGCTGATGACTCCTCGTTGTAACTTTGGACATTGTAGTCGTATGCATTATTCTCCCGATTGGTATCTTATACC
      ATAAATGGATAAGAAACCCAATAAATAAAAGGATGAGGAAATAAACCTCCTTTCACCTCTTATCTGAAAATCAATACAAA
      GATTTCAAGTTGTACAAAATGTTGACTTTTGTGTCTCGCTCGCGTGTCACTTTTGTTTTATTATCAATTTAAATTCGAAT
      ATTGCTCTATCTATAAGACACAAGCCTCACTCTCTCTATTTGTTCATGTCATTTCACATGTGTATGCTTTTGTATGTGTC
      TGAGTGTGGGTTATATGTATGTACAAACAATTATCAGTGTTAACAAAATCTTTTAGTCACTCTCATTTACTTAATTAACA
      ATTGCAAATCTTGCTGCGCTTTGTCTGGCTCCTTCGATGTCCGATGTGTGTAAGGTTTCTGTAGCTTCCGCATCCGGTTT
      TACTCAACGAACTCCGGTTCGCCGGAGTATGTGCAACCTGGATTCTTGATAATGTGCCCGGCTGCATAGTTTCCGCACCT
      GATGCAGACATCCAGCGACTTGCCCTGCACAAACTGCGATAGGAAACCTCCAACGAATGCATCCCCAGCGCCATTGGTAT
      CGACAATTTCATGCACCGCCAATTTCGTGACCGGGAATTCCTGCACCGAATCCTGCTGTATAAGCAGTACAGGATCGCAG
      CCCTGCGTGAGAATGGCAATGCGCGGCCGCGTCGGGTTTTTCTTCTCCATCGCCACCAGTCGCTTGCCAATCTCGCGCAG
      GTCCCCGCTAGGCCACTGCTGGGCCTCGGCGAACGCCTGAGCCTCCGCCTCGTTGCCAAAGATGATGTCCACGTAAGGCA
      GGGCGGCCAGCAGCGGTGCCATGTAGAATTGCGATATGAATGGTGCGCTGAGGTTCATTAGGAACGGTCGCTGTTTGGCG
      TGGGCGGTGGCCGCCACCTGCATAATGCTTGGCGGGTTCACAGTGAGGAAGAAGCCCTGGGAAATGAAATAATAAGAAGT
      ATTATACATACGATATCTTTATGTTTTAAAGAACAAAGCAAGGGAAGTAAAATTAAGTAAAGATTTTTTAGGTAGGTAAG
      AACAAAATTAATGTGAAATTAAGGAACTAAACTCTGATTAATATCTCTGATTAATCTCTCTAACTCTTTAGAAATCGCTT
      AACTACTTACTTCCCTTTGTGCCATTAATTTATTACTTCCGGCATCGATTGTACAGAACTCACCGAAATGTAGTAGTACT
      GGGCGTTATCCACCAGAGCCTTGTTGCTGGGCTCCTCCAGGTGATCGATGGTGAAGTTATTGGCGGCCGCCAGATTAGCG
      CAGAGCGATCGGTGGGTGCCGGTGATCAGAACGGCACAGGTTCCCGTGGGCACGTCCTTCTTCACCTGGTAGTGAACATC
      CAGTCCGGCGGCTTGCGCCTTTTCCTTCAAGATATTGGCGTACCGATCCTCGCCGACGCAGCCGAAGAACACAGCCACCC
      TGGGCTGTCGAAGAATCCATTGGGCAATTCTCAGAGAATTTTGCACGGATCCGCCAGCCAGAAACTCAGCCTGGTAGCCT
      TCGACCAGCTCCCCGTAGATGGGCATGTGTCGGTCCTCGGCAAGGATCGCATCATCCTCGTTCATAGAGTACTTCTGCAG
      GAAGTTCAGTGGAACAACGGCGGAGATGTCCAGCAGCGGGTTGCCGCATCCGACCAGGATTCCTTCTCTGTGGAACAAAA
      AAAAAATATATTATTTGGATTATTAGTTTCGCTAAGTACATAGCAGTAGCCCCAAACCTGACGCGATCGCACATGTTGCT
      CGTCTGAGGGCCTCTAGCTAATGCGCCCAATTAACGATACCAGTCAACATTGCGTTCAACCAGAGCTTTTAAGCGCAATC
      AGCTGGCGCGATGAACCTCAGAGATAGCCCTACCTCCAGTGAAAGAAGACTGACAGTCGAAATATTGCGCATACGCCCGG
      TGTGTACTGCACATAAACTAATTCTCATAAAGGTTTTTATGATGCAAAAATAACAATACTAGGTATTATTCATGGTTCTT
      TAGAACTCATTGAATATTCTGCCATAATATTAATCTAGCAAACTATTTGTTGGACGAATAAGTATAGGTACATATATGAA
      ATTATGGCACCTAATCTAGGCATCATCACTTTTTGGGACGCCAGTGTGCTCTTGTTTACGATAATGTTTGTAGTTGTTGG
      CAAGAATTCGCCCTGCTTATCAGTTGCATATTTCGGATTCGAGCGATTCTGGCGGCGATGAACCTGGCCGGATATATATA
      CATATTAATTCATTCACACGCTCACCGGCACACCCCTACTACTTATTGTATTTTACGGATCAACATTCAGAGATCGTAGT
      TTCTGTGAGTTCCAGATAACGAAGGCAAACACGCGCACACAGACACACATATATACTATACACATAGCACACGATTTTCA
      CATGCCGCTGTAAATTTTCGGCAATTATGTGGTTGTGCGTGTGTGTTGCGACACGAGAATCGGGAGCACATGGTGCCTAT
      TTTTTTATAGTCTTCTTACACTTTTCTATTTGGTTAATAATACTAACCCACTACACTTGCAACTTACTGTAGCGTGCTCG
      TCATTCTCCTCGTGTGATTGTTGTTGTTGCTGCTGCTGCCTTCTTATGTAAACATAAACAAGGTATTGCACTTCAGGTGG
      CCGCCTGCGCTCTCAACTCGTATAAGTCGCTATCCGGCGTAGAATCGAATCGGGAGATATAGTCACGTATATTTATATTT
      ATAGGTGATTTACCACGGGCTGCTGTCGTCGGAAGCGCGAGTTGCGGGCGTTTGGGAATTCGGTATTGTTTATCTCAGTG
      TTACCAGGTGCCGCAGGTGACGCATCTGTGGCTAATGCGTGGTAACTCGCAAAACGGTAACTCTGTGCACTGCTAAAAGA
      GCGAAAGAACTTTTCATCGCAATTGTATTGAAATATATTTGTACGATAGCAATGATGTTACTCTTAAATATATAAATATT
      TTTAATTAGCATTCCACAGAAGGTTGTTAAGTTCAAGTTTATAACAAAGAGATTAAATGTACTTCATGTGCACTGCGCAA
      AAATTGCACGAATTAGAATAGATTTCTGTAGAATATAATTGCTTTCCAAATATAAATCTTTAAATTTAACACTTTTACAA
      AATCATGTAAAAACAAAGTAATAACTGGAACAAGTGGCAAGGACAGATTATAGATGTATAGATAGATTTCTGTAGCAACA
      TTCTTTCTCTTAAAGATATAATATAATATATACCAGAAAACTGGGAAACCCACTCAAGCTTATTGGGATAAAAAAAAATC
      ATTTAATTAGAAAAAGTTCATCAGAAAAGTTAAAATATTTAAGAAATCTAAGTTAAGATAATGTCATAGCAAGTAAGAAA
      TTGGCATAAATTTCCATTGCACACCACTATCGATCGCGTCACTATGCAGCTCTGCGAAACTATCGATATTTGTACCAATA
      GCTAAAAACTCACATCTCCAGCGCCATGCCGATTTTGTTCTCTTTCTTTCCGGTTGTCAAAAGGTACAGATGCTTGGATT
      TTATTTCTCCGAAATGAAGAGGTTTTCTTATCGAAAATGTAATAAATATGAACAATTAACTATCTTTTCCAGTGCAGTGC
      ATCCTTAACCGCAGAACAATGGCCGACGTTGATGTGTAAGTAATTGTTTCATGGGCGATAAACGCATTTTACGCCTTGCT
      CGGAAAAACCTCTTGTTGATGAAATTAATTGGTCCGTGTTTATGAATTTCCATTGATTATAAATTCTCCAATTACTGACC
      AAGCAAGGCTAAGTCGAGTTTTGTGTAATGCGGCATGGCATGTGGCGTTGATTGCTAATAGTATATGTTTTTCCGATCTA
      GTGATGTTCCCTCCGCTGCCCCTGTGCTCGATGGCGCCATGGACATTAACACTGCCCTCCAGGAGGTCTTGAAGAAGTCC
      CTGATCGCCGATGGACTCGTCCATGGCATCCACCAGGCCTGCAAGGCCCTGGACAAGTAAGTAGTCCCACAATCTGGCGG
      TCAACGTGGTTATTCACTTGGGCTCTTAGATGCAAAATGCGAAAGGGTAAAAGCTATAGTAATATATTTCAAAGTCGACC
      ATTCTATAGTTGAAAGCAATCTATATGATTGATAGAAATATATATTTCAGTTCAAATCATTTGAAATACATAGACCACGT
      TTTAAAAAGTGTGGGTCTTCATTCAACTTAACCTATTTTCAGGAAATGAATCTTATTTCCTCCTTGAATTTTTTAATCGT
      TTATTAATCGTAATGATATTTATAATAATCCACTAAGTGCATTAAAGATAAATCCCAAGTGTGTTTCCACATTAAATCAT
      CTTGATTTTGCTGTTCTGACTGTGATGAAATTAATTGGTCCGTGTTTATGAATTTATATTGATTAAAAACCTTCCAATTA
      CTGAGCAAATGACAGCGTATCGAGTTGCATTGTATGAAAAAAAACCATTCCTAATTACAATATATTGTTTTACCAACAGG
      CGTCAGGCTGTTCTGTGCATCCTAGCCGAGTCCTTCGACGAGCCCAACTACAAGAAGCTGGTTACCGCCCTGTGCAACGA
      GCACCAGATCCCCCTTATCCGCGTGGACTCGCACAAGAAGCTGGGCGAATGGTCCGGTCTGTGCAAGATCGACAAGGAGG
      GCAAGCCCCGCAAGGTGTGCGGCTGCTCCGTGGTCGTGATCAAGGATTTCGGTGAGGAGACACCCGCTTTGGACGTGGTT
      AAGGACCATCTCAGGCAGAACAGCTAAACAGCTGCGCACTGCCTGCTGAATGAGAGACTACGTGAAAGTTCTTTTTAAGC
      TATTCGCTAATTGAAAATAAAACGTATTGAACCTGAATCCAGATGAAAAAATAAAAGAAAGTCGACCTTTTTACATTTTT
      GGAATGTTCTATTATATTGAAAAAATTATTTTGTATACTAGACGCTGGGTCACAATTAAGTTTTAAGGCAGACGAGCTTG
      TGCTGTGGCCAATCCTTGAGCTGACAATCACTGAAAGAAAAAATATTATAGAAGAAGCGAACTCCGCAAAAGTTGCGTCC
      AACCCACCGGGAGCAGTAGTGCACCTTCTTGCAGCAGGCACACTTCTTTTTGGCCTTCGCCTGGCAAGTGGCGCAAGTAT
      GGTCCGTATCTCCATCGCCACCAGCGCCGGCATCCTTTGCTTCGCCCATCTTGAGATCATCCATATTCTGCTCCAGTTCA
      CAGAGCAAGTCCGTGCCGTAGGCTTTGCTGAGGCGAGTGGCCAAAGCGCAGATGTTTTCCTTGTTCTTGCTAAGGAAAAC
      CGAGTCCTGATCCTGGGCAATCTGATAGAAGCCGCCATTTTCCTCGACATCCTTGAGCAGTTCCTCCTGGATCTGCGGAA
      TGTCCTCCAGCAAGAGCGGCTGTGTCTTGGCCGTATTGCCGCTGAGCGTCAGGCGGCTGAGGAACACCTTTAGCTCTATA
      AGTGGCGGCAGCTGGTCCAGCAACGGCTCGTGCATGAGACCCAAAAGCTAAGGAAGTCAGCTTGGTAAGTCAGCGCATTA
      ATCATAGATATATGTAGGTGGCAACTAACCTTGTGTAACTGCTTGCAGCGTGCCTCGTTGAAAGCATAGTTCTCCATGAT
      CTGAGGATTAAGGAGCAGCTGACGCACACAAAACCAGGCCTGCGCCTCTGGCTTGACAATCTTGGTGACGTCGTCCACAT
      TGGTCCACTTCTCGTCGATGAACTTCTGAATGCCCTTGCTGGTCTTTCTCTGCCACGGACTAAAACGAGGAGAAATGTGT
      AAAATATAAAAAAAAACTCACTTATCCGTGCTGCTCACCGGAAGCTAAGCACATCTGCCATGAGCCACGGAATGTCATGG
      GTCACCAGCAAACGGCGTGCGGCGCTTAGATGAAACAATGTCACATTATCTGCTATGTAGTTCAGCACTGAGATGCAGCG
      CAGTCCAATCTTATAGATAAAGTCGCGCTTCTGGCGCTCCAGCTCCGTGAGCACTGCCTCATCCACGTCCAGCTTTGTCT
      CGTTCTCGTGGTAACCCATGCTAACCAAGCCAATGACCTGGGAAATGGCCTGGGCGCAATAGTCAATCAAATCCAGCACG
      GACTCCTGCAGCGTCTCACAGCCACTCGGATGGTAGAGGCACACATCCAGAAGCGCTACCAAAGCAGCCTCGTGATATAG
      CACCGTGTAGATAAGGAACGTGGCCTGCGGATTGGGATCAATCTCCAGCAGATGCGGCAGAACACGCGTCTTCCACAACG
      TTACGCAATAGGCTTCGTGGATCAGCACGCGTAGCTTGTCGCGCGAGATGAGGAACTCCTTCACCTCCTCCTCGCGATTC
      TGGGACAGCTCCAAGGCGGCCTGCTGGCTCAGCCCGAGGATCATCTCGTGCACCTCCAGCCACTTCGGGCTGCCCACCTC
      ACGCACCTCAAATGGACGAATGCTCTCCACAAAGAGATACATTTCCTCGGGGTGCACAAAGTTTACCATTTTGTTTTTAT
      ACTGATTTTAATATTTTTTCGGATATTTCAAAACACGTTTTATCCGGCTTGTTTTGCTAAGACTGACGACTAACGAAAGA
      CTGGGGACTGAGTTAAATTATTATTTTAGGTTGTCATGGCAGTCACAGGTTGCTAGGATTCTCTTAATAAATAAAACATA
      TCTAAGATATGTAGTTTTAACGTTAAATTTGAATGCCAATCTTCTGGTATACCAATTATCAGAGCAAACTGAACATGCTT
      AAAAGGTCTTTAAAAAAGTGAAAATTTGGCATATTTGTATGCCTTTTCTAAAATGGTGTTAAAAGAAAATAAGCTAGAAA
      ATAAAACTGAGAACTAATAGGTGTTATAGGATGATGTTAAACTATTAAAATGTAATGTAAATGTAAGTATCCTCCATATG
      TTACTTATACTATTGACATTATATCATAGTTAAGATAGTTTGGTGAAATAGAAAATGAATGAGCTGCAGAATTTGAAAGC
      TACCTATGCTAATATGGGCAGTCTAGCAGTCTAAAGTCTAGACGTAAAGAGTTAGTAACCTTTTTGGAAAACATGCCTGG
      TTTTTGGCAGCAGTCAGTCCGCAGGCATTTCGTTTTCATTTATTTTGGCAGCTACATATTACGGCAGGCCACTTGATTGT
      TGGCCACCGATAAAGGCGTTTGGAGCGTCGGCCGTGGACAATTGGAACTCGTTCAGTCACTTTCGCTGAAAAGTTGCGTT
      GACACTGCGCATGCGTAGCGTGTGATGCGAGGATGGAGATGTGCGGATGGGGCAGGTGGGGGGATCATGGGGGTCTCATG
      TTTCGTGGGGGACAAACAATATTTCTTTCGTTTTCTTTGTGGCAGTGCGTTTGTTTCAATTGTTAGTAGTAATTTAATTT
      TATTTATATACGTAGCGACGGTCGAACGCTTTTTCTGCACGACGCGACGACAATTGACTTCAAATGTCGTTTGGCCGATG
      GGGAAAAAGTTACGACCACTATGAAAGTTTCTGTGGCCTTTCGGCGTTTTCTTCATTTTTCGATAATAACCGAAACGAAT
      TGAAACGAATATAGCTTGATAACTTTCCCAAAAGAAAATGAAAAGCGCCTTTTAATTGCCAGACGAAGTGAAAGAAATGG
      AGCGATGGGCATTTACAGAATGCGCGATTGCGCAATGCCATTAATCGATAACCAATTAACCGATAAGTCGGTTTGCAATG
      CTTTCAGATTCGTATGAAGATGGAAACCCCTTCCCGCGAGTATTGTCATATCCATTTAATATTAAGTTTTTCACATTATT
      ATTAACAATTAGACTCTAAAAATCTGAAATATTAAGTGATTTAAAAATGTATAAGCTTTATAATTTGTTTTGACCCTCTT
      AGATCTTTCTGTCACAAATGTCCATGGACTCCCTGTAAAATAAAGATTAGGTTCTATAAGTCACAGAAGTTTGTTCAATT
      AAATCATTTAACAATAAAACAGTTCCTCCTCCTCTCTCATCTCAATATTTAAACAAGATTATGTATGAGTTGGCTTTGGT
      TGCAAACAAAATGGCAGATGGCATCCGATTTGATCACAATGAAGTGTATGTGGAGTGATCAGTGAACATCATGCCATCTT
      TATGATCTGATATTTTAACTTCAAACAGATACAGATTTGAAACAGATTTTGACGGAAAAAATTTATTGGAAACATGATAA
      GAGGCATTGGACTAATATTGTTTCCGATCCTTGTAGTTACGTCAATTATTTTCTGCTGTGTCTGCTGCATTTGCCTCATC
      TTCTGCGGGTGCTGCTCGGCACTAATGCGATCCCTTCATCTGGATCCACCTTTACCGCGGGCTCGTCCTCAGCCCCGACA
      AATAATGGCAGTTGGATCACCCATGACTCAGCAGGCAGTGATAGCCATAGAAGGAGAAGTTTAGAGCCTAGAGGATGTGA
      TCCCAAATGCTGTTCATGCCAAAATTCCATGTGTATAGTGCCTTGAAACCATTTTTCTTTTTAAAGTCAAACATTAAAGT
      CTAAGATGGCAGCCTCCTTAGTCTTCTTTTATATTAATACTACTTAGCTACATTAATAATTTAAATCATATATCCTAATA
      ATTTAAATCATAAGATCCACTTGATAATGAGATCGTAATATATCCTAACAAACCTTAAATCTGTTTAGAGTCTGATCTTA
      CTATATTCTCGAATTTTAAAAAGTATATGAGACATTGAATGGCTAGTTTGATTTATTGAGCTGTGGCATCAGAATGTTTT
      TAACAATAATCCTGACATTCCTGGTCGGAATTGTGCTGTTCGTGTGCCTGTGCTATACCCTGATGTTCCTGGCTTGTTTC
      TGCCTCGATTGTTTCTTGCGGAGCATACACATGCATCCAGATCGGCACCCACAGTGCCAGCGAACAACCCAATCCTCTGC
      AGCAATAGAAGCAACAGCGGCAGCAGCAGCAGCAGCAAAAGCAACATCTGCTGCAGCGGCAACAGCAGCAGCAGCAGCAA
      CAGCAACACTTTGCACGACAGCAACAGGTTACGAGTGCGATGTAGCCGAAGATCCCATTGGCAGCAGCGAGACACCAAGT
      GCTTAAGGAATGGTAAACGTTACCTGGTCCGTCAGTTCAGGTTGAGCGCTCGAGTTGGTCGGTTGTTGGACGCGCGTTAC
      CTCTACAAAGTGTTTCTGAAAATCCAGGCATCCAGTGAAATCAGCGTGTGATATTTTATTCGCTTCGTTTCGTGAAGTGT
      AGCAGAAGTGTAGTGAAAAGGCAATTCGAATCGGACAAGTCGCCGGCAGAAGACACGATATACGAGACGTTCGACAGAAC
      ATCTCAAGTGCCCCCCCTCAAGTACAGCCAATAAGCCAACAATCAACCAGCCATCCAACCATCCATACATCCATCCAACC
      AACCAACTAACCAACCAACAGGCAACACACGCAGCTACAAAATGGAATACCGGTGCTTAAGTAGAAGTTCTGTCAAAGTA
      AGTGACCCCAATAAGCACAAAAAATAAAGACACTAAAGCCGTAGCGCCCACAAGGAGTGGCAGCTGCAAGATCTCTTTAC
      ACGTCTTGGATTCTTTCTTTCATTCTTCTTATATTTTGCCTGAACTTGGCATTGTTCTCGTCGGCGACGTTGTGTTCCTT
      TTGGGAAACCAGTATGGCATAAAAAACGCATATAATATGGCTATATATGTAGTACACAGATGTACATACATGTGCATCCC
      GCAGCCCACAGGCAACACCTTCGGTGGTGGTCCACTAAGTGCCTGGCGTGGAGTAATGGAACATGGGCTGGGTTCTCCGT
      TTGCCGCCGGATGGCATTTGGAGATCAGCTCTTCGGTGCTCCGGCGTTTCGCCCACTTCGACCCATTTCGCTGGCCCGAT
      CGGCCGATGGCTTGGCATGAATTAGCACCTTTCTTGGACTTTCTTTTTGTCCGGTCTTGACGCATTTTTAATGAATTTAC
      CATGGCCAAATAACTTTTACTAGGCTGCGTGTCTACGGGTATTCGATTCGACTCACGTCTAGGCCCTGCCACTTGAATTG
      GCAAAAGTTAGAGAGCTCTCGCGGTTATGGTTACAAGTGATATATGGGCCCTGTCGGCAGGCAGGTCGTGGAATGCGGCA
      GGAGATCTGACCCAGCGATTGGGCATGGTGGTGGTTTGCGGAATGCAGCTGCATTCTTGTGGGAAAAATACTTTTCTTTT
      TTTTCTACTGCCACCGGTTGTGAGCCCTAAATTGTAGGGTATGAAGCCGTAGGGACCACAGAAAACCCTGTGAACTTGAC
      CGACTTTGGATTTATGAGAATGTTAATCAGGCAGATAGCGAGAAAGCCAAAGAACACGCCCACTCGATCGAATCGCTTAG
      TCAACGATTTCCCTTGAATGGAGTTTTGAATTTCGTTCGGTTGTTTTCTCTGCTTGCCCGGCAATTTTTACGATTTAACC
      CATAATCCACACAGAAACAAATATGTATGTGAACCTGCTAGTTATTAGAAATGAGTGATAAGTTGTTCATTTTTACTGAA
      TGAAAACGATTTTCCCGTTACTTGTTCATTTAACATATGATTATTATGATTCATTCTGCCAGTGAATGCTTAAAATGAAC
      ATCGATTGTCAGGTTTATTTTCGAATAAGACAAACGTATGGAGACTATGTTAAGGAACTGGAATTTGTGGCCAGTGTAGC
      GATGATTCAAAGCGTTGCCTAAATGCTCGAGTGCCGCGCACGCCGTGGGCAAAAGCGAAATAAAAATTTTATAAAAAGTA
      GGCTAAATATATTCATACTTTGATTTTTATGGGTTGCGTCCCCCTGAGTCTCTGATTCTGCCCTACAGGCAGAAGATTCC
      CATTCGAGCGTCTCATGTTCTGGCATTTTGGCTTTTAGACTAACATGGGGAATCTGAGATGCCTATATAACTATTTGCAA
      AACGGAGTTTTAAACTGTTAGCCAAAACGGCGTTCTGGTTCAAATATTTCCATCATTACAACAGCATTGTTCTGATTGTC
      CGGGGAGTTTTGTCATACAATTGTGTTAATTGCCGACTTTAATGTAGCGCCAAAAGCTAACAGTGATATTGTGTGGCCCG
      GAAGATAATGATGCGAATCATCCAGTGAAACTTCTGCCAAGATATGTACATAAGTATCTAGATCCGTGACATTAAAACCG
      AGAGCGTAATGAGTAAAAGTGTTGCCCATTGTCATTCAAATACATCGGTTCTAGTTTTGGTCAGCCCAGCTCCACTCTTA
      GCCCCGTTTCCACGGATTCCATGGATTCCTCTATTCCGATCCCACCATCTGGACAATGGACGCGGTTCAAAAATGAAAGC
      GCCGCTGTCGTCGACCAAGACTCAAGTGCGGGGGAGTGAAACGGAGCGGAGATGGCCAAAGGCGCAATAAGCCAGGTCCA
      TTGCACCTGTCCCGCTCTAACTTTGCGGTCTGGCCTGGCCTTTTCTGGTCTTGGTCTTGCTCTTGGATTTGGTTTTGGTC
      TGGGAAAACGTGATCTGCATAGCGGCTGCTTCTTCGGGGAAAAAACCCATTGAAAGTTTTGTCGCTTCGGGGTTATCACG
      GCATTGAGCTTTGTTGTCTGTCGCGGAACGAAAAAAAAAATAATGGAAAACACAACATAAAACAACGGTCTAATGCGCAA
      CGGTGCTGGGAAGTAGCAAAAAAAAAGACACAGAGTTGTAAAGAAAACTGTTCTTGAGGCTATGTAATTGATCGATAAAT
      GGTAAAATCGGTTATGCATAATCGATGATTGACGCAAGGTGCAAAAAGTGAACTCAATTTAAAACATACAAAAAAGGAAA
      CATAGAATATTTGATGGTTTTCATTTGGAGTTTCCCGTGTTTTTCAAGACTAGATCTTAACCAGTCTAAAAACATTCTTA
      TCATATGAGTACCACATAAATTCCTGAATTTCAAAAACGTCTTAATAATTTGTATGGATAACCAATCAAGCTTTGAGTCA
      ACACAAATTCGAAGAGTTTGTTTCACAGACCGAGTTTTTGAAAGGTTTGAAGCCTCGTACATACATCATTTAGCATCAAT
      TCTTACCAATTTTTCGACACGCCTCGCTGTTGACATACAGCATCTCCCAAACAATAACAATTGGCCTTTGCTTTTCATCG
      GCTTTTCCTGACCAACTGATCCACAATCGGCGAACAAAGGCCTTTGGGAAATTGTGTCAGTCAAGCGAAGTCAAAGCCAA
      CGGCCAAGCCACAATTCTCTCTTTCAATTCGTTTCAATCACAATGCATTATCACTGACATCCATTGAGAATGTGGAACTC
      CAAGGAGGGGAATGCCCGGGGCTATGGGCTACGCTTATCAATAAACCTGTTCCTGGTTTCAACCAGTAACAACATCGCGT
      GCAACGCCAGCTATCTAAGTCACAGTCAAAGTCACAGTAACAGCCAAAGTCGCAGTCACCGCCGGCTATTTGTTGGCTGT
      CAATAATCTGTCGACATAGCCATGCTTTCCCAAAACCAATTTTCACCCGTGCAGCTGAGCTGTTAGAATTTAATTTCATT
      TGTTATTAAACGCCAATGTTTGTTTATGCCAAGCGAGTGAGACAGAGAAAGAGATAGAGAGATGGCATGAGAGGGAGATG
      GCGATGTGGGTCGTTAACCTCGTTATAACGGCACCTGATCCACGAACGGAGCCGCTGCTCTTGACAGTTTTGCCCGTCGC
      TTTGTCTCTTTTTGCCGTTTGTTGCTGTTGTTGTTGTGTCTCTTTGCCATCGGTTCTTTATAGAGAAGGGGCTAAATCTT
      GCTGATCTCGTGTCACGATGTAAATTTGCGTTTACAGAGAACCGTCTATAAATCTACAAAGATATATCGCAATACTTTAT
      CAATATCTCAGTATCTAAACTATCTTAAATTGCAGGAATGGATTATAAAAGTTGGTTATATATGAATACTTAATAATAAT
      TAAACACTGAATTCTGTCTCAACAATATTTAAAGAGTAGAAAATAATATTGACAAATTTGTTTAATTATTTTAATTTTGA
      TGATTATTGTGATTTTGGAATATTGCTCCTAGTTGCCTGAGTAATTAAATTCAATTTACATACCTTATTTCGTGGTATGT
      GGTGTTATTTATCACGCTGTCATCTCTAAGTTCTTTCAAGCCTTGCTTGTCTCGTCTCTTTTCTCTTTTCCTCGCGGGCA
      AATACAAAGCAGAGCATAGAAAATCATTGTAGTGCACGGTGTTGTTATTGTTGTTTTTGTTATGTAAGCCTAATGACAAG
      GCAAACCGAAATTGTCAACGGATCGTCAATGGGTTTTTGATTAATGCGTGATTTTCCGATTTCCAAAGCCCAATTATATT
      CGAAATTATTTGCATTCGGTACAGTCATGCCACAATCACTACAATGAACACTCCACAGACCTCATTAGGAGCCGACGAGG
      GCCCAATCAAGATGGCAATTACCAGGTAGAAATGCGTCTAGTGACAGGTTCAAATGGCAATGGCTTCTCCGGCTCCCCAG
      TGCTTTAATGTCGAATTAAGAGGGGACAGCGAGCATTTATTAAACGAAATTGCTGAAGAGTCATAAAAACGGAAAGTCCG
      AGCAACGAAATGACAATGTCGGGAAAAGCGCGTTTAATGAGCCCCCCAGAAGAATTCGACAGAAGGCGCGGTGAGAGTGG
      AAGTGCTTGTGGCCATAGTTGCACCATCGAACCTGAAGACCTGGCTGGTCTGCACGTGTATAGGCCCCCTTTTCCGCTCA
      TTCAGAGACCCATTAAATTCGTGTAGTGAATGGGAAAAGAATTAAATAATAGAATTTCGCTTTCGTTTTTATTTTCCCAG
      CGGCGCAGCGCACACGCAATGACCATTATGGCCCCCTCGTTTTTCATTAGTATTTTTTTTTTTGTCAAATGTCTAACTGA
      AAAGAAAGTTGGCTAGCAAACCTACCAAATGTGCGAACCGAACAAAACAATAATAGCAGAAAGAAAATATTTATATCAAT
      TAAGAAATATTTGCGGTATTCCGCCATTGACAGTCGCACAAAGGCTCAAAGAAAAGCAACGATTATCGTACATACATACA
      TGCATACCTTACATACATACATACGTGCAGCGATTTTCTCAACAGAAAGTCAAATGCAAAAAATTGCAAAAAAATTAACA
      GAAAAAAGCAGAAGAAATGGCAAATTTTGTGCTGCAATTTTAATTCAATCGAAACGGGTTTTTCGGCACGAATCGGGCAC
      TTGATCAGCAGCCAAATCTGCACGGAGAAAGTGAAAGAAAATACATGCGAGAGCGGTTGGATAAAAACCGCGAGAAGAGG
      CAATAAAAAGTTCAGACCATATTAGAAGTCAGCTTTGCATGCCGTGCCACTGAAAAGTGTCCGTATGTCCGTATGTCTTA
      ATACAAACATTCCAACTCGATGGATGTGGGTTTTCGTCTCTGTTTTTACTTTCACGTGCGCCGTGCCCCCCCCCCCCGCA
      AGATGCTTATTTATGAGCTTAATTAATTTGTTTATGGATTTCGGGGCTAAGCGGGTCAAGCATGTGAAAATAGAAACTTT
      TCATCGTCCATACACCTCCCTCCATCAAAACCAAAATGGATAGCCCTTGTAACGCGTAATCGCCATCGTCTGCAGTGGCG
      TACTTTTAAAGCCTTTCCCAGAATTCCGTAGAGTCCCCAGCCAAAAGCCAAATAGTGCTAGACAACTACATACATATGTA
      TGTTATATACAAGCAAACATATATAGCTGGGCCATGGTCAGGGTCGTCGGTTCAACGACAGGCCATAAAACACGTTACAA
      CTCTTACGGAACTTCAGTTCAGTAAGACTAGTTGTATTTCCAGCATGAGACAGCACTTCCCTCCTTCCGCGGATTACCCG
      TTATCAAATACCATAAATGCAACATATCTAAAGTCGCTGATATTATTGTATCAGTACTTCAAGAAAAGTCCTCTGAACGA
      AGAAGGAGAAGTCTTCTTAAATGTTTAAAAACTTTGTTATTGCTAGGGATCTACAAAAGAACATTTCTCATTTTGTTTTA
      TTATAGTTTTGTTTTCGCAGACTATTTTAAATTTTTGGTACGTTTCGTTACTATCTAGATACTAGATACTCTAAAGTCTA
      GGATGCACTTACTGCTCAAGAGAGCCACAAATTGACCGTGTGAATAATCTGTTTTGGCCCGTTTCATAACCCATATCCGT
      ACCGCTTCGTATCTGTTGCAGCACCTAACGGCTCTCTGCGTCCTCAGCATCGCACTCACCTGCGCAAACGCGGCATTGTG
      GCCAAGTTACAGCAGCGATGATGCGCCCCCCAGCCGCTGCAGCGGTGGGCGTGGCCTGAAGTACCTATCGGGCGATGCGC
      TGACGGACTCGCTGGACTGCCTGGGTCCCAATAATGCGCCATATCCGAGGTGAGTCAGTCATCTGGCATGGTAGTAACTT
      TCTTTTCTAACGCCCCTGTGACCATCCAATTGGGATCTCTGCAGCGCGGCCGTGGCGCGCACATTCTCCAACTGGAACGG
      AAACTCGCGACGTGGCCGCCAGAGCAAATTGCCCAGCACACTGGACCCAGCCATAACCACCAGTGCTCTGCTGAGGGCCT
      ACGACGAGGTGAACAACGAGGCCGTCGGAAGCAGTCGCTATGGTAAGTCGGTCACCGCCACCTGATTGACCAAACCAATC
      GATCGAACCACCGCCTGATTGATTGATTGATTGATGGATTGATTGACTGACTACTTGATTGATTAATCAATCTCATCGCA
      TCGCAACTCAACAGGTCGTTCGCTGAAGAACGCCACGCCGGCGCAGCAGTGCAAGAGCGAGACGCCGGCGCGCCTCTGCA
      AGACGCGCTACAATACCACGGCGCCCATGTACGGAGTGAGCCTCACCTCCGGCCAGCCGGTGACCATCGTCCAGAAGTTC
      CCCGATCTCCTGCAGCAGGTGGTCTTCGAAGTGTGCGAGTGAGTAATATTTTGGCACCCGATTAATATAAATCTTATTGG
      TATACCAAACAAATTGAATTCAAATAAGAAATTTACCCTTAACTTACATTACTCCACAATCTCCACTAGTTCTTCTTTTT
      AAAGCTCACTACTATGGTCAATTTCAGATCCTCTGAGTGCGATGTGGTCCGCGGCGAGTGTACGCAAACCTATGTGCCCT
      ACCTGTTCCTGGTCATTCCGCTCGGCCCGGTGACGCTGACTGGCCAGGATTACGTGCTGGTGGAGAGCGGATGCGTGTGC
      AAGCCCAAGTACTCGACGGGCGCCGCCCAGGAGCCGAACATGATACCGTAGAAGGAGGAAACGAAGGAAGGCGAAGGCGG
      TAACCACCAGGAACACCAACAGCAACCAAAAGAACTGAGCGAGTTTTGGGTCGGAGCAGATCGGAGCCAAGCCGAGCTGG
      GCTGAACTGGCTGGCTGGCTGGCTGGCTTAATTAAAAGGAATTATTTTTTGTAGCGAAATCAATTTTGCAATGTTATTTA
      ATGTTTTCCCCCCATCTCTCATTCTCCTTTAAATCCCACTCAGCTTTATAAAATTGAATTGAAATTTTGCTCGAAAAATA
      ATCGAATCCTAATGTTAAGTCTAAATTTAAACAAAATTGATTAAATGCCTCTGTGCGTTTGTAGTGTGTATTTATTAGAA
      CCCCTAATTACGGCATTCGAAAATGCTAAATAAAAACATTCGTTTCGAAATGTGACTGCAGTCGTTTAATTCCAAAGGGA
      TGGAATATAAAATTGTTCAAAAGGATGGAAATATAATAATGAAACTATAAATAGAATGTAATTGCTATGGCTACGCACAT
      ACCGACATGTGCCTTAAATGATCTAGAAAATGTAGCTCTTTTATAGTAAAAATAGAAACCAATCTAAACAGATCATTTTA
      AAATTCGTTTTAAGTTTGAAAAGATTTAAAATGTAACGGTCGCATTTGAATTAAAAAAGACAGTTAACACCCTGTGCGCA
      GCGCTGCCAGATGCTCGCCGATAACATTTGCCGATAGTCCTGCGCTGGTCCGATTACTCGTGTTTTGGGCCGCTGCTGCC
      ATCACTGGCGCAGACCGTTTTCACGAATATAATTTTTTATTTTGCGATAGTAAAGTGCTGAAAAATAGCCAGAAAACTGC
      CATTAAAGCTGTTCGCAACGACGACAGAACGCATTAGAGTGATAAACGCGCGAGCAGGGTGTTAAGATAGCGATTGTTTC
      GGGCCAAAGGCATCGCATCTCCCCGGCCATCACACATACGGCGAAAAGACGCTGCGCGAGTGTGTGTGTGCTCCTGTAGA
      CGACAATCGACTTGCGTGGTGCCGGGTTACATATTTTTATTGGATTTTTGACTCGCCCTCGCTGCGCTAGAAAACAAATG
      TGCCTGGCCTAAAGTTGGGCCACAAATTGGCGGCAGTGCACCGAAATTCCCGCAGGACTCTAATCACAAATACGCAGCCA
      AGATGATGTTCACGGTAAGCCAAAAGCGTCGACACCCCCCCGCAAACTAATCGATAAATGGTTTTTCAATACATTGCCCA
      TTCGTTTGTGATAATTTATTCCCCCTTTTTTTTAAATGGAATATCCTGCAAATATGTTTATTTTTCACCCCGCCCCCCCG
      CAAAATCAAATAGGGCACCAATCAGCAGCAGGACACGCGGTTCAGCGACAAGGAGAAGAAGCTGATGAAGCAAATGAAGT
      TCGGCGATTGCCTGAACAAGAGGGTGGATATGTCGAAAGTCAAGCTGGACGTACTGCGTCCGTGGATCAGCAAGAAGATC
      ACCGACATCCTGCACATCGAGGACGACGTGGTCGTCGAGTTTGTCTACAATCAGCTGGAGGAGGAGAAGTATCCGTGCCC
      CAAGAAAATGCAGATCAATATGACGGGCTTCTTGAACGGCCGAAATGCCCGCCAGTTTATGGGTGAACTTTGGGCCCTGC
      TGCTTTCGGCACAGGAAAGCGATTCGGGTATACCAGCGGAGTTTATACAGCAGAAAAAGGACGAGATACTCAAACGGGAG
      GAGGAACAGCGGCAGCGGGATCGATCGAGATCCCGTTCGCGTTCCCGCTCCCAACGAGACAGTTCTAGGCGAGATCGGCA
      GCGTGACCGCTCCAAATCCAAGTCCCGCTCCAGATCCCGCTCAATGAAGCCGGCCAACAACAACGGTTCGGTGCCCAGTG
      CCGCACGAGAAGCGGCCGCCAATGCGGCTGCCAAAATCCGTAAACGCGGCTCCTCCTCCGCCGCGCGTCCCGGCTCCAGG
      GAGCGGAGATCCAGCCGACGACCACGTTCTCGTTCACGTTCACGCTCGCGAACCGCCGGCAAAAAGACAGGCTCGGTGGA
      GCCCGCACCCGCCAAGACTGTCAACGGCCGCCACTCGACGGACAAGTCCTCGCCGGTACCGCCGGCCTCCAAGAACAAGT
      CGCGCTCCCGTTCGCATTCCCGGTCGCGATCGCCGCGCAGTCGATCTCGATCGCCCAGCGCCAAGCGGTCACGTTCCCGC
      AGTTCCTCGCGACGCAGTCGCCGACGAGGACGCTCCAGCAGCATATCTTTGTCGCCGGAGCGCAACCAGGATCAGTTTGA
      GCACCGACGCAACAAGAACAGTGTGCAAAACAAGCGGCAATATCGCAACAATCGCGGGGACTCGGCTAGTTCAATGGAGC
      GCGGTAACGATCGAGGCAGGCAGTTTGGCGGTGGCGGAGGTGGTCGTCGAGGTGGCAGACGCTTCTCCCCGCGAGGACGC
      AGTCCGATGCGACAGGATAATGGCGGTGGCAACGGCGGCAATCGCTTTCAGCGATCCAATTCGCGTCGCAGGTCGAGATC
      CAGGCGGCTATCACGCTCGCCTATGCGTTATTCTCGCTCTCCAAGACGGTAAGTTGATTCTATTGCCTAACTAACAATGG
      CTTAACTAATTCAATCATGTTAATTTCGTTCCGTGCAGCTTCAACAACCGTCGCCGTTCGCCGATGATGAACTTTAGAGG
      TGGAGGACGTGGTGGCGGGCGTGGCGGCGGACATCGGCAGATGTGGCAGCATCGCGGCGGATCGCCCAACTTCCGCGGTG
      GCGGGCGCATCCACTGGCAGGCCAGACACAGTCCTGGCGGCGGAGGACGCGGAGGGGGAGGCGGAATGGGTCGCTTCGAC
      AGGCGCCAGTCGCCGCAACAGAATCGCTATAATCGCGACCACCGCCAGTCGCCAATGCAGCAGAATCAGCCGTTCCGCAA
      GCAATTCTCCCCGCATCAGGGACCGGGACGTCGCTTCTCGTCGCCGCAGCAACGACGAAATTCAAGAGATCGTCGCCCCA
      ACTCAAGGGAAAGGCGCAGCTCACCGGGCGGTGGTGGCGGTCACATGAATCGGTGGGACAACCCGCCGCCTGCACGAAAC
      CGGCGCTCATCATCGGGAAGCTCGGCAGGTGGACGGCAACAGCGACAGCGCAGTGCCAGTCCGCCGGAGAAACGGCGTAG
      TAGCCATAGTCGCAGTCGCAGCCTGAGTCGCAATCGAAGCCGCAGTCGCTCCAGTTCGCAACACAGTCGCAAGCGCGAGA
      GTCCAATTGGTAAGTGTCAAGCAAATGATCAACTTAACAGTGGGTAATTAATTGTGGACTCCTTTTGGTTACAGGGCGCT
      CGTCGGTGGAGTATGCTGGCCCGGCGGTGAACACCATCGATCTCTGTCGCGAGGAGCAGCAGCGCAAAAACAAGCCAGAA
      ACGATCATAGTGCTGGACGAGGGTCCAGCCGTGCGCAGCAGCTATGCCAGTCTGTCCCGCACGCCCTCACCGTTCCTTAA
      GCCCCACGAGCGTCTAGCCGCAGCCAAGGCAGCTGCTGCTGCGTCGGCGGCGGTACCAAAGAAATCCCGCGATCAGAGCC
      AGAGCAGCAGTTCGGATAGCAGTGCCGAGAGCGATGATAGCGAGGAGCAGCCGCGTCGCAAGAAGCAGCCAACCAACATG
      GAGACTTCCAAGGGCAAGAAGGAGAAGGTACGGCGCAGCTCGGAGAGCTCAACCAGCAGCGAACAGAGTGACGACGAGGA
      CAACTCCAGTGGGGATGAGAGGCTCAAGAAGAAGCTGCAGCAAAGGAAGAGCAAGGAGGCGGCGGCTTTAAAGGGAAAAG
      AGAAGGAGCATGAGAAGGAGAAGGACAAGCGGCGCTCGGACAAGAAGTCCAAGCGGGGCGCAATCTCCAGCGGCGATGAG
      GAGTCGACGAGCAGTCGCAAGCGCGGTCACAAGAAGACGCGTCGGGACGAGGCTGGCGACAACAGCGATTCCGAGGACGA
      GCATGTGCCCAAGAAAAAGCGCAAGAAGGCGAAGAAGCCGGCGGATTCCAGTGACAGCGACTCAGAGGCCTCCTCCAAGC
      GCAAGAAGCATAAGAAACACAAGAAGCACAGCAAGAAGAGCAAGAAGCATAAGAAGCACAAGCGGAAGTGCAGTGCCGGC
      AAGTCGCGGGCGGACAGCAGTTCCCAGGGCAGCAGCGACGAGGATGAGCAGTTGCCGCACTCGGTTGCGGCCAAGCGGAA
      TGGAAACGCTGGCAAGCTGGCGCTACTGTTGCCGGGCGCCTCCGGAGCCGGTGTCATCAACGAGGACCTCGAGAAGCAGC
      TGCGGGAACGGGCCCTCAAATCGATGAAGAAGCTGGACTGAACGACATGAGAGACTTTGTGCGTGAATGGTTGCCCACTA
      TACTCCCATCCTGACCCTCAAATCATCCACTCATCTTGAAACGAGAATGCGAATGCGTATCGTGAATCGCTCGCCCTCAC
      AGACAGACGTACGTAGCCAGTAACATAGAAGTATACATTTAAACCAACTAAACATTCATTAATTGCATACATTGTATTTC
      TTAAAGTTAAGTTCTTTCGCCTAACAAAAACAGTAGCGATTAAATTAGCGAGCCAACATTAAGCGAATGAATGCAGTTTG
      TATTATGTACAAAACAAATGAGAAACTGAATTAACCAACATAGCTATTTAGCCCCCAGTGGTTTTAAATTAAATGCATAG
      ATTCCCGTATACAAGCATAACAAAATCACATTTAAAACATAAAACAAGCAAACATAAACAAGCGCGTAAATCCGATTGGC
      AAATTGTATTGTTGCCGCAGTTTAATTTATAAGTAGGTTTTACAGAATGTAATTAATAATGCCTAAAGAGCAAATTGTGC
      GTTTGAAGGGCATTAACTAAATGAGAAAATAAACAAATGTAAAATTACCAAACCCCCAACTGATGTTTCGTTTAAATTTC
      GATTGCTTGTGTCTTTTTCAAATACGATTAATTGCGCACAATGCAGCCCTGGCAATTATGGTATTTCTTTCAGGATGTAT
      CCAATGTTTAGACTTTAGTAAGGGTATTTTTTTTCGACGTAATTAAATGTGCTATTTTAATGAGGGTTGTCCATAATGTA
      TTAAATATAACTTTGTTATTACTAATAAGGTTAATACTTATTGTTAAAAAAATTTTGCAAAATATAATTATATTTGATTC
      GGAACGATTAATTCAAATGCTGCATAACTCGAAATCGATTGAGACAATCCAAGGGAAACCAAACGTTCATGGTTCCAAAA
      CTATATTATGGTCTATTGTGTAGTCCCACCTTTGAAAATAAACGAGCAGCTTGTTATATACACACTGGCGTTCAAGTGTT
      CTTTTAGCAGACCAGTTTTAATTACTAACCCTATATTTGAGAGACTTCTGTGTAAAAATAACTTTACATTTGACTTTATT
      TGACATGACTATATAACAGTGATAAGACCTAATTGCGTGTATATAAATTCATATGAAAGTAAAATATTGTATATTTAAGG
      GTAGCCGATTCTCTCTATTAGAGCAATCATCGGTTTATAACAATATACTTTATTTATATTCTCATTTAAGCATTAAATCG
      CGTCACAGCTGACAAAAGCTAATTGATACAGGGGCTGAGGAATACCCCCGATAATAAGGCATCCTCGCAAAAGTAACCCT
      GCGCGGTAACCGCAATCCAGTATTTAGTTATTCGACGCCAACTGCCCGCTGGCCACACCGCCCGCAAATCTGCCTTTTCC
      TTTTCCTGTTGTATTGCCCGACGGACGGTATGTGTATTTTTTGCAGCTAGCCACGTGCTAAGTTTTGTCAATGGAAGGCC
      CGGCATTGGGGATTTGCTGGCCACGGATGCGGCACTGGCAGTGGCGAGCGAATGCTGGCACAAAACTAACGTTTGATTGT
      TCTATTTGCAGTGATCGCCCGTTCAATATAGTGAATCAAACATGGTGAGTATCTGTTGGTGGTGGAGATATGGTCACGAT
      TGTTTGTCTTTGCCTTTGGAATACCTGACTAACGGCTAAAACCCACTTACACTTTGCAGGCTCGTGGCCCCAAGAAGCAT
      TTGAAGCGTTTAGCCGCCCCCAAGGCATGGATGTTGGACAAGCTGGGAGGCGTCTTCGCCCCGCGTCCCTCGACCGGTCC
      ACACAAGCTCCGTGAGTCGCTGCCCCTGCTGATCTTCTTGAGAAACCGCTTGAAGTACGCCCTCAATGGCGCCGAGGTCA
      CCAAGATCGTCATGCAGCGCCTGGTTAAGGTCGATGGAAAGGTCCGCACCGACCCCACCTATCCCGCTGGCTACATGGGT
      GAGTTGTGTGCTCGGCAAGAGTGTGCTTCAAATGTGCTCCATACTAATGGGCTCCATTGCCCGTTTTTTAGATGTCATCA
      CCCTCGAGAAGACCGGTGAGTTCTTCCGTCTGGTCTACGACGTGAAGGGACGCTTCGTCATCCACCGCATCTCCGCCGAG
      GAGGCCAAGGTGAGTTATCTAGTCTGTGCTTCCAGAGGTTCCCGCTTTCCAACCATGGAGTTAAAATCTAAAATTATTAA
      CTGAGGTTTCATCCTCAACTAGGAATTCTTTTCATGCAAGAGCACTTGAATTAGATTCATCTAACTTCATCTTTAAAACA
      TAAATAGTTCACCTATTTTGGAATACAAAATCAATCTTTATGCTAATTACCGAAAGTAATTAACTTAAATATCGAAAGGG
      CTTTGTCGAAGACCGTTTTGCGTGTAGAATAGTGCGCCGATTGGTTCAAAACGAAGCCCAAAGCAATTTTTGATACGACG
      GTCTCTGATTCGACAAATCCCAGTTGATTCAGTAACTTTTACGTGCAATTACAAAAGAAACCAAGGAGTATAAAGCATTA
      TATTGTAATTCTGTGGGCTACGTCGAAGACCGATTTCCGCTTGTTGCCATGTGTCTATTGGTTCAAATCGAAGCCCAAAG
      CAATTTTTGATACGACGGTCTCTGATTCGGCATTCCACAGTCGTCTGAGTAACTTTTACGTGCAATTACAATGCAATTAA
      ATGAAAGTGGTAGTGCAATTGTGTAGAAATAAAACGTCTTAAAATTAACCCACATTTTCTTTGCTTCTTTTGCAGTACAA
      GTTGTGCAAGGTCAAGAAGACCCAGCTGGGAGCCAAGGGAGTTCCTTTCCTGGTTACACACGACGGTCGCACCATCCGCT
      ACCCGGATCCCCTGATCCACGCCAACGATTCCGTGCAGGTGGACATTGCCTCTGGCAAGATCACCGACTACATTAAGTTC
      GATTCTGGTAAGCATCCGCTATCGTAGATCATCGTGTTCATTGGCTGGTTCGAAGACCACAAAACGCTCCTCGAAAGTTG
      CGTGGTTCAAAAACAATAAGCCAAAAGCAATTTTTGTCACGACGGTCTCTGATGCGGCATTCCAAAGTCGCTTCAGTAAC
      TTTTACGTGCAATGACAGTCGCCCAATATTATTAACCAAGTCGTATGATTCCAACTAACTGGTATATTTCTCCGTCTCCA
      CAGGCAACCTCTGCATGATCACCGGAGGCAGGAATTTGGGACGTGTCGGCACCGTTGTCAACCGTGAGCGTCATCCCGGT
      TCCTTCGACATTGTGCACATTAAGGACTCGCAAGGTCATGTGTTCGCCACCCGTTTGACCAACGTGTTCATCATTGGCAA
      GGGCAACAAGCCCTACATCTCCCTGCCTAAGGGCAAGGGTGTCAAGCTGAGCATTGCGGAGGAGCGCGACAAGCGTCTGG
      CCGCCAAGACCCACTAAGGCGCAGGAGTTTAAGGACTTTTACCTTTTAGCATAACACTCTGTACGTTTAGCTACGGAATT
      ACAAGCCGAGAACGTAACACATGTGTTTTCTTTTGCAATGGAAGTGGTTGATCTATTTGTTGGCCAAGAGTTTAAAGAAT
      CAGATGTTTGCTTTGAAATGTGTAAAAAAAAAAACATGGGACATGTGTGACGTGACTTAAAGCTATTCAAACGTGACTTT
      ATAGGAACTTTAAAATCAATTCACAATGCCTTAGAACTGGACGTAAAGTAAAACTACCCTCAAAATTGACATTTCAGAGC
      TTGAAAGACTAGTTTTATCTATGACACGAATTCAAAAGTTGCGTTTGTTAAGTAAATATTTCAAAAGCAGATTTTAATGA
      GGACTTAAATTTCAATTTATGATGATGATTGTGTTATTCTTGTTTACGTCTTCATCTCACTTATTTCATTCATATCATAA
      AAAAAGGGCAATAGATTATTGAAAAAAGGAATTCATTTATTTTACGGGGGGGGGGGGGGTGAGTTTTAACCCCTCTGTGG
      TGCGTGGGGGCTGGAGTTGGCGCCCAAATAATCGATAACCCGCCCCCAGCATCGATAGAACGGCCGCTGCGAAAGCTCCG
      GTCACACTGCTCAGTGGGCTGCTGCTTCTGCTGCAGAGAATTATCATTGTATTTCGTGTGGTGAAAGGCTTTGTGCGCGA
      ACATTGTGCGTCCCCGGATCAGAACTCGCTTCGAAGTAAGTACCCGACCATCCCGGTGGCGCATTCCGCCGCTGGGCGGA
      AGCCCTAGCAGAGCCCCCGCCCCCAAAAGCAAATCATATGCGAAGAAGAAAACACGAAAATGCTGGCCACCCATACAACG
      ATGCGCTGCACACACCGATGCACACCGACACATACGCACACGGGCGAACATCATATGTTGATAAGTTGGCGACAACAACA
      ACAACAGCAGCAGCAAGAACAACAAGAACAACAATGCATGTGAATCATTTGTAGGGATTTGTCTGTTTGCTCGCGAGTGG
      TATTAAATGTCGGCCTATTTAGCAAGACCCCTGCTTTGAACTCACAGCGATACATATGCACTTACAGATATGTCCAAGGC
      CTTGAACAATCCCGGTGGCAACGGAGGAGGCGGTGGCCCCCATCGGGACTATGGTGCGATGGCCGATTCAACGCCCGAAG
      TGAGCTTTGCGGCAGCCGGCGGTTCGTCCGGCTTCAGTCCGACGGAATTCATGTCTCTTAGTGAGGACATTGGCCACAAC
      ATCACTGCCATCCACAGCAGCACCAAGCAGTTGGAGAAGCAGCTGAAACTGATTGGCACATCCAAGGAGCAGCCAAATCT
      GCGGGAGAAGGTGCACACCATCAACACCAAGTGCAATGCCCGGGTGCAGACCACCAGTCAGGACTTGCAGAGGCTACAGG
      CCGTTGTGCGGCACGGAGATCGCCAGCAGAAGCTGCAGCTGGAGAAGCTCACCCGGGAGTTCCATGGCGTGGTGGAGAAG
      TACTCCAATCTGCAGCGACGCATCTCATCGGCCATGCGGCAGACCCTGCAGCAGGCGCAGCAATTTGCCGATCAGGTGGT
      GGAGACCAACGCCCGTGCTGAGCTGCTGCAGCAACAGCGCTTGGAGCAGGCCCATCTCCAGCAGGAGCACGACATGCTCG
      ACGATCGGCGGCGGCAGGTCGAGCAAATAGAGTCGGACATCATCGATGTCAACCAGATCATGACCCAGCTGAGTGGACTG
      GTGCACGATCAGGGGCAGCAGATGGGTGAGTAATCTCCATCCAAGTGGGGCTCAACGACCGCAAATCGAGAAACCACAAG
      CCGTAATTAGGGCTCTCACTTTACGACCCAAATGCACGCAGTTCCACATATTTAATAGCGTCCAAATGGAGAAATCCATT
      GGTAAAACAAAATATTCAGAGCTTATCAGTTGCTTAAAGGTTGCATAGCAAATCTCTCAAATGAGTTGATAAGTAAACAT
      GTGCAAGAAATTATGAATCATTGACTTTGCTTCAATAACAATGCACATTTCGAAATTGATTGGAATTATCAACAACGACT
      TAGACGTTTTAATTTTCCATATCTTTTATGAAAACCCGTGTCATTTGGCAAGTAATGTGTGCATACGCTTATCATATCGT
      TTAATTTAACTTCCTGTTTATTTGAACAGTAATCAATTATTTCGGGTCTTACAAAAATAAGAAGAAACTGATAAGAGCAA
      GCAAATATTATAAAATATTTACTGACTGCTATTACAGGTTTAAATATCCAAAATTTTTCACTCCTTATTAGTAATAGTTT
      TGAAAATTTCTAGGTGCTTGCTTGATGGAAGGTTTTTGTACTTGTTTTTGATTACACTTTCTAAGCAAATCTCAATTTCT
      TTCCAGATTTCATCGAGAACAGTATTGAGCAGACGGCCGCCAACGTTGAGGATGGCACCTCGGAACTGGCCAAGGCGGCC
      AGGAGTCGCCAGAGCTACCGGCGCAAGATCTTGATACTCCTGGTGATCGCTGTGATAATAGGTTTAATCGTAACTGGCGT
      TATCGTTGCCAAACTGAACAGTTAATTGTTTTATTTTTACGCCCATATTCAACAAACACACGCAAACATACACAACCCAC
      ACACACACACACGCATAGATTTTTGTAAAACGATTTTTATAAGAAACAAAATATTCGATCGTTGAGAACTCTGTTTAATC
      ACCAAGTGAGCAAAGACAACAAGAATGTAGAGGAAAAGCTAAAGCAAAAAATAAAAACAAATACCATATTTATAATTATA
      CATATATATCTACATATATATACATAAGTAAATAAGGATACTGAATCCCACTTAACTTGCATATAAACAATATTCAGCGC
      TTTTAAATGTTAATTATTTCTTGTTAAAAACGATTATCGCGAGCAATCTGAGTTTTGCATTGAAATTTGTAAAATTTTTG
      TGTTTAGTTTCGAGAAAGCGGAAGGCGGATTGCTGAAGCCGTCTGCGGCTTTAGTATTCCCTTTTGATATATGTTACAAG
      TTATATATAAGTGAGCCAGCAATCGAAAATAAAATAAACCGAACAAACCAATTTGAGTGATTTGAAAAGCGCGCCAAGTG
      GCTCAAAGAGGATGCAATAGGTTGGCAGTCCGCTTAAATTGATAGGACGTAATCGATAGACTTATCGGTGTGGGGCAAAA
      CCAAAACAACGTGCTGCACAGCAAAACATTTATATTTCGTTTTCTTGATAAAAATTTGTCATTTGTAAAGATGCCACAGG
      GAAAATTCAAGAAGGCCAAGCTACCAGCAGCGATACAGAAAAAGAAGAACCAAAAGCAAGCTGCTTTCACCCGTCGATCA
      AGTGATTACCCACATGCTTAACAATCTTCTCCAAATTCTATGTTTTTGTTTTATTAATTTACAGATGCGCCAATTCAGGC
      GAAAAAGGCCAAGTTCAATGAGACGCAGAAGATCAAGTCCGTTATTTCGAAGTCGGTCAACAAGAGCGTGGAGAGCGAAC
      TGCGCTCCCGCGCCCACGAGGGCTACATCCAGTTGAGCAAGGCCCAGGAGGCGGTGGCCAAGCACCACGCCTCCCAGGCG
      AAGGCGGCTGCGGCGGCCAGTACCGCCAAGTCCGCGGAATAGCTTACTCTAGGCATAAGTACTCTGTTGATAACCAAATG
      ACCTGCATATTGTATAGTAAAACATTTCTAAAACTATTTCCTTTGTTATAGCATCGATTGGAACCCAAAGGAAACGAATT
      CTCCTCTTAAGATTGCCAAAAGGATTAACAAATCCGCCTAATATCAGAGCATATGAGCTTTAAAGCGTTGTTAGTATCTG
      CAATCTCTCAACAGTCTACTAAATTAAGAAAGTTACTTAAATTTTGTAGTTCTCGCTGAGTTTTAGGATTGCATTTCTAT
      TGATGGTCAGGTGAACCTAATATTTGATACTAAATTCATTCATTAGAAGCTATACTAAATGAACAAATTCATTTTCAATG
      TTAGTATGAACTATTTTATGTTATAAAAAGTTAAATGTTGCCAAATGCAGAGTACATTGTCTTACAATCTTGAATATTTT
      ATTCAGTATGTTTCACAATGAATGCAAATTACTAAGAACGATAACATTTTCTTTTAAATGCCGTGCAAATTATACGAATT
      TTTGAAGTTTTCATTAAGTTTTCTTGTCGTGAGCTTTGACTTTTTCCCAACGCTGTCTCAAGGACTTGTTGACCAAGTAG
      TACAATGCTTACTTTGACGTTTGGCCAATTTATGAGCGGACCTTTGGTGGCCGCTGCTGGAAGAACTTTTGCATTCAGCT
      TCCTACTTATCACAATCAGTTTGTTTAATTATAAAAATAGTTGGCCAACAAAGTTGGTTCCGCTGACATTTATTGGACGA
      TTCGCTGTGGCTCCGTTCGCCCAGAATTCGGGGGAATTCCAAAATTCCGTAATTCCGCTCCTTTAACGACAGCTATTCAT
      GACAAACTTTTTAGTCATTGGCAGGCAGCTTTGACGAAGTGAAAAGGAAAAAGTGCCACTAACAATTTCTATTTAATTTT
      CGCAACGTTTCGTTTCGTTTGCTATGCAAATTCTGTCCGCTTTTGATGCGCTTTTAATTAGCCAGCATCCCGCACTCACA
      TGCAGCCGGAAAAATTCACAGCCGATTGCGTGTTTTTGTTTTGTTTCCCCTTGTTGCAGCCCACCCCCTTTTATCACTCA
      CCCCCTTTTATCAAGCACTTTGATTCCGCGCCATTTCAATCGCATGCAAATTAGCCACTCCCAACCGGCCCACCGCCCAC
      TAAACTGAGGAACAGGTGACAGGATCCCCAGGTGCTCGTTAGTCGTTTTTTTTTTGGGCGTTTTGCGTTTTTAGTTTAGC
      ACCAGATTGAAAGTGCTCCCAGCATGCAAATGCATTTCTGCACTCAACCAGCAATTTGGCGGTATGCCCCTTTTCGGATA
      TGCTGTTTTAGCGCCGGAAAGAATCCGTTGATATCAGGCATTCGGAACTTTTTGACACCTATTCAAGCACACTCGCCACT
      TTTTCAGGGCGTTTTGAATATGTCATGAAGGATGAACTACTCTTCAACTATCTTGAAAGGAGGCAGAAGAAAAAGATAAT
      ATGCTAAGTGTATCTATAAGATAAGATGTACTATATATACTATATTTTCGGACAGCATCCAACAATATTTATAATATTTT
      GCATAAGTGTATATTTATATTATTTATATCAGCTGAAATTACTATGAAAAAAAAGTTTCAAAGGAGTTATAAATTAATAG
      AGTATTCATCTTGCTAACAACTGTCTACCCTTTTGGCGGCTTTTAGCCTGACGTTCCACTTGATTACCAGTCCATCTCCT
      CGCCCTCACCAATTAGAGAAAAAATTGGTAATGGCACCGACACTTGAACACTTATGCCAATCGAAAGGTTTACAAAAAAA
      TGCGAATATCTCTTCAACTTAAAGCCTGCGTGGAAATCCCCGCTTTCCACATCAAAGTGATTGTTTTTGGTGTTTCATTT
      TATGGCTTATTTAATTGAGCATTGCATTTTGACCGCATTTGGCAGAGGAATTGATTGATTTGCATTCGCACTCATCCATT
      CAATCCACCCCATCGATCCCCACGGGGCTTAGCTCAGTCCATTTAATTAAAATATTTCGAACAAAAGGAGCGGACACCTT
      TCACGCATCCCCGCCCTCACAAAGGATAAAAAGCAGCGTCCAGAGCGGAAATCACACGGCCCAGCATCCTTTTTGCATTT
      TCCATCATTTAAATGATGCGTTTCTGTTTGCCTTTGCGTTTGCATTTGCTGGCTGCCTTCAGTCGGTCGGGGACCTATTT
      GAATAGCGACGTGTGTCCCACTGTCGGACATTCCAGGTAGAGCAGCCTGCAGCTCTCCATGCACTCAAAAAAAATGTTCT
      AATTCGAAAGATTTATAAATTTACTTCTTCACGATTCGGAATGTATTATATATATCTTATAGTTTTTAAAATATGTTTAA
      CCATGCAGTTGACTGTCTTAACTGTGTGGTTTCGTGCCATATTTCGGTTTCGACCCACTTTACTTTAATTATACATTTTA
      AGTGCCTAATAATGCTCTATCTATATCTCCTGAATCACAATCATAATATTCTGCAGAATATGTCACATTTTTTTTCAGAG
      TGGATGTGGCATGGACCACGGCTACCTGGTTACCTGGTCAGGTTGTCCGGCATCTCATTGTGTGCGAGGCGCGCATGTAA
      ATTTGTCCAACTGCACAGGCAAACACTTGGAAAGCGAGCGACAGAGGCCCACTGCTGGCGGCCACCTGCGGCATTCCACG
      CCAAACCATGACCATTCAAAAACAAAAAAAAAAAGAGGACCCATTCCATTCCATTCGATTCGATTCCGTTTTCATTATCT
      TTTTGTTTTTGCATACAATCGAACGCTTTGGTTCCTGGTTTGAGGTCCATATCCTTTCTATGCGACGACGCGCGGATTCT
      GATTTATACGAGTATGATGAATGACAATGAGCGCGGTTTTGTCTATTATTTCGTTTCGGGTATTAAGTTTTTCATTTTTT
      CGTTTTCGCACACTTCTTATAGGGGGATTATATTTGATAATAGAAGTGCTGAAGATTAGAGCAAATTCCAGGAATTTCTT
      AATCCAGGAATTAGTTTCAATCATTTGTTATTTTTTATATACATTTTAATATCGATATACTAACAAAGACAATACAGTAA
      CTAGAATATTCTAGTGCCTTTGATACTAAAGTTCAGTTTTAAGGAATTCGTTTCGCCAAATGATTTCATTCTTCTTCTTT
      TTTAGATATCTTCTAGATATCATTCCTACTAATTTCCAACACATTCCTGTTTTCTCTCGCTATCCCAAACGCATTATTAA
      TGAACAACTTCGATACCTTTACTAAATTATACACCTTTGCCCTTGAGAGAACGCAAGGGAGAGGGACACGAATATAAAAG
      AAAATTCACCTGTCCACACGGATTTCTAACTTTTAATACATAAATTAAGGCTCAAAGCCGAAAAGTGAGGGAAACGCAAG
      AGAAAGAGAAACAGAAACACAGGGCAATCCGCGGCATTGAAACGATAAAGACCCGGGTTGGTTCATTGAGATATTCCACC
      TGCAGTCGCATCGCATACCCAGTGCCACCAGATCAACAACATATAATAATCCCATCAGCATTTTCGGATACGCTTTGCAA
      ATGAATTGTAGAGCGGCATTCCCGATTCCCAACCAAACCGGACTTCAGAGCATGGATAATAATAATGTGGAACCGAAAAT
      GAGCCACGGATCGTTGAAAACTGACGACTGGTCAGCGAAGGTTCTGCATTTGCACCTGCATCGGATGGGATCGGAACTTT
      GATGGGCCTGGCGTGGCTTACATATAATTAAAGTGGACTTGTGGATACAACCTGATATCCTCGCCGATGTGCTTCATAAA
      GCATATGAGCGCGCCAAGATTACATAATGGTTTCGTTATTAAATGACTTACATTTGCATTTTAGAAGAGCTGCGGTGGGA
      ATTTCATCGTTAAGAACTGCACTTTCGTCGGAATTACCCCAACAAGTTCCTTTCATTGCCTTGGTTATCTATAATGTTTT
      TTAGTGGTAATACCTACATATGTCCATCTGGCAGTAAATAAACGGTTCTTTATTATGTTAGGAATGAATTTAATTAAAAG
      CTGTGTTAAGCCCTGCTTAACGAACCAAATCTTAGATAGTTGTTCAAGTTAAATGGAATTGATAAGAACTAACCTCTAAA
      TGTGAGCAGTGTTCATTATTTCAATTTAATAAATAACCATGGCTAAATTGTAATCGAATTAAAGGCCAGCTATCCAAACT
      TTTTGCAGCCAGTTTTCAGGGCATTTATTATTTAGTTAACATTTCCCAAATCATTTGCCTTGAACATTATTTGCACAACT
      GCATTATTAAAGCACCGGGTAGCATTTCACTTCCGCTTTCTGCGAATAAAAAACGAATATTCGTCGAAAAAACCAAGGCT
      GAAAACCTGAAACAAGAAGAAAAGCGAAGCAGCATACAACAAAAAAAAAATCTGTTGTCAAAAGGCGGAGCCAAAAGCGG
      ATGTAAATGTGCCCAGCTGCATGCCAAAAACTGCAATTGTCATCAATACGAGCCAGAGATTCAGAATGCAGGACTCAGGA
      TTCGGGGCGGCACACAAAGCCAATCCATAAAACAAAAGCAAGAGCGAAAAGTGAATTTCAATAACGGATGTAAATAAACC
      ACATGAGATCGATTACCTCCCCAGCGTGCGGGTGAGGTGAGTCGAGTCCTGCTGTCAGGATAACAGATGCACGAAAGGCA
      CCGACTGCAGGTACAGCTCCTCCTCCGTCTCCTGCTCCTCCCGCTCCTCCAGCGCCTCACAGCCATAAAGCATCCACCAT
      ATCAGTTAACTCAGAGGGGGAGGATGGAACAAAAAATCATAGTCCTCGCTGAAAAAAAGCACAAGCCAGAAACATCTGTC
      CTTTCTTCGAAGGAGCCAGAAAAAACGCGGCAGGTTTAAAATTTATTTAGCTCGGCACGAACAGAAGGTAAAAAGTGTAG
      AGGTAAAACGCAGAGCAACTTGGTCATCAGAAAAGGTTTCAGGAAACAAAACTTTAATGAAAAAAAGTAAAATAATTTAA
      TTTTATCAACTACTATAATAATAAACTACTTCAGATTTTAAGTTTTAACAAATGTTTTAAAAAGTTTTCAATTAACTAGC
      AAATATCTCAGAAAAAATATAACCACCTACCAAATTAAAATATTGTCATCCATTCATATTCTTCATGACATGACCAACCT
      AACATGACTAAATTTTCATCTATCTTTATTTTGGTTGTTAATATTTTTATATTTATGGTATATTCGAGTTTTAAAATATA
      TATAAAATATATGTACAATATATATTTCATTGCGATTTATTTCAGCGATTCCACTAAAAGGCTTTACACTTTGTAGCTAT
      GCAAAAACATCTGTCCGCTTTTAAGGGGATAAGGTAGAAATCCGACAAGCTTAAGATACATTTGCGTCAGCCGATGGAGC
      AGGAGGCCGAGGAGCAGATACATATGCGATGAGGATGCAGCCGCGGGCCTTGGCCATCAGAAGACAAAAGCCCATTAAGG
      TGTAGCACCTGGACCGAAGATCACCTTGGTTTGGCAATCGGCGGAGCAGGGGGATCTTGGCCAGGACGGGAGTGGAGTGG
      AGTCGGGTGGGGAGTCGCATAAATGTGTCGATATTATTACGGTAAACAGTCTGATGCGTTTTAAATTCAATTTTAAACTC
      ATCCTGCACTCTCTAATTGGAGCCTTTGCGAAAGCGGATCCTCGGTTCCAACGGCGCATAATAATAATGAGCCTTGTCAG
      CGGGCCAAGTTATTCGCCGCTGAATGTGGCTTATTGAAAATCCATCAAAATGTTAAATCTTGTGCCATTTCGGGGGTAAG
      TGCTTAAACAGTTGCTTATTATAGGGTAGTCTTCGCTGACCCACAAAGTGTGCGATATTACTAAGCAAATATATGAGGGA
      TGGGGTAGGGATTAAAGAAAAAATGGAAAGTTGTAATGGAAAACACTTAACGGCTTTGATTAAGGTTAAATAGGGCGGGT
      TGTATGTGCATGTATTTTGTGGGAAAAAGTTTAAAAATGTGGATATCAAGTTGAAAGAAACCTTTCGTAATTCAATTATG
      TGATGTGAATTGAAATTGGTAAAGGTTTTGATATCAGTTAGCAGTTTTTAAAATTTATTTTCTTTTCCCAGTTTGGTAAT
      TGCATGGCATAAATCGAACCAATGAATTGACTAAAATTGGTCATGTAAAAAGATCATAAAAATGCCATGTGGAGTGCATG
      AAAATCATATATGAGCCTTGTCGCTAAGAATAGTCCAATCAAAATAGATTCTTAGATCTCTTCTTAGGATCACTGCAAAC
      CAATTTCAGCTGCCAGCAAACAAACGATTCCAAAGTCATCCGATGGTCATTGTATGAGAATTAGGGAATACCAAAGAGTT
      TGCCGACTGCAAAGGTGTAAAGAAAAGGTGCTGACCCAAGGACAAAGGATCAGAAAGGAGCCCAACGCCTTCACAGCCAC
      AATGCGTCAATAGAAACAGACAAGGAATTTGCCAGAAATAGTTTCCCGATGGCTAAGACCAACATTAATCATCGAGCACC
      AATTCCAAGGCCAATCAGTGGACCAAACAAACAAAAAAAAAAAAAGCCAGAATTAAGCCACATCAAGGCCATAAATGTCG
      CTTCAGTTTTAATAGAGCAAGCTGATTTCGAACAGGACCTTCGCTCACACACACTTGCAGCTGGAGAAACCACAGGAGTC
      TGGTCAACAAACAATGGCCAAGGCGGCCAAGCGGCCAGGCACAAAGGTGTCCAAGTCATTTGAGATTCGTTAAAGAAAAA
      TTACATGAAGTTTTTGCGGAGCAATTACCAGGTGTAAGAGAAGTCCAGCACTCGGGGGCGTATACTAATTGTTCGATTCT
      TGGCCCGCTTGCGAAATGCTCATGACAAATGTCTTGGCCAACACCCTCCCCCCTCTCCCAGGCATTCATCACTCTGCATT
      CGAAAGTGCGCTGTAATTTCGACCTCCTTTTGTTGGCCAATTGTTCGTTCGGGCCAGCCTTTGTCGGCACCCATTTGGGG
      CAAGTTTTATTGAAAAGCCAGCCCCGCTGGACCGACACTACATGAGTGGCTTGGGTGTGGGTACGCACATGGATTCCATC
      CAAGGACTATTGTCGGCGCTCTACTGAGTTGTAATTAATGTCCCCTGTCCACCGCAATCGTTGTTTGATTGGCGAGTTCT
      CTCTTTTTTTCGAGAAACGAATCTTCCTGGAAGAGTTCGTCTGACTAGGAAAATGATTTCAAATATAACTCAATTACTTA
      CATATTATGTCTAGAGAAAATAAGGCACACTAGTCTTAATAATAAATTTGTGGATTTTACTGTAATTAAAAGCCTTGCTG
      TTATTTTAAAATTATATACAATTATTATAGTAGTTTCTTTATGTAATGTTTCTTTATTAAAAGGAAATGCAACCTGCTCG
      TTCAGTTGATTTTATCTGATAGGGTAGATTAATCTTTACTTAACGTTTGCGTTTAGCCGCTTTGTACACTCAATTTGGGT
      TTTGGCATTGGCCAAATCGTATCTGCTACTCGAACTTATCGGTAATCCATCGCCTGCCAGGGGCACTTAACATGCTTTTT
      ATCTTTATCTTCGATCTGGCCGCATTTCCTCCTCATCGAATTTGGTTCGGTTCCTGTTCAGGCCGCAACTTCCTTGGCAT
      TGTGGCGCGTTTTTTCCTTTGTTTTGGGTTTTTATATATTTTGGCAAACTTCTCGGGTGTCAGGGAGGAAGTAGGTGTAC
      ATGTTGTGGTTGATTCGAAGGATACCTGCTCCTCGCGAGGGATGCTGTCGCCTGAAACCCGAATTCAGTGTCCTGAAAGC
      CGATACTACGCGAGTGTGCGAGCCCGGTTTGGCATTTGTCTAAAATGCGGTTTTCCTTGGCATTTAATTTCTATTTCAAC
      ATTGCATTCGTAATTCGAGCCCTTCCCACAGGTGTGTGTGTGTTTGTGTGCGGATTTGGTCTTGGGGAATTGGAATTGGA
      GCAGGTTGGTTGGCAATCTCTCTAGACTGTGTATTTTAGTGCCGGAGTCCATCGTTTATATATTCATGTTACCTTGGAGA
      GCATTTTCCCTGCTGCTTGGCTTTTTGTTTGGCTTTCCCTCAAATTGTGCGTGCTAAAAACAGTTGACATATCCATGGGC
      GTGGCTCTATGTTCGGTGTCTGGGGGCTTTTACCGTTGGCATTTTACCAGAGCTACCTGCTCAACCAGCAACTCACTTGG
      CGCTCCTTAAAATGTCAAATGTTCTCGGGGACCATCCATCCATCCGTTCGCTCGTCCGTGCCCACATATGTATGATGATG
      TACCCATCCCGTAAAGCTGCTAATGGAAATTGCGGTTAGCGGAGGCGTTTGGCGACGACTTCCTGTCGTGCTCGGCCTGG
      AGAAATTTATGCTAAAAGGTTGCCAGTTTGACTTGGGAACGAACTGCGCCTGCCACCCGAGATGGCCGGCAACTTAAGGC
      CTCGCCGTTTCCACGGGTTATCTATTGGAATATGAGGTATTTCGTATGAAGGCGGTCGCAGCAAAAAATGAATGCTATCC
      ATTCATATTCGGGGGCAATTTGCCTGTACAACGAACAATCCCGGCCCATCCTTAGTGTCCGTCCGTATCTGCGTCCCTTG
      TCCGTTGTCCGTGAGTGCGTGCGGCGCCTGGAAAAGCATTTTGTTTAAATGCGGCGCAAACAAGCTCCAGACTAATTACG
      ACAGGGAGATAACAGCAAGCAGAGCCAGCCAGGCCAGGCTGGCATGGATTCAGGATCCAGGATAATAATCTAAGCAAATT
      TATCAACACGGACACATATGAAAAAAATATGAAGGAAAAAAACAGCAGACAGCAAAGGATACGCACCAAACGAGCGAGTG
      AAAAATTATGCGATGCGGACTCCAACAAAAGACACATGGGAAACACTGTGGAAAATGGGAGCAGGAAGGGGTTCCATAGA
      TTTGGAGGAATCGGCAATCTCGCCTAATCTCGTTTTTTTTTTTTAGCTATTTTCAGTTAATTTAGGTTTCCTGAAAATTC
      CTCACTTGCCTCTTAGATTCATATCATCTGTTTCTATTTTAGTGGCAAACTAAATTCCTTCGAAAAATTATATAAATTCA
      ATTTAATATTATTAAATTTTTTCAGATATTCATATGTTTCAGAAAAATACAGTTTATAAAAATATATTTTTTTAAAGTTT
      TGAATTTTGTTTTCCAATAATTTTGAAGTTATTAAATTTTTTATTAAATATTAAATATATATGTATAATCAAGCCATCAT
      TATTATGAATAAAACATCCCACTTTTGTGCCTATTGAGATGTTAACTTAAGTAACTTAAAACAAGCACGCCACCTGCTGC
      AGGCCAAATAATTAAAACGGCGAAGATAAGGCTTTAAACACGGCTTCAGTCTGGCCTATTCAGGCAAATGGGTATTTGGG
      TGAGGTTCCCACTTTCCCAAGAACTGGAAAATCTGATTTCCTTTTTGGCCAAGATCATTAGGAGAACACCGCCTACAAAC
      AAATCCCGTGTGCAAATATTTGCCACAGCTAACAAGAAAATCTGCGCGCCAGAAGATGTTGCAACATGGCCTAAGCCCAG
      ATCGTAATGTCCTAAGCCGGTTCGGGATTAAATTGGCTTAGATGGGACCTAGAGCACAAAGGTGAAATGTATACAGTTCA
      TCAAGGATTGATCCTTCGCATAATTTTGCGCAGTCCCTGGCTGGCGGGAAACCCCAAATGTGAACACCGGAAAATGCGGT
      GCGGGAAACGGAATGCGGAACTTTCCTTCGCCGGAGGCGACCATCAATCATCGTCAGGCTCCGGGGCACATTAGCATTTA
      TGAACTTTTGGCCGAGTTGATTTTTCTCACAGCTTGCCAAGGGCTGCGATTTTGGTCTAGGACTGGTTGACTTTAATAGG
      GTTTTCCATTATTTCATGCGCTTGTGCATATTTGGCAGTCAATTAATGTCAAACTAGTTACAGCTCTCGCCCGGCAATCG
      ATCAAAAATTTAAATGCAACCACCTCCGTGGGTTACTGCAACAAAATTATTTGACATTATTCATATGACCCGAGAACAAC
      AGCAAAAAATGAGCGATGACAATGAGGTAGTCTTATTAAAAACTGGAGGATAGGCCAAGATACCGTTGAGGTGTTGATGA
      TCTCGATAAGAAAAGAAGTTGTGGAAATACCTTTTGCCTTCATTTAATGATTCAGTTTTTATTACATTACCCATCAATTT
      GATATGGTGGTTAGGAAACCGCGGTTCAACCAAATGAAACTAATCTAGAAATTCATGGGAGAAGTTCTTTGGACGAGATG
      TTCCTAATTAAGATTTGGTTCTTGATAAAAACGGGAAAATTAAAGGCTTCATGCTGAACAAACTTTAATCGCTATTAGAT
      AGGTACATAATCCCAAGGAGATCGTGAAATTATATGTATCTTACCTTAATAGTTATCTGATTAATGTAAATAACCTTTAA
      TTATATATAAACGAAGCAGATTTAAAGTGTATACATATATCAGCTTATATTGTTTACACATTGTTAAGCTCCTTAAACCT
      AAAATTCCGATTAGCAATAACAAATCTGGCATTTTACATAATTCAACTGTCTTGTGCAATTTAAATTTGCAAACCTCGTA
      AACAGCATTTCATTAAGTTAATTAAAATAAGCCGAAAATCCCCAACCAGTCAAATGGAATTTCGCAACTTAGTTTCTCCG
      ATTTTTTACGCTGTGTCATTATTAAAAGCGGCATTTTAAATGCCATTTTGCATTATGAATTTAATCCAATTGTTGATGGC
      GTTGAAAAAAAGGACAATGCAGCAAATGCACAGAGACAACAATCAAATGATACGGTAATTAGTTAATTTATAAATATCAT
      ATAAACTGCTCATTTATGAATTCAATTAATGTTCGCAGACGCGTGACCGAAGTGGATTAAACTCTAATTTAATAACTCAG
      TTGGCAGTTAGTGGGTGCAAAAAATGCGACCATGCAAAGTGCTCAAATATTATTAAATGAAAACCTCAAAATGGGTGACA
      GTTGCAGCATAATGATTTACACCACAGAACTGTCAACGGTTATGGGTACTATATCGAATATTTATATACATATATATACG
      ATACTATACGTATGCCGACACATGGCCTGACATCGGTTGGCCACAATCCACGAATCCTGCCCACAGATGCGTTTACAACT
      CACCAGAACGCCCAGCACTCATTCCTCATATGTCATGGATAGATGACTACTTAAGGGATCTGTCAATTGCCTAGGATAAT
      GTTGTGTTCTGTCGTTAATATATATGCGTTTTCCAAACTCAAGTGGATCTCGGTTTCTCGGGATATGTCTGCGCACATCT
      GTGTAACCCTAGAACGCAGAACGCCCATAGCTCCCTGGGATCCCACTAATCCCCTGCCCCCAAAAGATATATGTATATAT
      ATCCCTCGTGGTTAGGCCCATGCCAAATGTACGTATAATCACATTGTTGACTGCAACTGCAACTAATTACAAATCAATTT
      GAACCAGCCCCCAAAGGCAAACGAATTCCGGGGAGAGTTGTTCCATGGCCAACCGCAACAAACACAGGAAGCGGGATCGC
      GGGTTCCTAGCTCCTTAACACCTGCCTGCACCCCATTAAAATGGTACGGGGCCAGTGTCAATGCCAAGTTTCAAAACGGA
      ACACAAAAATAAATTGACATCTCAGGCTGGCCGTAAATCAAAGGAGACAACTCAGACATCCAAACCATGTTGAAGTGACG
      AAATGAGCTGCAGAGTGAGTCATAAAAACACTGAAATCTAGAGGAGATGGATCACATTTGATGGTTGTCTTTTATGATCC
      CACAATTGAGATACAACAAGATGGAGATATGAGAGTTCTGTGGAGGACAGTGTAGATATATTTGAGAAGGAAACGATTGA
      TCACAAATGATGGATGGAGCTTATGATATGATAAGCATGTAATAGATCGTCCAAAAATCCTGCTAAGCCCTTAAAAATAG
      TAATAATAATATATTTTTAGCACCCCAAAAACTGATAGCAACTTATAAATAAACAGCATATATTGAAGACATCAAATGTG
      AGTGAAGAAACAGAAGAATTGGCATTGAAAAAACTTTGTTTATGCAAACAATCAAAGATTTGATTGGCAAATATATATTT
      TTGGGATCGTACCTTAGGGTCTTTGTGTACCCAAACTCCAACTCTTTCAACACATCGCTTAAGCTTATTAGTACCCAAAG
      ACGTTTTTGCCATATATATATTTTTATAAACCTTTCTCAAACAGTGGCGTATATAAGCACTTCAGCTTCGATGCCTGGCC
      ATTGTTCGGGGATCTTGAGAGGAACAGAAGAATCATTTGTCTTCTAATTATGATTTCAATGGCTTGGCAGAATCAAAGAA
      GGCGTAATTCGCTCTCACCACAGCCAGGACTCGTTCGGGGCCGACTCTAAGGCGGCAAATCGAATCAAAGAAATAGCAAA
      CAAACAAATAAGAAAGGAAAAGCAGACTCCTCTATGGTATTGTTGACAGGCCGCCGAAATGAAGGAGACCGCAAAATATA
      CTCAGACAAAGGATGCGGAGCAGGGGCGACTTCATTTGCACAAAAGGAGCGGAAAAAGCGATCAAAGAGCTAACAAAAAG
      CGGAGCACCGAACTCGAAAACATAAAGCAGGGCCATCATCATCACATGTCCGACGTGAGGTAAACCCATCTGAAAAACCC
      CTAAGCAGGCCAAAATCCAAACCATATCCATGCGGCCAGCTTAGGTCTCCTTTTTTTTTTGGCCTCATCTGCTTTGTTGC
      GTTGTCGTCTTTAAGCTCTTTAAGCGATATTAAAAAATTTCACGGCGCAGCAGGAGGTGGCTTGGAAATTTTAAAGCTCT
      CAAGGTTTCACAAAAATAATATGAACATAGCCTTTGAACCAGAAGTGCATGTGGCGTGCAACTCAAAAATAAATACATAT
      AGTTTATAAAAATATTTCACATTTTGATTGTTTTCTTGTTGTATCGCAGATACTGATGAAAATTAAGTAGTTTTACTTAA
      TTCTTCCAGTCTGAAGCTGCGTTTTAGTTAAGTTAAAATTTAAATTTAAATCTAGTCGCCAACATGGCTATTCAGAGCAC
      AATGCTTATCAGGTCCAGAGCACTATGTCCGCAGTGGGCCACGTACTCGGAGCATCCCGGGCCATGCGTGCCCGCATCGG
      AGGCCTTGTAGAGCTCGTCCACGTGCTGCAGTTCCTGCTCCGCGGCACTTGTCGTTGGCCTGCGGAAAAATTGGCGGGTG
      GGGGAAAAGGATGTCATAATTAGTGGTGACCCCTTGAAGCAAGCGAGCTGGAGGGAGACTCACATGAATAGAATCTGAAA
      CAGGCTGCCCAGCAGCCCGTTTTGATCATCCAGGGGCGATTCGCTGACCTCGCAGATTGTTCGCAGCAGGCAGGCGGAGC
      CATTGAATCCGTAGTGGGTCAGGAAGTTTATAATGCTGCGGTAGAAGTCGTGGCGCCTGAAGGGAGGCGGAGATCCCACC
      GAGCGACGCCTCACCTCGTTGTCCTCGTCCTGTGAAAAATCACCTCCATCCTGGCGGGCATTTATGGGAGTCACATTGCC
      TCCGACGCCCAGATAGTGATCATCCAAATCCCACTTAAATATAATAATTATAAATTATATTAAATTATATAAATTATATA
      ATTTAAATTTTTAAACATACTCACCCTGTCAATCCACTGATTGTAGGAATCGTTGGAGGGCAGTGCATAGTTGGACTCAA
      AGTTGAAGGCCATGTACACATTTTTGGGACCCAGTTCCAGTGGAATGGCTACAGCAGCCAGTAGCTAAATAATAGTGTCA
      ATAATCATTACACCCCTCAGATGAATCACCTGCAATACTCACACCAAAGGATCCCTGACGAGGAAACACCAGAAAACAAT
      GTGCTAAGCTCAAGCCAAGAACGAAAACTCCACCCAAGTAAAACTGCCAGCGAAAGGCACCCATCTTAACCCGAGCTCCA
      GACAAACTAAGTGCAGTTTGCGAATTATTGCAGGTTGCACCAAACGATGGGCGTCAAAATTGGTAGTTAATGAATGGGTG
      AGAAGTGGCTTACGGTACTACCGAGTTAAGAGAAAGAAACCGGAATATGCAAGATTTACACGGTTACCACTTGACCTCGT
      CTCCATCCGATCGCAGTTGTCTACTGCGAGAGGTGCTAATTGCTAGAATGTGTAACATTCTCGGGCGAGAAAGTCTTGTG
      GGCTCGATTGATGGAGCCGTTTTTATTGAGAAATCAAAAATGAAAAATTCGTGAACTAGAAAAAGAACACCCAGAAAATG
      GATTAGTATCTTAAAAACAGAGCTGGCATTAACACGCACTGAGATTCGCTCGGGCGTAGACCAAAAAAAAAAAACACCAA
      ATTATAATAACAGGAAAATGAAATTTAGTATAGTATTCATATTGGTCAGTTGCCTGTTGTACCAGGTGATGGCCTCCCTG
      GGCAGCCTCTTCAAGCATCAGAGGAGTAAAAGAGCTCCCATTCCTTGGCTTATATACCCCACCACATCACCCACTCGCGT
      CATGGTAAGATAATCTATTGGTTGACAAGAAATCCCATTTGTAGCCCACTTTGTTCTTCTCCCAGTTCATTGGCGGCATA
      GGTATTCCGCTGGAGGATCTCAACTACGAGGCGGTGACCACCGGCTATGTCCTAAAGGTGGAGTATTGGCTGCCCACCAC
      TCCGGATGATCTGAGAACACCCACGGCTCTGCCCCTCACACAGGTGGCTACGCCGGGTGTTACCGGAGCCAGAAAGCAGA
      GGAAACCTATGTTTGAGAACTTTTTGGTTGGAGTGGATGAATTGGGCAAGAACACCAGGAAGCTGTTGACCAGGACCAAC
      AAAGTCTTGAGTAGCTATCGATGGACTGTCTACAAGGGACTAGAGGGATTGGCCGATCGATTGGGCTATCAGGGCAGGAT
      TTGTGTGCTGAAAAGTATATGCGAGGCGGCCGAGGAACCCTTTCATTACACAAATGGACTCTTTGCGGATCTATTGCACA
      TATTACTCACGTAGGTTGTAATGGAAAAACATCTTAACCATCTTATAATTGCCTCGTAACCACAGACCCTCCTCCTCGGT
      GGACAAGTTGTCGGAACATGCTGACAACGAGTATTACTATGCGGAGAAGATGGGACAATCCGGAGCTGGATGTGATCGGG
      TCTTCAAGGAGTGTCGACGAAGTTTATTGCAACACTTTAGCGAACTTCATCACAATCTGGATAAGATCTTGTTTTGAGGC
      AATAAACGAAGGCTGAACTGATACCAAATTTTTCGCTCAGTGTTCTTTGTGGCAAATGGGACTTTGTGATAGTAACAAAA
      ATGGTCTAGTGCTAATTAGAAGAACGTGAACTTTTAGTGAAGACAAAAAGCTCAACATGGAAGCTGAAAAAATCGTCTCC
      ATTCTGATCGTGACTCCAGTGTGCCATATAAATTGCAGCTAATGACACTTTCGGTTTCCTAATCGAAGAAAGTAAGAAGT
      TTGATTCCCTGGACTATTAAGGTGAAATCATTTTGCTGTTTGCTAATTTAGTCATCAGTCTTCTTTGAAGCGACGTGGTT
      ACTAAGCACTAGGAAATATTCTTAAGGACTTTATCATGAACGTGTTGATAACAGTGCTCGTAATTAATAGTTTTGTTGGA
      GTTCTTGGATATCACACTCCAAACAATACTGAGAATTTTAGAAGTGAGAGTGATATTTTAGTGCGAAAAGCCCGATGGCT
      GCCCTTGATTTATCCTAGAGCTAATCCAACTCGATTGCAGGTAAGTTCATGATTTCATTTTTAAATAGGTTATAATTAAC
      TAAAGACTTATTCAAAATAATAATAATAATATTACTTTCCAGATGATTGCTGGCTTTGGTATACCCGCCGAAGATCTTAA
      AGTTGAATCCGTCATTACGGGTTATGTTCTGAAAGCTCAATATTATTTGCCATACTCTGCCAAGCAATTGAGGACCAAGG
      ATGTGCATGAAATCTCTGAAAGTAGGCTGCTACAAAATGCGACCATCTTCGATAAGGTCATGCAGATGTCGGAACAAAAA
      CTTGGATTTGATCCAGATATCCTGCAGGAGGATCTGCAGGCCCTGGGCAGCTATCGTTGGTCGGTTTACGAGGCTTTCAC
      GGCTCTGGCCATTCGCATGAAGCTGAATGGCAGAGTCTGTGTCCTGAAGAGCATCTGCGAAAGTGCTGCGGCTCCCTTCG
      ACGATCGAAATGGTTTGCTGGGCGAAGTGCTTCACATCCTGCTCACGTGAGTTTATGATCGTGGGATCGGCCTTATGGTA
      ACCCCAACTCCCTTTCAGACCATCTAGCTCGGTGGATCCCTTGTCGGAGCACTCGGACAATGACTACCTGCAGGCTGAGA
      GATTGGGAGCAGCTGGTGGCGATTGCGATCAGGTGTATCCGAGGTGTCCCAAGTCCCTGCTGGAGCACTTCAGCGATGTG
      CATCATTTGGGCAGTGAGTTCCTCAGCATGCTGGGTTGAGATGGGGCCCAATTTGTGGCGAATGATTGTGATATTTATAT
      ATAATAGCTTATTAAATTATTATTGCTGTGCATTATAAATTTAATATACTTTTATAAAAAGAAGTATTTTTTGTATATCT
      TTCTATAGTATCTATATTGTAAGTATAACATTTTATATGCAACTTTTTGATTCCTATCTCCGTATTATATTCTTAGTTAT
      ATTAGATGATTGCCTGCTTCCGTATATGCCTTTTGGACTTTGAGAACTATGAAGGCCCTTGGCACTTCCTCTCCGGTTGA
      TTTCACCGGCAAGGGCGTGAAATTTATGCAAATATCCACATAATAACTCTTTTTGTTCTCCTGTCTGGGCCTCATCATCA
      TCTTTGGATATATGTATGCATCTCCACGCTCGGGTGGTCTTTTCTCCTCTCCGGCTATCAAAGCGTACGCATCTCCCAAC
      TTGGTCCCAACCTCTTTAGGCCCTATTGTCTTCTAATTCAATAATTACAGCCCGAGCTTTGGCTACCGGGGATTGTTTTG
      GGACCCAGACCCACCACCGTCTTGGGCGAGGGTCTTGTGTTTTTGTGTCCACGGTACCTGGGACAAATAGGCGTTTAAAT
      GCAAATGTCTGCGCTGTAATTAATACGCATAATACGCGTATTATGCTAATGCCAATGTCATAATGACTCGAGGAAACCCG
      AAATGAAAGACGAAAATATGCATTTCACACTCGGTGCGGGATCTTCGGGCTCAGTCATATATTCATCACTGGCGGGCTGC
      ATAGTTAATGCCCTTACGTACTAATTAGCTTTGACAAAATATACAACAGAAAACAAAAATGTGGCTACTAAAAATTAGTA
      GTGCCGCTGCTGTTGCTGTGGGGCAGGGACTTTCTCTCTAAGAAGACCCAAATCCAAGTTCCCAGACCGAGGCACTTGTC
      TGTGATGACAAAGTTCCGATAAGAGCTGGAATATATTTTGACAGGAGTCAGCAGTCGTCTGGGTCCAGAGTGAGATCGGG
      ATCATGGTGATCCCAAACATAAACTAGATGCAAGATGCACCTTTCACAATTTTCATGTTGTGTTGTGATTACCCTTAACC
      CCTTTACGGTCTAGGGACCCCCCCCCCCTCCCCCAAATTTTGTGTGCGGTGGGTGAGGGGCAATAATTTTCATTTTCATT
      GCCTTTCTTTGGAAACAATTTGTAGGAACATGCAACTTAACGAAGTAATCAGAGGCCAACTCCAAAGAGTTGGGGGCCAG
      CAGCAGATGCTTATCCGATGCCAGAAGGCCAACCATCCAGCCATCCAGCCATCCAACCATCCAGCCAGCGACAACTATTT
      TATGGCCTTATGTGAGGATGGGGATGGGGATGGCGATGGGGTTGCGGTGGCACTGGCACTGGTTCGCTTTATATGGCTGG
      GATTGCTATTTTTGGTAACCCTTTTTGTCTGCCTTCGGGCAGGAAAGTGGGTTACTATCCCCTCAGACTGGAATTTATGC
      TGCGTAATAATTCTTGGTCCACAACTAAGTTGGTAAAAACAATGTAACAAATTGTTGTGCTACGTACCTGGAGGAGCTGC
      GTATGCAAATTCACCCACCGACTGCAAATGTCAGCTATGTCAGGGCTCAACCCAAAATGGTGGGGTCACCGGTGACCCCG
      ACCATTGTGTGCCACTAACTAACCCACTTCCACCCATTAATTTCCCATCAACGGGTTCTTACGGGGCTTTATCGCTCAAT
      TCGAAATTCGAATTACTTTTGATGGCTTTTCCATTGGATCTATATCGCTACTCGAGTTTGAGAGTTACATACAGTCCGCC
      TGAAGGGGGCCATAAAATTACACATAGATCTTATCGGGGACTTCGTATATTTCATGCTAATTAAAACGCCGAGATATTTG
      TTTAGCGATAAACAATAATTAATTGTGCTTATTTCTTTTCTCCTGCACTCCACCTGCTTCCTCCCATCCAAAGTGCCCAC
      TGATTGAGTTGTATCTGTATCTGTATCTATCTGGGAATCAGTTTCAGTTGGTTTCGGGCGCAATAAACCAAATCAAACCG
      TGGGATGGAGCCCTTTGGCTACCCACCGCCACCATGACGTATGCACATTGTCATCATAACTCTGGCCATTGTCTCTGATT
      TCGACTCCCAGATGGATACTTTTTATATTCTTTGCTTTGCATAATGCCCTCGTCTGGGGATGAGTGCGTTTTTGCGAGGG
      CGTGTGTGTGAACTGCAGTTTATTATTTAAACAACGTGACTAAATTTACGTAGTGCCGAAGGAGAGTGAGACTCTGGGAG
      GGAAAAACACCCGCAGGTGGTAAAACAATAATAGTAAACGTTTGCACAATGGAACAAGCCAAACATGCGAAAATAATGGC
      TGCATTTGGGGCAGTGAAATTGGTTGGATTAAAAAGGAGACTCATGTTTTCTGCTTCAGATCATTTTGATCTATTGCATG
      GCAATAGAAATCAAGTACACAATATGTCAAAAATATAATTATTAATTTTGTATGTTTAAAATAGTTAAAACAAATATTTA
      CAGCTACACTTAAACAATTAGGAGTGTTATTTTATGGATTTTATTTTATGTTTGTCCGTTTTTAACATATTTTGAAATAT
      GCCTATTTATGTATATCTTTTGCCCCACTGTGCATACCTGCGGCTTGGCATATGCAAAGTGAGCGTGGCTTTGGCCCCAG
      ACAATTTTCGCATGATAAATCGTTAAAGGAATATGAAAAAAACCCCGCGAATTGTAACAGAAATAACATACTTGGGGGCT
      GGGGCAAAAGTGCGATGAAGGAGAGTAGATAGCAAGGGGGACGAACTGGTGGGGCCCCACTTGGCCACCCCCCACCCACA
      CGCCCCTGTCTTTTGTTTATGAAAAAAGCTTCGCAGAATTGGCGCTACGTACGTGCCAAAGCATTTCATGGTCTGGCAAC
      TTAATTCACCAGGATGGCACCGCATGCCCCTTGCCACATCCGTAGCCATATGTTTCGGGGTCGTACCCCCTTTCGGCACC
      CATGCTCCAGTTCCATGCGGGTTCCATTTCCATTCATCTTCTGTTTGCCGGTGTCTGTGCTAGTGTTTGTTTTCCGCGGA
      ACCTGGCCCATTCTACATCCTCAGCTTTTCTCCGGCGCTCACGTGTAAATTTTCTCAAATAAATCATTAAAAGCTGCGCA
      GCAGCCGCAGCACATTGACATTGTCAGAGGCTTTGCACCCACTCAGGGCATCCCCTTTGGAGACCACCCCGCTCGCCTTC
      CCTTTGGAGGCTCCTTCTTCCGGCCTCTATCTTTCGGAAGGCCGCTCTTTTGATAGCAATCAACGCGGGGAGCGGATTGG
      TGGCCATTCTGAGTACTCCAGTCATCATATTCACTCATCCTCATCTGAAAATCTAAAGCTCAGGTGCATCTATTCATAGA
      TCCTTTGGATTCCTTCATGGGGCGCCGTGCCATTGCACTCAACTTTTGTATGTATGTGTGTGTGTGGATGGGCGCGTGTG
      AAGAGGTTAGTTAGTGGCACTTTAGCGCTAAAGTTTATACATAAATTTGTCATTGGCATTCAGTGCCTTGCATCTACTCC
      TTCTGACCCTGTGCGTCATATGTGCACAAACCTGCACAGGGGAAAAATGTCAGCATAAATGATAATAAGGTCAACCAGGG
      GTAAAGTTATATTTAAATTTACAACAAAATTAAAGGCTGCTCAGAAAATTTGATGAGTTTTAAGATAGTTTTAAAGGAAT
      TTAGATAGTTTTGTAAATATTTTATATTATCTAAACAGATTTATTAAAAATGTACGTATTTTATAAAAACTATTTTCCAT
      ATTTGACATGTCCTCAGATATTATTATTATATTAAAAATGGCATTTTTTCCTTGTGCACACACCTTGGACAAAAATATGT
      CTGGGCCTTTCGTCTTGCAGCTTTTCATGGCTGTGAATGCAGATTGTGTTTTCCTTTGATATTACTTTAGACTTCCTATT
      TGGGGTGGTGCCTTTTAATTAAATCGAAAGACTTCCTTGGAAAGACCCAGCGCACCCGTGTCTGCCACCTTAACAACTCA
      TTTTTCATGCGCGGTGCCACCCTGGTTCGCATAATTTACAAGAAATCTGTTATTGTCTTATTAGGAGCGGAACTCTGCCT
      TGGCGCCATATGGCGTCAGATGCTTGGCAAATTGAGCGATCGACGATGACTTGGCACCTTCCCAAAATCTAAAATACAAA
      ATCCAGAAACCGCATCGCGACACGAACATAAATAAATAATCGAAATGGAAAAGCGTGGCGAATGGTCCACAGCTGTGGCC
      AGGAAAATTCAAGGGCGGGGTGCCGAGCAATTTGCAATGCCCTTGCTCGCCCATTTTTATTGCACAATCAAGTGCTGCAG
      TTGCAAAGAGGGCGCCGCCACGCCCCCTTCACGCATTCGGCCCATACACACCTTTGAACGTTTAATGTGCCGCACTTCAC
      ACCCATCCACTAGAATCTGGAGCTGCTTACACTGAGAACAAAAGGAGGTGTCTTCAATTGCGCACTGAAAATGTTGTTCA
      ACTTGTGTCATAACAAACCTTTTGGATAAACATATTTTTGATATTATTAAGATAGGAAGTGGAATCTAACTTTTTTCAAA
      ATTATTCGAAATATTTTTGAAAGACAAAATTTTAACTCTTAAGTTAAAGAATTTCGATTGAATTGTATAAATTGTTATAA
      GATTACAATGATTTTTTAAACAAGAAATAAGTATTTCATGAATAAATGAAATAGCTATTCTTTTTTTTTATGTGCCAAGG
      AAAATTCACAATTAGACAGTGTGAGGATGATTCGGAGAATGGTTTTCGATGGATGGATCGAAGGGCAGGGCGGTGAGAAT
      GGGATGACTGTGCCTAATGCGCGGTGTGCACTTGAGTTCAGTTTGCTCAAGATCGCCCGATGCTCATCTCATCATCGCTG
      GCCATCGATGTTGGCTGAAAAATAAATTAAGAATTTTAATGCGGAAAAAACAAAAGAGAATAGTCATAGTCATAGAGCGA
      GGAGCCCACAAACCCAAAGACCCACGGCCGAGACACGACTTCATGCTTAATCAAAATGTGTTGTAGGGCAGCGCCTCTCG
      CTCGCCCGACGGATCGCGGATCCTTTGAACTGCCGACAGCCACCGTAATATTTAAACCAGATCAGATGAGATCAGTTCCA
      TTTCCATTCGCCGACTCTGGCCCGTTCTTCGATTCTTCTTTGGAAGTCTCTCCGGGTTTTTGTTCTGGGTAAAATTATCA
      CAGCTCCGCTAATGAAAGGGCAAACGAATGAAATTTTAACGAGCCCACGAAGGAGTCGGAATCGGTGAGTCCTGTGGCAG
      GACCTCCTGGGTTGATTGTCCCTAAAAGGTGATAACGCCGCCATCAGTCCGCCCTGCGAGCCCTCTTCCCAGGATTGCGT
      AACGAATGCGATCAGGAGTTTATGTGCCTTTGTCGATTATTAACGTCTTTTTAGCATTTGGGCCTGGGAAATGTATTCTA
      ATGCATATCCTTTAACTGGTGAAGGGTAGACAAAGGAAAAATCTACAACAAAATCGATAATTTATGGATACCTTCCCGAA
      TCATGCCTTTGAATGCTAAAAAATTACCTACAGATATATATTTAATTAATAATGAAGTAATTGATGATTTTTTTTGCTTA
      TGCAATGCAAAGTTAAATATTAAAGTCAAGGTCAAGGTAATGGCACAAAATGGTTAGTATTTAGGCAAGTTTAATACTTT
      ATTACTTCAGTTAGGATTTCTGCTAAGCGAGTATTCAACATCAAATATAGTCTTCTTAACTATACATTTTGAGCTAAATT
      GGCAAGGATTTGCACATTAGGCAAGTTTGTCATTGATACCAAGCCAAGTAAAACTCATAGTGGATTCCGCACAGGTCTCC
      GCTCCTCATGGAATCCGACTCTTAAAATGAAACTTTGACTATCTAGCCGCATAATGTGAGGTAACCCACACCAGACGACA
      TTAGATGCGGCAACTTCTTTAGCTCATTATCATAGCTTCACGTAGAAGAAGGTTGGATTTCCCGTCATCGCGACATCCAT
      CAGGTTGAGCGCAATCATTACCGACATATGTTACTGGAAGCCCCGTCCTCCGACACACACCACCACCATCCAATGTCAAT
      GTCACACACTGAAAATTATCACACTTGGGATTAGCTGGAAGAGCGTTTAGCATGTAACACCACCAGCTCCAAGAAGGAAA
      ACTTCCGCCCGGCGGCGTAAATCTTAGCCAAACATTTGTCCAACACCTACGCAACAAAGACCCTTGTATGCAGATGTCGC
      CGGCTTGAACATATCTCCTTATACTTGTATTTATTTATAAGCGCGGCCTGTGATAAGGATGCTGCTAGTCCTGATCCCGA
      CAATTTGTTTTACAGCAGATAAGAGGATGCGCGCCGAGGTGTTAGTTCCTTTAGCTTGCGGTTGCTCTGCGGTGTGATAT
      TTAACAGTCCAAAAATGATAAGAATTATTTACATTCTGCTTTTTTTTATGTTGGTTTCGGGTACGTGCTGCTCATGCTTC
      TCGCGGTAATTTTTCTCATTAAAAGTTGCGGCCGCCAGTGGAAATTGTTGTCATTTAAAACATTTTCAGTTTTTTGTTCG
      TTTTTTTTTTTTTTTATTTTTGTGGGTCTCAATGTGTGTGGGGCCGGCGGCAAATAATTACCAGGACGTTTAAGCCACTC
      AGCCGAGCGTTGTGAAAATTCATAATATCCAGCACTCAGACCCCCGACTCTTTGAGGGAATTTTTTCGGTTGCTGAATGG
      CTGTTCCGGGGCACTTGCGGGTGGCATTTTGCGCATAAATCCTTTCATTCCGTTGGGTTCGGGCTCACACTCAGACGAGA
      ATGGAAAAAAAAAATGTATATGAAAACGGTGGAATAATGAGAGAAAGGATGTGTTTGCTCGTGGGTTATTGTTTGGCACA
      CTCATACACAGGGATAGATGGATGGATGGGAGCGTACATAATTAAGCTGTCGAGGATTATTTTGATGTGTCACAGGACGA
      CACCGTCAGGCAGCGGCAGCTGATGATAGCCGGAGGTCCTCGGGGTCCCCTCCAACCTCATTTAAGCCAACTTTTGTTTG
      CTGTGAAGTCCAAACAGCTGAAAATTTGAAACGAAATGAAATTCTTTCGAAATGCGTTTGCCCAAGTTGGCTGGGGAAAC
      TTCTCGCGATCATTTCATGGAATTTAATCATTTGGTGTTTTCATTTGCCGTAGAGGTGTTAGTTGCTAAAGCTACTTTAA
      GACAAGTTCCTAAGGCCATTACCCGAAACGATCTCGAAATCGTAAAGATCGGGCTCAGGCAAAGCTTACCAAATCAATAA
      CAATTTTTCACAACTTCTCTGCTCTTCGCAGCCAAATAACAAATTTCCCCCCTTTGTTGAAGCAAACAATGGAGTTAAAG
      AACGATATTTATGTTGTCGTTTATGTAAAAACCACAAATGGGAAATGGAAAAAGACGAGCGCTTAACATGCGTGTAAATT
      ATAATGCGAATCAAGCAAAGTGACTGAGAATTTGGCCGCTGAGCGTAAATTAAATAATTCCTTTGTTGGCACCCGTGCAC
      CATTTGCATAAGACCCATAAAAGACGAAGTTCTGTCAGCGGGAGCCCTAAAAGAAAACCCCAAAGCAGAGACCCAACCCT
      AGACAGTCGGACGACCTATTGAACCCAACGCGGTCGGATTGAGTGAAAGGCCAGCTCAGGGCTGCTTAAATTTCATTAGC
      TGCAGGAAGGAAAGCCGAGCCCATTGGAAATGCTAATGAAGGAGTGTCTTTGGGTAGCCAATTGCTACCTGGTCGGTCAC
      CTGCCAAATGCAAGCCAACACTTTTGTCACCTTCCGCCGGCCGGCCGACAAAGAGTTTTCCAGCCGGTCAGGATCCAGAT
      CCAAATGCACACGCATCCGTAATGAGTTTGGCCCGGGGCCAAGTCAGTACTACTTTGATTTCGAATTAAATGTTAATAAG
      TTCAACTCTTTGGCACTCTTTACTCGATTGTTTGGCCCTAGGGCATCTTTGGCTTTCCCTCGAGGGCGGAAATGTGGCCA
      CCATTTAAATGCTAATGCAGGCGGGCGGAGGGCACCACTCTGTCTCCGAATGTTACGAGTTTATACTCGTAAAATGGCCT
      AAATTATTCGATTGCCTGAAATGTGCACTCTATAGTTTCCGGCTTTCTAGCGGATGACATAAACCCATATAGATAAGAGC
      TATGACAATCGTCGATATCTTTCTGGACTGCCCAAATATTTGTGGCGCATCTTGGATTTCATTGAAAGTTTCCATTTCAA
      CCTTCTGATTTGTTGCAGCAGTAAAGATCATTTTGGGCTGGGTAAAAAGTCGTTAAATTGAAATCCAATCGGGAGCTTAC
      CAACATAAATCTGACTTCCAAGGAAGTTGAGATACAGTGTTTAACTTTTGTGAAAGGGCCTTATAGGTATTTACTTCAGA
      GAATCTAAATAGTTTATTACGTGCTGGATGAATGACTCATATATTTAAAAAGAATCTTAGGATTACTCATCCTTCGTTAT
      TTGGCTGCTTGAAAACTGTGTGCTTCTTAGAAATGTTGTTGTAAATAAATGGAGACAAATGTTGTCAAACTTTCAAGACA
      ATGCTTAGTAATTAACATTAAATTATAAATTCCTTAGCGCTTAAAGCAGCTTAGAATATAAAATCCCCTTTGCACGTTTA
      AATAATTATAATCTCCTTAGAAATTCCATAGTTCTTAACCTTTCCGAAGAACTACTTAACCTTGGAGCACAGTCTAGGTC
      AACGATTTCCCTTGGTTATGATGGATCTAAGACAGCACCTAACTGTTCTGCATGCCAATCCAAATGGTCTGCAATTTTTT
      TTCACCAAGTCGAGCAGCTAATCACTGTTCTCGGGAGGCGAATCCAACTCCAATTACATTTAAATGCCATGAAATGGTAT
      TTGATTTGGTTTATTTCGTCTTGTTTGTGCGCAACCCATAATTACCAACAATTGTCAGTTGGACGGGTACTTCTCACCGG
      CGATTATATGGGCTAAGGCGATGGGGCAAGTCGATGCGTGCTGGAAAATTATACCCATGCCCCATTAGGGCACCGAAATC
      CAAAGTTTAGACTCGGTTTGGTGGCATTTGAAGGAATTCAAAGTCAAATGACATTTGTCACGCAAGCCATCAACCTTTTT
      TTTTCGTTCAACTCAAATGCAGACGAGGCCGATTAACTTTGATTTGGTATTGAACTTCTTGCATGAAGGAGGGCTTAATT
      ACATGTCCAAGGACCTAAGGATCCTGCCTCGTTGATTTTAATAACTTTTAGCCGGTGCGCAAAAACTCTCAGGCCAAAAG
      CGAAAAGTTCAAAGTTTCTGAGCTGCGTTTTATGCTCGGGCTCAAGGTAAATTTTCATTCTTTTTCATTCATTTCGGCGG
      TTTTAGCTCATTAATCACAGGGCACAAAGAAGCGCCAGGTCTCCAGGATTGGAACTTTCTGAACCAAAAAAAGAAGGCAA
      ATATCGGAGCGCCGGAGGAAGTCGTCGCCAGCATTCAAGTCTAACAAATCAACGTGCAATTTGCTCATTGAACTATGATC
      GCTTCGTCGCCATTGAGAAGTAAAAAATTCAAGTTTCTACTCTTATTTTTTAAGAGCGAGTGTGGGTGGGCGTGGCCAAA
      CTGAATGCCAAACTTGATGACATAAAACTTCTGCTAGTGCTGCGTAAAGTTCGCTTTTGCTTGCAAACTTTTGCGTGATT
      TATAACGCACGCAGGACTCAAGGGAAGAGCGCAGTCGAAGTGAAAAGCCGACTGGGTGTGAGCTACAGAGACACGTTTTC
      AATAAACTTTTCGCCCAGACATATTCATATTTTATGCATAAATTCACACAAACGACATTCGAAATGGCCAAAGAAAGCTG
      CAATTGAAAAGGGAACTTCGCCAAAGCGCCGAGTGTCAGACAATTAGTGATCAAACTGGTCGGTCAGAAGGGCAATTTTA
      CACTGTCTATGAATAAGTGTCGTAGTTTAAAAGTTAGCGAAAGAATTAAGCGGTTATCCAGTCTATTAATTGCACAGTTC
      TTTCTATCAGAAATTATATGAATTCTATTTGAAGAGTTCGCTAACTCACAAGCAAGTCAGCAAAGTTCATATGAGGTCAA
      TGTTTACTACGCATGTTTTTACCCCAGAATCTTATCAACCTTTCCCCATCGCGGTTAAAACCAATTCTGATAGGGGTACA
      ACTTCAAGAAGTCGATATATGGCCAGGGCTAACGGCGCCCTTAATTCGCAGCCACATACACACACACGCCTTAGACAAAC
      AAAAGACCCTTTTTTTTTGTTCCCAGTGCAGGGCTCAAAAATCAGTTTCCACCTGCATCCTTTCGGGGAATATTGAGCGG
      CAACAGTATCTTCAACCTTTTCGGGCAATGAGGCAGGTATAAAACGCGTGCCCCGTCTGCCTTGATTAGCATTTGAAATC
      ATTAGCCGGACTCGGTGCTGGACTGGTTTTTGGGATCTGAGTATACTGGATATACTGAGATACTCAGTTTTGAGCCTGGT
      TTTCATTTGGTTCTGGTTGGCAAGGTGCATTCTGCATTATAGAACCGCAGTCGTGGTCGGCCGACCAACATCATCATCGC
      TCACATCGTGGCATTTATCTGGCAGTGTGCATCTTCTTTTCATTCTGTTCTGTTCTTCGCACTCGGCCGTTTTTGGTTTT
      AGCTGAAAGCCAGCGGCGTCAAATTTGTAAATGCACCTGGATTACCTCGTTTGTTCCTGCCATTGTCTGGCCTTCTTCTT
      TGGGCCCAGACAGTCCAGACAACAGGCCGATATTTGCTTTTTTGATATATGTTTTGTGGGCCTTGGTCTGCTCTCCTCTC
      ACTCGTTGGAAATCCTTTGACATTGCAGCCGTTCGTCGGGGATCATCATCCATCAAAAATGATTGCCGAAAGATGCGTTT
      CTTGTGATTTGAATTTCAGATTCAGGCACTCAATTAGTTTAATTGCACTCCATGCAGCTTGTCCATTTCAGCAGGTGAAA
      CTCTATTTTTTTTTTTTGCAAAGGATATGGGGGGCACTGTTTCTTTGAGTTGTGGGTGCTGTTTGAAGAATAGAAGTGTG
      TAATTAGTAGACCTTTAGAAGTAATTCAATAGGGAAAATGGTTTGCAAAGGTGTGGTTTTTATCCATTTATTATTCGGGT
      TTACAAATAATTCCCGGGCTTTCTATTAATGCGTCTAAATAGCCTGAGAATTATAACTGCACATGTTTTCTATCGTTGGC
      TACCACTTCGATTTTCCAAACTTAATTGGGAAAGCTCATGTTTAGCGGCTGATAGTACAACCTGTTCGGGCTATCATGAA
      TCTCATTAATAATGTCTCCTACCAGTGAAAATTAAACTTTTCGTATCGAGCCGCTTGCTCGTATTTCAATGATAACGTTT
      ATTAAATATTCTCCACCCGAAAAGAACGCCGATAATGTCAATCGGGCACTCAGCTTCATTTGGGGGGCCTATCTACGCGG
      CCTTATCTAAGCCAAAGTTTCTTTTAATTAAAAGCAAACCCAAAAGCAACCCAAAACAAAGCCCCTCGTAGGTCTCTGAG
      GCAATGACCCGCATGTGTCTTGGCCAGCATCCAAACCAAGTTCAAACCAAGTCGAATCCCAGTCCAAACCGAGCTGCCGT
      TGGCAGAGACAAATGCAGCAGTGCACCGACACATTATTCATGCCGTTATCAGCGGAATGGTCGCTGTCTTGGACTCGGAT
      TCGGACTTGGATTCGGATTGGAATTGGAATTGGGAACGCTGCTCTGGATCACGAGAAACACTTGAAAGTGGAGGTGAAAT
      ATGTATGCCACAACGCGGCACAATTCAATACCCATACTTAAAGTATTAAATATTCTGTGGTAAATTAATATCAATTAAGT
      AAGATGTAAGAAAAGCAAATAAAATTAAAGTAAATAAAACAAATAAAAAAGAAAGACAGACGTTATCACTTGTACTTGTA
      CGTGTGAATGAATACATACATTCCTGAACATTTATATTTATTGATATTTTGAAAATAAGTTTATGTTTAAGAAGAATCGA
      TAGTATTTTGGACTAAATAAAATATTAATCCTATAATTGATATTAACTTTTATGTAAACAAATTCGATAAAATCTTTCTT
      GTGGCAACCAACCACATTTTTCTGAGTGCTCTTAGCTTGGCTATTTGCCAGTAGCCGTTTGGCCAGGCTATCAGGCTGAT
      CAGTTCGCTTGGTGGATACATTTTCCAGCTTGCCACCAAGTTGAAATCGTGCGCTATTTTGGCAATTTTAATTACGCCAG
      AGTGGCGGAGGGGCGGGGAAAACACTTTCCCATTCGGCGGAATGCACCTGCACACGTCAGAAACGCAGTTGATAAGGATC
      GGGATCGGGAGGAAATGCCTTCACGCATTGTCCTGGGACTGACCCCATAATTTCCGTAATCGCTTGCGTGTGCTCTGGAC
      CTGCATTAAAACCAGTTTTTAGTTTACCTTTTTTAATAACGGACATCAACTTTGGATTTCGAGGCGTTTCTTATCCTTAA
      AGGTAGCGAGTTCGGGGATCTTTGGCTTACCTGTCGCCTAGCCATCACCATCATCATCATCATCATCGTGATACATTGTT
      CCTTTCTGATCTCGTCCTTGCCTTTCCCCCATCCAAGAAATGTATTAATTAAAGCAAAATATGACTCTCGAACAGGTTCC
      TCAGTTGTAGCGGACCCTACCTAATTGTATCTCTTCGGAAAATTGTTTCACATAATTGCAGTGATTTTTTCTTTCATTGT
      TACAATTTTGCTCATTCTGATGAGTTGCTGTCAACTGGGATCTTCTCGAGTTGATTGCCGAGCTGTTAAGTGCCAGCGAT
      TAGAGGGTCTAGGCGAAGGTCGAAAATTGTGGTTAAGGGTAATGTAGGTTTAATTAATTCCTAAAAATAATAAACAAGCC
      CATCATCGGATTCGGGAGATGTACCTATATCATTGCTTATTAAAGATTGTTTTACTTTTGCTTATAAATTTTAGGCGATT
      TCGTACGATAAACATAAATGTCGCCTAAAAGACTTGAATATTAATTTTGATAATTAAATTTTTATTTAAAAGCATTATAA
      TACTGAAATCCAACAAAGACTTGTTTATTGGGCAATAAATCAAATTTATTTATTTATTATTTAGAATTATTTGTATGAAG
      AAAAGAATGTTAAAATTGTTCCTTGGGGAGCATAATACCTTCCAGCAGCTTCCTTGCAATTTGTCTCGGCCAACTTCCTG
      TGTCATCCCCGTCTTAACCACATAAGTCTTCCGCAAAACATTAGATGCGCTTATTAAAACCGTGACACAATGCTACCGGA
      TATGGGAATCACCCAGTGACGACTACCTGTGATGGAAATCGAACCCCGATCGAATGGCTTGGATATACAATTGCATTCCC
      CAGATGACAGAGCATTCGTTGCTCATTGTTGGCCAATTTCATGACAATTTTTCAGCAGCCATGTCTTCAGGGAATTCTTG
      CGATGCCAGAACACCTAGCTAAGACCAAAAGTCAGAAATTGTGCATTTGTTTCATATTTACTTGGGCGAGGCAGCTGTAC
      AATTGGATTTCCTATCGAAGGACCGACCATCAATGTCATGCATACAATTGTGAGCGACACATTGGGACTCGGGCCAGGAT
      ATGTGTATGCATTGTTGTTGTGTCCTGGCCATTGGAAAATCTTGCGACATATCCGCTTCCTTTCGGGCCAAAGGCAATAT
      TTGTCTTTCGAGTGAGTGACACTTTTGGCCAGGACTCTGTGTCGGTGGAATACAAAGGCTAATCCTTATGTTTACGAGGC
      TATTTACGGGTAGCGCGCCCATGACAATTTTTACAATAACCAAAAGAAAATATTGAATGGGTAGCGGCAAACTGTTTGCT
      TATCTTCCTGCCGAAAGGAAAACTATTTTGGCAAATTGCTTTAGAATAAAATTTAATTGGGGATTACCGGGCATTGCGAG
      CGGGAAACTCCTCTCCTTTTCGCATTCGGTGTCGTTGTCGTTGTATGTGTCTCTGGATCTGGCGCTGTCGCCTCTGTAAT
      GCCCTGTGTTATCCTGGCCTTAAGGCTACTAAGGGGCCTGTCTCACATATTACCCATATTACGTTAAATGGCTTCTCCAG
      CAGCCAACGGCCAAGAGCAGAGTCCAAAGTCTGTAGTCTGCAGCTGGCCGTTTTGGAACATGTGTAATCATCGTACGTGT
      TGGCAATTGACAATTATTATTACGTAGTTTGTTGCCATTAACAGGATGTGCTACTGCTGCTGCTCCGTCTCCTCGTCCTT
      CCTGGTATCCAACTGCCTTGACATTGACCAGCCGGAATTTATAGAGCTTCCTCGCCAACTCGATTGAAACTTGATTGGCG
      TGGCGTAGGTTGTGGCAACAATTTACGCTACGAGCTACAAATTGTCATACAGCATGATGCTCCACAAGCTATTGGGTTAA
      CTATGCGTTTTGAATAGTGATATTATGTTCGACATCTGCAGTCTATAGATTTAATGGCAGTATTACTTTACAAAATAAGT
      AGTAGTTTTACACGTTGCACATTATAATATTATATCATTCAAATGTTCAATACAAATTATTATTTATACTTCTACTAATC
      TACTATATAGTATATTTATATCGAACATTTAAAGTATCTTAGGTATATATTCTCTTAAATTGTAATGGTCATGTTCTTAC
      CAGCCACCTAAATGCTTTTCAGCAACCAGAATTTTTATAAATGTATTCAAGTGTTCCTTACATGGCAACATTAAATTTAA
      TTTAAAGCTGCTTTAAAATCTTCTCACACTGAACTCCACGGCTCCTTCAGATCCTTTGCCGATTGCCAGCTACCGAGAAG
      AAAAAACCCATTTCCTTCCCATGGTATCCTTGCACTAACAAGGATGGCAATTAATCATTGCGTAAAATGTTCAGCACAAA
      GTGCGCAAGTACTTCCGACTAACTGCGATTGATTTTTGCGAGCCAAGAAAAGACGATTTCGGTTCCCACACCTAAGCAGC
      ATCCTGGAAAGCAGCTGCTTTTCATCCTGTGAAAAATTCGCAGTGAAATGAAATTTTAGCAGCGGCAAAAGGCAACAAAA
      AGCAAAATGAAGAACATATCGGGTGGAGGTGGAAAGGGTGCCAGACGCTGCAGTAAACTTCCGGCTGGCCAAAAATGCAA
      CAGGACCTGGTGCAAAAATGCAGGGATCCAGGACTCGCCGACTGGACAGGACAGTGGCGAACAGGTCCGGGGTCCGAGAA
      CCGAGTTGGCTGGTCCTTCTTTTCTGCTTTTGTTTGTTTATTGCCACGCCAGGGCATCCCATACAATGTCCTTCCGGTCA
      TTTATTAACGTCAATGAAATGCTATTGCCTGCCCTCGCTCACTCTTCGCTGCAGTTGAGATTTTACTGCTCTGATTTGCT
      TTGCTTTTTGGTCAGGATGCTCGAGTTGGCAACGATTTGTCGCCGAGTCAACACAACCCAGTCGAAGGTTGCGACGCGTC
      CTTCCCGCTTCTGCTCCTACTCCTGCCTGCATATATCCTTGATGCACTCATAAAGCCAAAATATTGCCAAATAGTAAATT
      TCGCCCTTCGATGGGAGGAGAATCCACTGCAAGTTACGTGTCACTGCACAGAAAGAAATATACAATATTTCTGACGCCTA
      ACTTAATTTAGTTTAACGATACAGTTACGTACAGATTGTAATATTTTTTTCCTGTGTGAGAATTGAGTTTGATAATGCAT
      AAAGTTAAGACTTCTCTGCAGGTAAGCCATCCATCCGACTATTTACCATAATTCTGATTGATTCTCCCGGAGATTTTCAC
      AAAAGTTGTCTCAGCCTCCAGGCGTCCAGCTACCGTCTTACTGGCTTATAGTTTTTCGGACCAGTTCAAGACCCTCATAA
      TTTATATTTAATGATCCGCAGCTAGACTAGCTCTACCTCTAATTGACATTTAAACTGTCTACTCAGCCCGAGTGATATGA
      TAAGCTGATTGATGTGCCCTCTGGATGGACGAACTCTCACAGAAGAGGAATTAAAGGTATTTTATTAATTGATGTTGGCA
      TTGCCGGTACCATTTCTCCCGATGACAACATTTGCTGCAGGTCAGGCATTTATCCAGACAGCAACCCAAAACGCTAAACC
      CGAAAGGCTTTTAATTTCTGTGTTGTTGAAATCATAAATCAAAAGCGGGGATCGCATTCAGGTGGAGTCCGAACGAAGCA
      GACAAGTGGCTTAGGCTCTGCATCTCCGATAGCCGAACGAACATTTTGTATCTGGCGGATCGCCTGGCTAATCGGAGGCA
      CACACACAAAATTGAGTATCTGGTTGCGTTCGCCGAGCATCGGCATAAATTACACAAATTGCATTTCCATGTCCAGAACT
      CTGATGGATCATCGCCCGCGTCGCCATCGCTGGCCATCGCTGCTCATCAGCATAATCGTTAAAATAACAGCGCAATGCAC
      TTCGATGCTCGATGCTCGTGAGTGGCTACCGCGTTTGGTTTCAAGTGGTCCAATCTGCTACCCCATCTGCCCCCCCATCC
      CGACCCATACCGTTTCATCCCATCGCATCCCAGTCGTCCATCCATCCATCCATCTATCCATCGAAGCCAGAAGTCTATGC
      CCCAGAGGGACCAGGCTCAAATGGAATAAAAAACACACACCGAAATGTTTGGGGCGCCGCAGCCGATGGCATCTCGCATC
      CAGTTGGCTTGTTTATTGTGTCGGGGCTGAATTCGGAGGCATGTTTAAACAGCGAAATGAACTTGTGGATAAACACCATT
      ATGGTTATTTGGCATCCACTTTGGGTCGCCGCAACATTCAGCCTTCGATGTTTGTCGCCCTACAGGGTATGCCGACTACC
      CCACTCCACTCCACTCCACTCTGCCCACTGCATCTTTGTGGGATAATCTCAAGGCGATGTCCATGTTTGAGCTTGATTTA
      GTTATTTAATGCGGCATTGACATAAGTGCACTTTGCGACTCAAGACCGCGGCTCAAGATCGGTCTCCCAAGTGATTCCGT
      GGGCGAATCGCAAGGACAAAGATGCACTTCACGACATGGGACTTTGTTCGATGGCATGGTAATTGACGGAAGAACTCCAT
      GACATCCATCAGAAGGAATGAGCATTGAATTTAAATGAGCTTATGTAAGTTCTAAGGTTTGCATTCGTATTAATTGAAAT
      GAGCTTACCTCAGAGTAGAATTAGGGGTAAAAGGGTATGCGTTTATACTCCACTTATGTGGAAATATAGCCGTGTGAAAA
      CTTTTCTATATTTCCAGTCCTTTACTACTATACTATAACCTTTTGTACTCAATTTTCGTAGAAACTTTAAACGATTTACC
      AAGCACGTGGGCTGATATATTATTACCACAATAAAACAACTCACTTTTAAGAATGGGATTATCTATTTAGTACGACCTTC
      GAATGTCACTCAATGAATATATTTATCTGAGAGATATTTCTTAATGGATCCCAGAACTCTGCAGGTTCTGTCCTTTGGAC
      TTTGCTTTACGACTCAATTTGTACTTTATGGGCTGTAATTAAGAATATACAGGAACCAGCTAAGACCTTCAGCTAACCTT
      GAGGATAAGTTAAATGTGTTTATTATCAGCGCACGCCTTGCATTCGCCTTTGGGCTCGATACTGCGCATGCGCGGCGCGT
      GGTTGAGCAAAAAACATTTATTATCCTGCAGGACCTCAATTATGACTCAAGGTTGCTGCGCCCTGTGTGTCCTGATGGCA
      TTGTGCAATTGGGCCTTGACTTGGCCCGAAGGACAGGCAACCCATTCGGAGTGCCGGCTAATTATGCACAAGGTCCTTGG
      CCTTGGGTCCTGGATCGTGGCTAATGGTCTGTGCATCCTTGGACGTTCGCGTGTGTGTCCAGCGCTGACAAAAGTCGCCA
      TTGTTCGACATTAATTGCACTTTTCCAACCGAGTGCGTGTCCTTGCTGGTGGCCCGCCGTCACAGGGATAAGTCAAATTA
      ATGCTCCACTGAAGGACATTGGCCAGGACTTTGTGCATCCTCCGGGAATTGGTGTGAAAACTGACAGCGTTTGTGTGTGT
      GTGTGTGTCCCTTGTCATTTCCTGGAATGTCCTTGAGCCATATCGCTCATATCGCTGTGCAAAAAATAAAGGGACTGAGT
      AACAACAGAGCGCAAAAGGGACGAGTGCCTGCTGCGAGTTTATATTAGATAAAAATTTAATTTCGCCTCGGTTCGTGTGT
      TTTTGTACTTGGGTGCTTAGGACTCAAAGCATGTCCTTGGTGTGAACTGTCAATAACCGAAGTTGGGAGCATAAAATCCG
      ACACACTCTCCCTGGGTTGTTGTAAAAATGCAATTATGATTGTATTATGGTCGCCTTTGTGTTTACTCTAAACACTCGTC
      CTTTGTTCGTTTGTTTGGCATCCTGTACTCCTATATTCCATACCAGGCAAATCTCCCCATTCCAGCACAGCCCGCATCCT
      CGCATACGTTTCTCTATCTGGGCAATCTGGCTGCAGTTTTGCAGTTGTCATCCAACATTCAACGTGCATCCATTCGATAC
      TCAATGCTGGTCGATGGCTAATAAATTATCCACTTATTATCCTTGCCAAGCAAATTTCCTCTTTGTCCAAGGGATTGGCT
      TTGTGTGTGGCTTGTTATCGTGCAAACCTGCATCCTGGATGACTTCTCTGATTGCCCGATTCTAGGTGAGAAAATCACCT
      TTGCTGCGTTTTGAACACGCAATAAATTTGGGGAATCGAAATTTTCTTTTTTTGTCATTTGAATAAATGCCTCTTGTTTA
      AAAAATAGTAGTTTAAGTCAAGCAACCCTAAAATTATCAAGAGGTTAAATTCCAATCTGAATATGCATTGTGTGTTAACG
      TAAAATAAACAGAATGCAGATTCCATAAGCTACAACAAATGCGTCTGTTTATTTATACAGTAAATCTTGACATCCTTTTA
      ATTCCGATCAACTTATCCTTCTGTGCACTCTTTGCCACCCTTCCTTGATTACATCACTACTACACCAATCCTTTTGGTTA
      ACCAGGTTCAATGCAACCACAAATTCGCCGGGAAACACCTACTAACTTGACCTGCACAATGGCGAGTGCGACATCGAGTT
      CCGCATCGAATCAACCCTCTAGGCAAACAAAAAACCTCTATACATCGATAGTGAGACTGGGCAAATATACCAGGATATAT
      CACCGTGGTCACCCCTCAACTGTACACAAAGTGTGCGCAAACAAACTCAACCCCTCGATATCCTGGTACCCCCAACTTCC
      CAACCCCAAACACATAAAACCCCTCTCAACTGCACTTGAATCGGTTGCAACATATGCAGTTGATGTTTTTTACCAGACTG
      CAATATTTTATTATTTCTCTTTTTTGCGCTCTGCTTTGCTTTGTTCCACCCCTCTGGATATAAAAATATCTAAATTATGA
      ACTATGACAAATATTATATTACCAACAGGACGGAAGGGAATACGCCTCCTTCTGGGTGATTAATCATTGTGGTAAATTGT
      CGAAAAAAAAAAAAACCAAAATACCAAGGCCGAAAGAAGAATGACAAAAACGCTGCATTTTGTTGGCCACTTTGTTCAAA
      CTTTTAGACGAAAGCAGTAGAAAATGCTGGCGGGCCATGAACAATTTATTGCCATAAGCCGCTTACGGAATAGTCCTCCT
      ATCGTTGTCACTCCTCTTACCCGTTTTATATCTACTGGATACATAGAGTATTCCCAGATGTCCGTTGAGTAGGCAACTCT
      CGCTGACGTCGACACCGCTCAAAGTGGTCACATTAAGTAAGCTTAGGTCTTAACACTATTTTTTCTTTTCAGACATCTCT
      CTGCACATCGAGGGCTTCTCGTTTAAGTGCTAAAGGGTTAAGGCAATTAAAATTGAAATCACTCGGTCAGATTTACTGTG
      ATTTGTTGACTGCAGTTAATTGCTGATTAAATGGACTTAGTCGCACTCAACTGCTCGCAATGGATCGGTTTTGAGTGGAG
      ATTTTGCGGAGTGTTTGATTTTAAGTGGGTTGTGATGATACTAAGCCCTTATAAGTGAGTTAAGTAAGTCAACATGAGTA
      AAACATAGGTGTTTGTATTATTATTTTTGTGCTTGGTTTGAACGAATAACTTGTGATGTTAAACAAGCACTATATTTGCA
      TAGCACATTGTTTGAAACCCGACCCATTTCACATTAGTTTACCAGGTTATTGCTACCCACTAAGACTCTAATCTCTTTGA
      AGCCGATCCAATTTATGAACAGGAAATGCTGGACAAATCGAAATGGAGCTGGCTCATTTAACGCAACTGGCCAGCTGACA
      TTGCAGGACAGTCCACCCTCATAAGGTAGCTTGATAATGATCTGTTATTGGGAAATTCCTATAACAGAAATAATTGCAAA
      TGCTCAAAAGTTGACGGGATCAATGCGTTTCGTACTTTATGCACTTGAAAACGAAAGCAAACTGGACTTTTCACTCTATG
      CGGGAAACAAAAAGGATACAATTGTCGATGGCGAGTGGAAAATTATTAAAGTGCATCCGAACATAAATCTAGTGTGACGC
      ATGCGTTGAGGGAAATGGGTTTTCCATAACTGCGCAACGGCAGCTGCCACTGTTTGGCACACCCTAGTGAAAATACCGAA
      TGGATGGGGTGGAGAAAACCACCCTGATCCCAGCTTAGGGTTATGGTAAGCACCCCAGCATCATCATTATCATCATGATC
      GAACGCAAATGTGTTAATTCTCTCCCTTGCAGAGACTCTCTTCCCCTTCTACAGCTCTTATCAATCTGCCACTCGACTCT
      GAGCTGTATGCCACATTTGTTCACCACATGCCAGCCAGAGAAAGAGCTGTCCTTCCCTTCCTCCCCGTTGCAACTTGTAA
      TTTATGCCCCGAAAGCATCCATTATGAAAACATCAACACACATTGTGCAAATCAAGCAATTATCGCAGGAAATATTCTAC
      ATAATTATCAGGCGTTAGAGGATTTCCATAGTTGCCATATCTTCCCTACAGGACATTGGGTTATAGGAAAAAGGCACGCG
      ATGGGCTTAGTTTGGTATATGAAATTTTAATTCTAATGGAGGGAAACTGCGTGTGCTTAAATCCATTACAGACCACTTAG
      GCACTTTTAAGCATTATTCCAATCAAAATGAGATAATCAGAAGTCAAGCTGTGAGCAAATGTAGTAGCTGGAAAATTAAA
      GAGGAGGGCTATATTCAATCTCATTTCATATAGTTTATTTACAGAGTACCCAATATAGATCTACAAATTATTAAAGAATT
      CTAGAGTCAAGTGAAACTTGTTGGTCAAATTGCCTTAGAAACTTTTTCAAATTACATTTTTTTGGGCCAATTCACAATTT
      GAGAATTCCATTTCTTGGAATGTCAATTTGCTCATTCGAATGCCCAAAAAGGTGTGATTAATGGCCCCGAAAAAGCGAAT
      AAAAATGAGCAAGAAATTTCCGTTTGATGTTCCACAGACGTCGGCGGTCAAATGTCACAAAACCTACGCCAGAAAGTGCA
      GAGTAAACAAAGCTGGGAACATTTCTCTTTAGGGGCATTCAATTTGGCACCGACAGGAGCTGGCTTTTGTGTATGCAAAA
      TACATGACAGTTAAATGAAAAGAAAATAACATTTTCCCAGCACACAAGCACACACATTGCACATGAATGAGAGCGAATCC
      TGTGCTGATTTTGACAACTTAAGTGTGGAGGAGTCGGAGGTCTGAAACTCGAGGAGTTCCAGCCACAGATCTCAAGGCAC
      ACGAAACGTGGCCACATTTTTCGTTGGGACTCGTTTGCTTTCCGTTTTTGTGTTTTTGTGTGTTGTGTGTTTTTCTGTCT
      GTTTATTTAGATTTCGTGCCTGGCAATTGGCTTTGGCCACCCGAGGGTTATCCTTTGCGGATCAAAGTTGAAATTTATAC
      ATACAAATGTCACACCTCTCCAGGATTATGTATAACAAAGCAGCAGCGGAAAAAAGGAGACCGAAAACAAAAAACAAAGC
      AAATTTCTGCATACTTCGGCATTGACTTTGGTCGGGATATGTGTCATATCCACACCGCCAGCATCCGCATCCCCAAAAAC
      AAATTGTTAAAAAGATTATGTCATGCCGAAGGAAAAATAAAGGAAGAAAACGAGAGGAAAATCTTGTTTTCTTTTTGCGC
      TCTCTGCCATCCTTTCATTGTTGCCGCCTCTTCCTGGTCGGGGAGGGATCCCCTATTTTGTTTGGCAACTGCTTTCAATG
      CCATGTTCCTCGGCATGTTTTGGCTTTGGCTTGTTGCGAGTTGCTTGTGGTGAATATTACGACATGTAACATTTTATGTG
      CTCCATCCCCACGCCCCCGCGTGGAGCTCCCATCTAAAAAAAGTGGGCTCCACCGCAAACTTCATGCCCGGAAAAAAATG
      TGACAACCATACAAGAGGAGCTATCCACAACAACTAATCATACTTCACTCTTTAAGCGTATTTTAATACATAAATGAAAG
      ATTGAAATCACTATCTGTTGTTTGTTCATAGTTGTTTAATTACATCTTCAACCAGAGCTCCTCTTACACCCAAATTTTTA
      TTTTTTACACGGACATGTGTTCACAAATTGAAATAAGTAATACAACAAATCGACTACACGTTTTGATCGGCATTATCCTT
      GCTAGGATCCTTATTTCCGTTCGAGGGCGAGATTGATAGGACCTTGATCTTAGTTTCACGACTCTTTTCGTACTCGGACT
      CAATTTTCTTTGAGAGATGATAGAATGTTAAATTAATTATAAAATTGATTTTTTGTTAGATAGCTATGTGACTAGGAATA
      GTTTAAATTTCGAAAAACTTGTAACATTTTACTAAGCTCTCCGCTGTACTTACAATAATCTCGCTATCAGCCCACTTTAC
      AATCGCTGGAAGAAGCCTAATCACAGCAAATGTGGTCAGGATACCGATGGTGATTCCACTGCTGTAGTAGCCATCTTCCA
      TGATGCCCAAGGATAGGCCGCTGTGCTCGTGCTTAATGGCGCAACAGTCTCCGGAACAGATATATGCCAACAGGCCGACG
      CCCATGGGTCCTTTAACCCAATTGTCGGACGGGAAACCCGGGCGAACCTTTCCGGGACTTCCATGCCCAGGGAGCCTACT
      TAGTCCTTGGGCGGAATGGGTGGTAGCCGAACGAGATGTGGCCACAGTCAAAGGACGTAAGGCTATCAAAGAAGGAAAAA
      TAAATTATTATTATTAAGTAGTAATAGTATTTAGGCACTTTGACCTATTCTATTATTCACCTAATCTCGAGAACATTCTA
      AAGAAAGTTGTATTGAATTTTTGTTTAATTAACTGCCGTAAAATGGTAAGTATATGGATTAAGGATGAATTGAATGATAG
      TAATTTTGCAAGTGAAAGTTTAGAAAAGTGACAGAAAATGCGAGAGTAACTCTCTTAAATCAAGAAATATATATTAAGTT
      ATTTGTCGCATTTCAGTTTTTAGTTACTATAGCAAATTAATATTTTCCTTTAATTAGCGCAGGCCTTTGTCGTCGACGTT
      TTCCATGCCAAACTAAACATCAACTTGCAGAAAGAAACTGGCCTAGATTTTGATTCAAAAGGACCAAGACTAAGCCCGAA
      AGATATCCCAAGGATACACATCTCCGTACAATGAGAGAGGGTGGCGAAATTTTGTCGCTAAGCAAACGGGAAGAAAATAG
      AAGTATCCCCGGTACTATGGCTAATTATGTGTATTTTAAGTTTTTGGCCAGCTCACTAGATGGAATAAACGGGCAGAAGA
      GGAACTGGAACTGGAATGGGCCCACTTCGCACACAATGCGACAACGTCGGCGATGAGTTGCATAATTAAAAACTTTACAT
      TCTTCTATTTAAGTTGCCGTGCGTAAAGAAAAGATACAAAATTATGTACCCCACTCGCTACATTTTCCGCCGATTCCATT
      TTCCTTTTTGCTAAGCAAATAATTGAGAGCGAGACTGGGGGTGGTGAAAAGTTGGCTTAGAGGGAAAACATCTTTAAGTT
      GGCCAAGGCAAATAATGGCGAACGGAGGCTGGGCGGAGGCCACAAAGGACCTTTTAACGCTGCTGCAGAGCACAAATGCA
      GGAAACAGGATATTGGATCATTTAGCATTAAGGCGGCGTCGCCTACCGACCCAGTCACACCCCTAATATTCCACCGCCCT
      CTTTGTCCTGTTTCAATGCGAAACAAGTTAAGCGCAGCGCGAACAATAAAAAGGGAGCAGGATTCAGGGATCCAAGGACT
      CGAGGAGCAGGAGCAGGAGCAGAAGCAAAGGCATTGGCAAAGGACACGGACGGAACGCGTTACGCTTTAATAACTTGCCG
      CAGGATTAAGTCCTGTGCAATGAGATGATAATGCGCCGTGGCTTTCGCAGCGGGGATTCCCCATTCTTCCCTTTGTAGGC
      GCCGTGTTTGCGGCTTGTGACTCTCTGAGGATAATGTTGATTATGCTTGGGCGTATCATAAAAGTGTAGCCATCACCCAA
      TCTTTGTGGCCGCCCCCTTCCTGCAAACCATCGAGCCAAACAAATTATATTACAAAATGATTTTCCCGCCACCCATCACT
      TCCGCGTTGCATATTAGGATCCCACCAGTGCCTTCCTCCTGACATGGTTATCTGGCTTCATCCAGGGCTTGGCATGGGCC
      CAAATTTATTGGCCAATAATGACGATGGAAGAATTTGCGATGGGGAATTTGGGGACATACGTGATTTTTATTTGACTTGT
      AACAATTTGATTCATTCAACGTTTATATTTTTTTTGATTTTGTTTCTTTCGGTTAAAAACATTGGTAATAGTACGACCTC
      GATTTAATACTATCATCGAAGATCGTTAGAAACCACTAATGTGGATGCAATTAACCTACATAGTTAGGTTTCCTTCAGTT
      TTCAGATTATCCGTTGGCTGAGCACAATACGTATGATTTCATCAAGAATAGGAATTAACGACTTTATTGCACATTTTGCC
      CAAATTTTGAATTTCGCTCTCTATAAGATCACCGGGCTTCAAAAAGCACGACGGATGACGAAATGCACCCGATCCGGCGG
      GTGTTCCCGTTAGTATAATGTCGCCCGGACAGAGAGTTAAATATTGGGATAGGCGGTGAATAAGGAAGTCGATCTTGAAT
      ATCATATTACGGGTATTGCCCGTCTGGCGCTCCTCGCCATTGATGATTGTCTTAATCCACAGATTGTTTAAGTCTGGCAC
      ATGGCACCTGTGCACAATTGTAGGTCCCAGTGGGAGGAAAGTATCCATTGAGTGACCGCCCAGCGGAACATTCCAGTCCC
      TTGCCACGATGTCCTGGACCACCATGAATCCAAATACGTGATTCAGAGCCTCTTTGGGCGAAACTTCACGGCATCTTTTG
      CCCATAACCACGGCCAACTGGCAGCCATAGTCAATGTGTTTGGCCGAACTATGCGCCCGTATGTTGTCCAGAGCTCCGGT
      TATCGAGGAGGCGAACTTGACGTGAAAACTCGGCTCCCTCGGAATCGAGATGTGCTGCTCATCACAGTTATCCACATAGT
      TGCAGTCCACGCCAATGATCTTACTGGGGGAATCGATGGGTGGCAGCAGGCGGAGATCCACGGCCTCCACATCCTCGATC
      TTCATGAATTGCACACTGTCCAGCAGGCTAACCATGCAGTATCTCTGCTGGATGAAGTCCATCATATTGGGGGCGGCGCA
      GGTCATGCTCGATAGCTCCGCCATCTTGCTGCCATCCTCGGAGACCATGCCCAATCGCTTCACCTGCTCATTGGCGCGCC
      GGTACTGCATGAATCTGCACTTGGGCAGCACCTGTTCACTTGTTTTGATGGCCACCAGTGCGGCGGATGGGTGATTCGTC
      TGGAGCTGACGGAATATGTGGTTCTGGAGATGCTTCTCTGGACGTGGGAGACACCACTTGGGAATGAAGTTGCGAAGGAG
      GTGCATAAAGGCAGGCATCTTTTCATCTGTCTTGACAATTCAGTTATTGGAGTAATTTTGAGAAGCGTTTTCAGAAAATT
      TAGCACGTTCCTCAAATTAAATATAAAATTGCAACCTTAAGAACTTAAAAAAGAAAACATTAAGTGTACGAGGTGGCTTG
      ATGAATTATTACTAAACAATGAAGTTTTTCGTAATTGTAAGGCAGCCTACTGGATATATAAAATTTGTATCTTAAAAGTA
      ATATATTATTTACTACTTTACACATGTAAGGGGCATTATAAAATTGTATCTTATGATAGTGAGTGTTAGAATAATGTGTC
      TCCTTAAATGCTAAATGGTATATAGAAAATAAAAGTCGAATACACAACGATGTCAATTTCAAACGACACATCCTTAATGT
      GCGAGGACCCCAACTTCAAATGTCATCAACGCATCATGAAAATAATAAACATACATGTTCGCATTTTACCCTGGGCTTTT
      GTTTCTGGATTCGTGTGAGCTTATTATTTCTTTTATTTACATAATGTATCCATCCAGGCCTCGTTTTCCTCTTGTGTGCA
      ATTTACATAACACGCTAACAAATTTCCCAGTGCTGATCATCTTGGGGGCGTCGGGGGCGTGGTTTATGTCTGTGTACTTT
      GTCTTATTTGTTTTTATACGCCAAACATTTGGCGGCTTTTATGCGAGGAGAAGGTCATGAGGTTTGATTGGCCTGGTGTT
      CAGATCGGGGTGTTCATGGCTCCGTTTGATGGGCAAACCATAAAATTAGTTGAGGGGCGGAAGGCATTATTCTTTGGGGC
      CAGAAAATGGGGGAAAGATGTGTTTATTAATGGCTTAAGGGCTTATTGGGGGGACTTCTTGTCTTGTGTGGCGCCAGATC
      AAAACTTTTTTGAAATGGAGTTAAAAGGTAGACAGAGAACGAGACAAATGAAAGCATCCTGTTTTAAGTCAAAGAATGGC
      TTACTAGAAATGTGTATACTCTGTAAGAAACAGAAAATTCTTTACAATTTCCCAAGATCTAGATATTAGTATTATTGGTT
      GACCAAAATCTTTCGCAATTCTTACCTCATCTCCGATCTAGATCGGCAAATATTGGGCCTAAATGGAAAATTCTATTTAA
      ATAAATACTTATCGGGTGTGTGTTTTCCTTTCTCGGCTTTAATAATGCCATCACATCGGTAAGCGAAAACAAAAACAGGA
      TTTATCTGTTGTGCCTGGCAATTGGATTAGGTCAGGAGTACTTTCATCAGGGGTGGATGCCGCACGCTCCACTGAATTCA
      GTTGTCCGGATTGAAGCCGCAACTGCAACTGCGAGTGGAACTGGGATGGCAGTGTAACCTTGAGAGAATTCAGCCAGGAT
      GCATGCGCCAATTGTCCTGGTCTATCTCGTCTATCGAGGCTAGTATCTCCATCTGTATCGCTTACATGTCTACTTGACAA
      GGTCCTTGTTGGCTTGTTCAGTTGGTTTCTCTCTCTCTATGAGTGTGTGTGTACGAGTTTGATTATTTGCCAGGATAACA
      TCAACACACTGAGTTGAGGTTTACAGCTGCCCGGGACAATGATTGTGGTTGTGCCTGCGCCTTGATCCTTGTTTTCATTG
      CGTTTTGATTGGATTTTTGTACGGCCTTCTGTTGCCTCAATTAAGCCACATTCGTGCCGCTATCCCTATCCACCTTCCAT
      TTCGCTGCTCTCGGCTTGTTTTGATATTTTATTGCTGTCGCAATGTTTGTTTATTTTTGACGCCGCCATCAAACTGCAGT
      GCGGCATGACCACCTCCTCCTCATCGTCCTCCTTCTTGATCCCCACCCCCATTTTTTTTTGGGGGTGGACCTTTTGTGCG
      GCTGTCAATATGTCAATTTTCCTGCCACTCTGGCTGCTGCTCCTTTTCATGATTTCTATGACACAAATTAAGTTCGCATT
      GTCGTCGTGAGTTTTTCGTTTCGCATTCATGTTCTGCCTCGATTTGATTTCATTTTGATGTACATTCGTTCGCCATTTCC
      TTCGATATTCGATTTATATATTTTTATTTTCGTCCGATCGGTGGTGGATATTCGTGGTTCAGCATTCGGTGCGATTGCGG
      CAACATTATATTTTTATTAAATGCAATCAGCAATTTTCGTCCTTTTGTGTCCTTTTGATGGCCTCACAGCTTGATTAGAA
      TTGTTTAGGCAATTAAACTCATATGCTTGATTTTCGTTTCCGATTTTTCTGTAATTTCCGAAGGGTTTTTCTTTTTTGCT
      GATTGCTTTGTGCGGGCTCTATATATTCGATTATGGGGGTACAGTTTTTCGAACAAAACGAATATAATAATAAACGTACC
      TATATTCCGTGGTAAATATATTCAGCTTAGAATAAAAATTAAATGCTTACATTTTTTGTGCAGTATTTTAAATTATTTCC
      CTTTTGCTTAATTATAAATACTAAGAGCATATCATATAAAAAGCGTCAATAAAAGTTCTGGCTTAAGTATTAGATTATTA
      ATTCCATAAAAATGTACACTTTGTTATAACAAAAAAATAACTAAAGCCAGCTGCTCTTAACCAACATAAAAATCATTTTT
      TTATAAACATATATATGCTATTATAAGAGTTTTTTTTATCTGTGCAGTGGTAAAAAATGGTCCATCCCATAGTTATATTC
      GTAAGCCAAGCGTTTTAGATTTCTGATGCAGATTGGCTGAATTCGGTAAATGGAACCACCAAACTCAACCATCCCTACTT
      ATATTAGTTTCACTAGATTTTTATAGGCGCCGAGTTTAGCATCAGATGTGTTTTCTTTTTTTTGCACCAAAGGCCTGGCA
      AATTTGCAAATTGAAAGCATTTAATTGCAAATTGTATTATTTTTTGGAGCGATGAGCTGGCAAACAAAAACCACCAACGA
      GCGGGTGCATTAAAATCAAGGAGGATTCGGCAGATTGGCGCGACTTAAACCGCTGCAGCGGTCCGATCATAAATCCTTGA
      GAGCATTGGGAGCTATGTGGTTTTCCTGAGGATTGAGGATGCAATCGAGCGGCGGGGGAAACTGGCCACAATTTCCGTTT
      TCCGGTTGCAGCAAAAGCAGCAGCGCCTGCAGCTCAGATTCACTTTTTGCGCGCAGCCAGCAAATGCAACAACAAGGCGA
      AACATTTTGCGGTTTCTGGGGCGCATATCCCCCTTTTATAGCCCTCTCTCCAGAAGACCCCATACCAACATCGCCATCGA
      GCTACCACAACGCATGCATAAATTATTATTTCCTCGACTTGCCTGCCACTTGCTGCCAAATGTTGCTGCAACATTTCTTG
      CTGGCCGCGCTCACTCGTTGCAGCGTTTTGCATATGACCCTCGAGGAAGTTGGGTATGTGGAGTATGTGATTGCAGTGAC
      AAGATAATCAGAAGTTGGAATAACACGTAGTTATTATAAATAATTACAAAAATATCTGAGCAGTAGGATTTAAATATATA
      AACAGCTATCTTCAAACAAATAAAGGTGTACCACAAACAGAAAAATGCTAAATAAATAATTTGCAATACTTTTATTTATT
      AAATATCATAATATATATTCTCAAGAGAGTAACTCCACTTCGAATACTTGTAGTCGAAAAACTTTATCTCTGTCCGATTC
      ACTCGTCCTGTAGTCCCCGTTCTGCGTTTTCTCATCGGTACGTCATTGCTTCGCCTGCGAATGACATTTGGAAGTGGTTT
      GGTTGTCCCAGTTACCGCCCCCTTACCCTGCCACCCACCAGCGCCCCTTTTAGCACTGCAAGTGCCACGCCCACGCTGGC
      AACCCTTGGGTGTGTGCGAGGGTATAAAAAAAGATGAACACAAACATATTTGAGCGCTTTTGTTTTGCATTTTTATTACA
      CACACACTCTGACTCACATAAACAAAAATTCGTTTTGTGGTTTTTATCACGCACAGACAACAGAGCAACTTCCTCCACAA
      CAGATCCCTCCTGACCAAACTACATATATACCATCCTACCCTTACTCAACCAACCCATCGAGCAAACTGCTTTAATTGGA
      GTCGATGGTGTTATTTATATAAATGTTCGCCATTTCTCTTCGTTCGCCCAGTTTGCATTTCATTTTTTTGGCAGTTTAAA
      TTGTAGGCGTCATGTGATATATTGGCCATCGGTCCTCGGGCTTGGGCTTTTGGCCCTGGATTCCCGAACTCGAGTACCCG
      CTCCTCTGCTGACCTTGTTCTGCATGTTCTTTTCCCTTTTTAATGCTTTTTGTTGTTTGGCCGAAAGTGCTTTATGTGAT
      GTTTAAAGTTGAAAATATGGCTGGCAGGACATTAAAGTGTGTTTACGATGTGGTGACCCATATAAGTGCGATGTTCTTAT
      CCCAGCAGCTTGCAGACTTTGGATGTTGAGTGCTTATATACTGAGAGAAAAAGCCTACATAAAAGAGTTAATTTGAATAT
      AATTCTCTAACACAATTATGCGTGCATAGTAAGCAAAGTAAATATTTTTCTTATATAAGGAAAAAATAATATTTAAAAAT
      GGTCTTTATTTTTCTTACGCATTCTTAACATTTTTTCAATGATAAATGAAACGCTATCTTAACAAAAAACGACCAATTTA
      TCTCATTCGGCGTGTTAGATAATCCACCACCTGTCCGGGCATAACCAATTCTAGTTTCCTTCCTCCAGTCGCGAGTCCTT
      CAGCGGATTGCCTGCAATGACCTCCAAGGAGGCTGGCTCAATGTCAAGGGTACCTGGAGCAGACGTCTCCCATGTGCTCC
      TGGACCCATTAGCTCAGCTCCCTTGAATGAAAAACGCAGGAGAAGGCAGCCATAAAACCGTGAAATCACATACAAAGTGC
      ATTTAACGCGCCACATCAAAAAAAAAAAAAAATAAAAACATGTAGAAGAAAGGCGACCAGAGGAAAAAACATTTTGGTTT
      TAATTAAAGAATAGAAACGAATGAGAGCGAAGTGTGTGGGGAACATATTTTAATTTAATGTTAGCTGGAGACCCAGTAAG
      TACTTCCGTTTACAGCTAGACGTGCCACACACACATGTGTGTGTGTGTGGGCCTCCAATGTCATTGCCACAAACAACGGC
      AACAAATTCTCGACTCAATTTCAGAAAATGATTTAACGACTCCGTTTGGGCATGAAATTGCAAGGAAGTGCCGAGAGTAC
      ATGATGCTCCCCCGGTCCCAAGTCCTTAGGCTTATTTCGGGACGAGTGATTTAAATGGGGAGCTACAAAATAAAAAAAAA
      ACCAAAAGAAAAGAAGAAAATTAAGCGAATGTCCTGGAACAAAAGCCATTCAGCAGCGGCAGGAACTTTATCACTAAGTG
      GGAAAATCTGTTGGATTTTTTCAGTGCTGCATATATGGAAGTTGGTGTGGTAAAAAGGAAGACTCTGCTCTATTGTCCTG
      CGACAAACTCCCCTGGTTTCAAGTTCGTGTTGTCTAGGGACGACCCGTTTTTCGCTTTGTATACCGCTTTGTTTTGCTGT
      TTTCAAGGTGTGCTAAGGAGGCGTAAGCACCAAACATTTTCATTTACTTTGCGTTTTTAATCACGGTTAAAGGATATGTC
      AGACAACCAACCGCTCGTTATTATATAGACGAGCTGGCTCTGGCCCTGTCGGTCCTGCCGTCTGGCAGGATGTCAACGCA
      AATTCAAGTGAAATGATGCACAAGACAGTGGCAGCAAAGCGAAAACGATGAGGAAATAGGAAAGAGGACAACGGCAGCAA
      AATAAAGGATTGCTACCGGATGAATGCACTTCATTTGAAGTAGAAGAAAAGGAATGCAGACCTCATTGTTAGTCAGTGCT
      ACGAGGAATACAAGGATATCCCAGGAGCGTTCACCGAGGGCAGCGCCCAAGTCAAGCCCAAAAGGATTAGAACGAGGGGT
      GTGCGCTGCAGTTGATTTTTCGCATCCATCTTCGATGATCATGTTTTGGCATATTTGTGGCTGTGACTCAAAGGGCCGGG
      ATATAATCACCTTCTCAGGGAGTGAAGTTTCCGCGAAACGTCTGGCTTTGGAATTTAAGGTGTATTTACAAAGTCACAGA
      GTAGGAAATGGTTGGATTTAGCATGAAATCGGCTAGAAGGTCTTTATGAATATTTTATTATCGAACATCAATATTTCAAT
      GATTTATTATTTTTAATTGCTACATTTCTTACACATGCTTTCTTAAAGATTTGATTGATTTGAATTTTACTTAGCTAGGA
      TACCATAACTCAAATCAGTATTTATATATTATATGATTTGACAAGGTCAGATATCTTAGATCTCTAACTCTATACCACCC
      ATCTTTCAGGGAAGGCAAATTTACCCACATCTTTCGACTGCTTAAATAAGACATCAAAATCATATTGAACATCTTTAGAT
      AGATCACCTTAGATAGAAACAGTCTTTTGTTCCTCTCGATACTGATCGTTCAAATGAAAAAGGATGGAAAAGGATTAAGC
      GGCTTAGGGGTGTGTGCCCGTATGCATGATCCTGATGATGTTTTGTCATATCTAGCGACTGGCAGTCAAAGGTTAGCCAA
      ACGAAGAACAATGCCCAGAATATTCGGTGGAAAACCACAAATAGCGGTACCCTAACATTTTTCGGCTTCCAGCTGTTTTC
      CACGGCGGTGATGAAGTTGTTCGCTTGCCTTTAAGAACTTTTTGAAGAAGCCGCTGCTGCAGAGTCATTAATTTCGAGCT
      GGCAGGAGTGAACTTTCAACAACTTGTTGTCGCCGCTGGTCAGGGTCGCACCTATGAGCTCACTTCGTTTCTATGCCCAG
      AGAAGTAACATTTTTGCCCCCATCCCCATGCATTTATATCTAATTAAAACAGGTGTTTTAATTATTGCCGCAATTTAATT
      TCCGTCAGTGTTCGCAAGTCCATGTTGTACTTTTTCCGAACGTTTGTTTTTCCTGCGCCTCATAAATGCCCCGGCCACTT
      GGCACATTTTACGAGCTAGAAGAACCATTAAAAACTGTTGCACTTTCCTCACCCAAGTTGCTCATTAGGAGCATTTCCAG
      CCATGCCGTGCTCTAGATATGATTAATTTTGTTTTCCGTTTATTAGACTCGTAAAAATGGCCACAGAGGTGGAGAGCCTA
      CCGCTGTTTATTACTTTGCTTAACAGTTCCTACAGAAATTATCTAAAAGAACTTTTTTCTTTCTATTGTGTTAATTAGAA
      GATGAAATGCTTTTTAAAATAATGGTGTTTTTCCTAGAAACATTTAAAGCTAATAGAAAAGGTAAGTTTTTGAATGTTAT
      TATTGTTTTTAACATTTTGTAAACGTTAAAGATTAGTGAACGTTAAGTTGCTTGATTTTCTTCATTAATAAAATATCCTT
      ACTCATCTGAACTTTATTGGGAAATTAAATTTGTGAACCCATTTAATAATTACATTCCATTATATCACCTTTCCTGTTGA
      CATAACCATCTCAACCCGAACTTCCCCTCGCATCGAACCCTTTTCCTTTTCCTAACCCATTATTATCGTTATGGAAATAA
      ACTTTTTGTAGAGCAGAAAATTCCACACGTAATTACATTGTCAGGGGGAGGTGTGCGAGAGTTCAATCAGTTGTTATTTT
      TTCTGGTCCTAATCAATTTTTGAACACATAACAGACGAAAAACCAACACTTTACCATAGCATTTCATACTTAATCAGGTA
      ATAATAACATAAATTAAATAAACAACGGATGGGATCGAGAGAAAGAACTTTTATTTTCCCAAAGATGAAAGGGGGGAATC
      GATGGCGATGACGATGTGTGTTAAATTTCACGCGTTACATTTAAAGCATCCCAACAAGTCTCACAATAACAAAAACACCA
      GCTGCTGACTGCCACAGACCGGGACCGGACCAGACCATACCAAGACCATACCCAAACCGATCCAAGATATCCAGAATATT
      GCAAGTTCATTATACAAACACCAATCAAACATCGATGGGTGATAGGGGCGCTGAGGGGCAGTTGTTGGAGCAGGTATGAA
      AATCCAATTAAAGCCGTCAGGCAAATCGGGCCGCAACAGTTGTTGAAGGGAAAACTGCAACCTCACCGCACACACTTCTT
      ACTCAATTAGAACAGAAAATTCGAAGGAAATGTGTGCTATGGTCTCCCTCGATGTATGTGTGCGCCAACAAAAATAAATA
      CGGAATCGGGCGAAAACGTAGGCAGGTCCAACGGCCACGATTTTGCCCATAATTTTGACTCCGACTCCAAAACTCTGACT
      TTGACTCTGCGGCCGACTCCTGCCATGTCGATTTTTCCTCCTAAAAGGCTTGAGTTGATTTTCAAGTGGCCCGGCAACTG
      TGGCACTTGAAATGTTGTTTCTTTCCCTCTTCTTGGCATTCTTCACCTGTCAAGGTGAGGCAGTAGTTGGACGCTCTCGG
      ACTCCGGGACTCTGGAACCGACTGTGACTTATACTCCGACTCGGAATACGAAGTGCAATAAGAACGTCTAAAACCTCACA
      CTTCAAAACTTTTGCCGAAACATCAAAGTTGACGTACACAATGGCCATTGATGTGATACAACTCGAGTGCAAAGAAAACA
      AAACACGAAACCCTAGTAGTCTTCTTGGTCTTGTGCCCAGAGCTTCAGCATCTGGAAGAGGAAGTGGGAGCAGGCACTCA
      CAGACAATCGCCGACACAGAGCCGTCCAGAATCCGGAGTCGGTCTGTCGACGTCGTCGTCGTCTTCGTTGGCGGTGGCTT
      CAATGTTGTGTCGTCAGCCTCAACAAGCGTAAAATATTCTCAGAATTGCAACAACTTTGGCTCCGGCTGCAGCAACAGCC
      TTTTGGCAAAATTTCGAAGGCAACAGGAGCGCTATGTCTGTAACGCTCAAGCATATGTGCCCCACGTTGGGCGCCAGTTG
      TTAGAAATTAGCATTTGAAGCTTAAATACCTAATAATTAGGAAAATCCTTACCATAAATACTTCATTTAAGACCATTTTA
      AATTTGGCATAAACCATGTCTGCAAAATAAGTTAATAGAATGTACCCAAATGTTTTAGTTTGTTTATCGTGGAACCCCAA
      GTAGATCTGCTCATCTCCCTTTCCCAAATTTGTAGTCATGGCTTACTCGTATCGTCGACCCCATTCCCACATTAGCCGCT
      ACCGTTTCATTACCGAAAATCTTCTCTTCCCGCATTAGAACAACAATCGATGGACGACAGCCACATCGACAATATGGCCA
      GCTATGCATAGCACGATGTACACCCGTTCCCCCTGATTACCAGTTTCTAAGCAGAGCTTCTACTACTGCACCATCTCCAT
      CTGAGCACTTAACATTTTCGGGCTTCGGTTGCATGTTCCGTCGTGTGCTGAATGTTGCATAAATAAAGCGCAGATCACAC
      GCAAACAAAGCTGCAGCAGAAACCGTAGCAACACAGTAGAACCACCACAACGGACAGTGACACGGACACGGACAACATCA
      AAGTGTTGACTTGACATTTTGAACGACATTTTAACCTGTTTAGCAGCAGCGTCCGAGCCGAGTCCACAGCCTTAGCCCAG
      AGTTAGAGCCGAAAAGCAAACCAAACAAGCGTGGCCAAAGCCAAGTCAGCGTGCCATGCCAGTTGGTCGCATCATAGCCG
      AAAGTTGGCAAGGGGGTGGGTCTGGTTAATGGGGGATTAGTGGGGCCTAGAGGGGGCTAAGGGGCGGAGGATGGGGGGGG
      GGCTCAAAAAGGGGCCAAATGAGACCAGCGAAGCAAACAACATGCCATGCTGCAATCCGAATGACTGCACGCTGTTTGTT
      AATGCCCTTTCCCCTGGGCTAAGCGAACAGAATCACGCGGAAACCAGCGGTAAATGCTCTGACCACGCAAAGTGTAGATT
      GCGTCATATTTAGGTTCTTAGGATGGTCTAGCTTCAGATATAAAACTTAAAATTTATTAACAAAATTCCAAAGAATACGT
      GTTCTCACAAAAATAGTTGTCGAAAATTTTCTGAAAGCATTAAAAAAATTTAACAATTGAAATTTCTAAAAACCATATAT
      AAGATATGTTTTTTGAAAACTTATTATATTTGGTGGAGAACTCTCTGTATTTTAAGGGTGGTTAATAAATAGAATATTAG
      CTTAACTATTACTAAAACTAATAACAAATTGTTCTGTGCTGTTCTATACTTCCCAATTTAATACCGGAATAAAGCCGATA
      AGATAGGGTATCTAAAGTGATATATTCCCAATGTGCACTTACCTTGTTCTCGCTGTTGTTGCTGCTTCAACTACGGCTGC
      GGCTTCTGCTGTACCGAGTATTCGGGCGATGATGACGCCGATTCGTTTTGGACCATGTTGTTGACTCGCCTGGCTGGCTG
      GTTGTTGGTTTGCGAGCTGGTTAGTCGGCTGGGTCGTTGGGCTCTGTTTGAGCTGTTGTTAATTTTCCTAAAATCAAAGC
      AGAAAATGCACAGGAAATGTAAACCGTTTTGTGGTAATTCCAAAACACGACGACTCCGATGACGACAAACTGGAAACTGG
      AACGCTTTTCAAGAAATTGCATTTCAGTCTTTGGCCCTTGGCCATGTTTGGCCAAAGCATACAAAGTGCTGGGCTTGATG
      GCCGCCTTTATGTGTTCATCTGCTTAAGTCAAATTAAAATATTAAAATTTATGAACGTCTCTGGGCAAATGTTTGCTCCA
      ACCTGATTATACCCCTAAAAAACGGGGAAAAGACCAAAAACAAAAAAAAAAAAAAAGGAAGGAAAAGCGAATCTTGCAAC
      GTGCATCTCACCTCGAAGGAGGAGTAGCTGCAATGGAACCTGCTTAAAACGAGACCTGGCCTCGGCCCCTCCTTACCCGC
      CCATGTGATGTGGCGCAGATGATAAATAATCCACGCAAATCCCTCGCGCTCCCCCACCTGCGCCATTGCTCATCCGGCAG
      GTGCAAATCGCATGTGACAGCCAGACACTTAACTTTTGTGCTCTCCGAGTGGCTCAAAAGTGCTCGAGAGCTGCTGCTGG
      AACTTGGATCTGGGCTCTGGGTTCTGGGTTCTGTATTCTGTGTCCTGAGTCCACAGTTCTGGCCTAATGCAAACACGTAA
      GCCAAACGCTGACCAGGTCGAGTCCATGGACTCTGGTCGCTCAGCCCGGTCATTTTTTATCGCATGTTAATCACAACCTT
      GTGGAACTTTGTTTACCATCCAGGCTGTCTGCTTACCTGCCACCTGGCGAAACCCTTTTTGTTGTGCGGAATTCCTCCTG
      TGTATTTATGGCTACACTTTTGCAAAGGGGTACAAAGTATTCATTGTAGCTTGGGTAAGGATTAATACAAGTTACAGTAT
      TGGTTCAGCTAAGTATCTATTTCTGCACGCTTTTAATGAATTGTCTATTTATTATTTTCTTCATATATTTTTACAAATGA
      TTATGTATTTTAATACATTAAATTTAAACAGTTGTATATTATTTAATATCAAAGATTTGGTTAAATAAAAAATGTAAAGC
      TTGCTGGTCAAAGCAGTATTTGTTTTAAAATGTTAAAAACTACATAATAATTTTTGAATAAATATTTATGTTTTCTATAA
      TCCTATTGAAAATTGAATTAATAAGCCAGCATATGCTCTCCACTACATACATTACATCATCGTTATTCCCTAGTCAGGGT
      ATTTCATAGCTCAGCTAACCAGACTTAATCCCATGTTTGTTTTCTTTTTCTTTTTGTATGCATATTTCCAGCTGCTTGGC
      TGTGCTTCTCATAGACTTGAGCCTGCTCTAAGTGAATGCAATTAAAATTGACGTTAATCTGCTGGAATTCTGATGTTTTG
      TCATGTTTGCGCGCTAAAGATGTTATTTTGTTTTGACATGCTCTTGGCCAAAGCCAGCTTGGTGTGCCATGTAACCAGCA
      GCCAGGTTCGCTTCGTTTTGGCCAGGATGGAATGGCTGGGCAACATGGTCGGCAAGGAGTCGTTCCGGGCTCGAGACCCG
      ACTTCCAACTTCCAACTTCCCAACTTGCCAGCTCTGTGTTGTCGTGTACATGTAGATCAATCTATCTAACTAACGCGCCT
      GGTGTTTGCTGCCCGGCTGACTAGCTGGCTAGGAGTCTTGGCCATGGCTTGTTATTTAAATTGTTATATTATTTGTGGCT
      GGCTGAGCTTGGGAACCCAGGCCAGGCTCACTGCTCGTCTCCGGCTTGTTATGGCTTAACTTTAATCGAATTCGTCTGGC
      GTCGGTGTTTGCTGGATGTTTGCTGGCAGGATTGTGGTATCTTTTGGTCTCTGGTCTGCTTGCCCTTTTATGGCCTGTTT
      TGTAGTGGCTTAAAGACATGCAGTAAATGTTTATGATTGCTTACTTAAATCACTTATTAAATGCTTTTCCCTGCTTCTTT
      TATTGCTTAGCCATAAATAAACTATGGCCTGGCGATTAAGATTATGTCGACCGTGCAGGGCTTACCTTTCAGATACATTC
      AGATGGATTAAACGACCAAATTCAAAGGGAACAAGAATAAAAATGTTGGAATTCTGAATTATACAATCTTGGAAAAAAAG
      TTTGCCCTAACAAAGCATTTATTTGATATACTAAACTGAATTTAGAATCTCACATACTTCGACAACAAGGTATCAATCAG
      AAACTTTTGAAATTGTATCTTAAAAATGAAAAAAAAAAAAAACAATTTTCCCATTGCTTTTCTAATTATATATAAAATAT
      TTTTCCAGCCAGGTTTTGTAGCTCGATTTAGTAAGTCTCATTTGGCGCAAAACTGAGTACATTTGTATTGCCCTGGAGAC
      CATTCGTGGACCACACACTGCCAAAAAAGGCGATCACAAAAACTGGAGGAAAAGAAAGCAGAGCTGAGCAGCTATAAATC
      TCAAGCTACTATCTCAATGCACACACACTTTTAGCCATTATTACTGCAACATTAAGACACCCAAATGGCTAGGCTTTTGT
      TGGCAGATCCCAAAGCCAGATGCTAGGCCATAACTGCCATTAACATTGGCACTTAATTTACTTTTAGCCAAAAACCGAAA
      ACCAAAACAAACGCAAACAGACAAACAGAAGCGAATACACAACACACAAAATGACGCACTGCTATCTTATTATATTTGGC
      CAACAATAAGGAGCCACGAAAAAATACAATGAAAAATAAAAATATATACCAGGGGAACAACAATTAAAACCATTTTCAAG
      CAAGCAAACAAATGGCGCAGAATGGGAAAAAGTCGCATTCCCATTGTCCGGCAAACCTCCTGCGCTTATTTATTGGCGTC
      CTGTCCAGTTTGGACCATTGTTTGCTGTCCGGGGGGAAACGAGGCCAAGAAAAGGAAAGTAAACCAGGCAAAAAGGCCAC
      CAAATAGGATAGAAAGAAAGTAGCTCAATCTCCTTCGTTCTCTCGATATCTTAACAATTTTCAATTTTAGCTTTTGTTCT
      CGAAAGCAAACAATTCGAGAAACAAGATGAAAGCAAAGCGGTTGGAACTGAAGGATACCCTATAAAAATGTGCGGTACAT
      AAACAAAACTTTTTAATTTGTTTAAAGTCTTATGCTTGATGCTCATTATGGAAATCATACCCACATTCTACTATGCTGAA
      TTCGAATTATACCATAAACTATACTTAACTTAAGCACCAAATTCAGTTTTTAAAATAATTTAATTTAAAACGAAGTTATT
      TTATAGACGCTATATACCCTATAACTAAGCGGTACGATTCCAGGGGGACAACTAAATCTAAGTGCCTTTATCCTCATCAT
      CGCGACCTTCTTCAATGCTCGTATACGCATTCTGTGGTAGGTCCTTTTCTTCTTCAATGCCCGACCCATCACTTGATTTT
      AATTTAATTTGATTGCATTTCTAAAGCAATTTCAATTCTACTTTAATTCCTATTTTTGAACCCATAAATAATTGTCTAAG
      CGCACAGGCGTGAATCGCTTTACCCCTTTGTTTGTGCTGCCCGAAATAAAACTCATAATTTTTGTCAAATTCAAAATGGT
      ACTTTGCTATATATAGTGGGGTACTGGAATTTTAGTTTTGGGGAGTTTTCAAAATTGATTTCCGGTGGAGTTCTGCTCGT
      TGCGCTTCGTCGCGGAGACCCAGGCGTTAATGATCTGCAGCATGCGCCGTTGAGTATCTGACAGATACTTTCTGCTATTG
      TCAAATGCTTGTCATGCTTCAATGATTTCATAATTTCCCCCACTGAGGAAAAAGGTTTGGCTGCCGTTTTGCTGAATTAA
      AATGTAATTCTTAATTAAACTCACTTAAAATTTATTGTTCGTTGAATAGAACTTACAGGAGGCATGGGCCATGAAATTGT
      TCAATTTCCTGTTTGAAAGTTAGACTGCTGATTGAGACATCTTCTTTAAAGAATCTCTAAAAAAACAATGGAACTGGGCT
      CTTTTTTGTGAATATAATTAAGATGGAACCCCCTTGGAATTTCTTTTTAAATAATTCGATTGTCAACCAGAAACAACCGA
      CCGATCTATCAAGAGCAAAACTGTGACTGCATTTTATCTATTTGTCAGGTCGTTAAGACAGACTGACTAACCATCCCAAC
      TATTCCAGCCATTCTGTTGTCCGACAGTCTATTCCCAGGCATTCAAGCATAAAACTCGACAGGAAGCAAGTCATGAGTCC
      CGAAAATAAGACGCACAGCCAAAACAGATGACAGATCGTTCAGGTATTTTTACATCATTGATATAATTAATCGCGGGCCC
      CGATATTCTCGAGCTTAAGTCAGCGAGCTTCAACTGTCAGCACTCCTCCCATAAATTACAATATATTATGACATCATCTT
      TTCCTTGTCGCCCTTGTCTACAGGATTACCCCGGTGCATTCGGCTCCGTTTCGTTTTCAGTTCAGTTTTGCTGCATAAAT
      TTTACATGCCGCCGATCTAGATACAGATACAGATATAGATGCATGTGTGCCAGGCGGCGTAATATTTCCTTGCATTGAAT
      TGTCAGCGCCTGCTTACCTAGTCATAATTTAGTGCTTCGACAGGGACTTGCCTCACTGGATTTTCCCTCCACCACCCGTC
      CATTCCGTCCATCTCTCAGGCTGTCAGCACTTCCCAGCTAGCTGCTAGTTTATATGGCTGCAAACATGTGCATGATACAT
      TTATTATCTATGCATATCCTGGCTCTGATTGTCGTCTCGGCGCTTTGAACTTTCCTGCCTCTGTCGGGTTTTTTTTTGTC
      TTACCTCTGACAGCTTCTTCTGCTGGATTCAGTCCCCAACATGGGTTTATGATTTATTTGGTTATTATGGGTGATTAGTT
      GGCATTTGGGGGCTTCTATATCGGACTTATTGAGCTGTCAATTTTGAGACAATTTTAATTCATGAATTTTTGTACTTAAA
      AATTATGGAAACGATATGAATTCAAATATCATTAATTCCAACCCAGACACGTTTCAAATTTGAGAGATTAATAAGCAAAT
      AAAGTGTTCACAATTATAAAATAATGCAACTTCAAAATAAAAATATTTTCATTAAGTAAAATATTATTAACATTTATTCA
      CTTTTTTTTGTTTATATTTTTTATACTAAATCTTCCTGAGAACTTTCTTTCAATTACCAAATTCTGCAACCTAATTTAGT
      TTCAATATCTCATCAAGCTGTCTCACCCAAGCAATTAGCCTCTCATTTCACCGTCTTGTTTCCAACCAAATTGTCTCATC
      ATGATCTTGGCACTTTGGTGCCCATTAGCCTTTCTAAATTGCGGCCAAGAAGAAGCAGTTCAAAAATTAATTAAAACTTC
      TGTCTCGAAAACGATGCCTGGCCAGAGATTATAAATGGGTAACAGCAACAAACTCGACAAAAAAAATGTGCCACACACCA
      AAAAAAAAAAAAAAAAAAAAAAACAGAACAACAAAATACTACTTTAGAATAACTCATTACGCAATAGCAGGCGAACATCT
      TTATTACACCTAAAACATTTAAAAGTAATTTACAACGGACATTAAACCAGAAAAAAGAGACGAGAAATGGCCAAAAGTCA
      GATGAGACTGGACCCCCAAAAAGATACACTAAGTACTTGAAGTGCGCGGCAATTAACAAATTTCAACTGAGATAACAGGG
      CCAGCGAATCAAGTTGCCTACGACGTGGTCAGTGCAGTCAGCTTTTATGGTGACGATTAAGTTGTGATGATAACGTTTTA
      ATTTACCAGGCCGACCTACAGCAAGGATGGCAGGACAATGTCCGCGACCAGCCTCCGATTCTGGGGAGAACATAAAACCG
      GGTTTTATGTCCCTGGGATGCAGCTGAAATCTCGCCGAGAAACGTACATACATATGTACCTCCAAAAGACCAAAACCCAA
      CCATTGAAAGCCGAACTGAAAAACTAAAGATTTGTGGTCATTGATTGTGTGCGCACACACAGAGATTTTAATTTTCTAAT
      GAAAGATAAATGCTCTCGAGATAGTTTGATTTCGGGTCTCTCTGGTTTCCCCGTCTTGGGCCACATAAATTTTCACTTGC
      CTCGGATTGGTTTCTGTTCTAAGGAAACCCAACTGGGCTGCACCTTTCTGTTCCTTGGTTCTATTCTTTTTCATATGCAT
      TGTCATTGATTATAATAAAAATCAAAATAAGTTGTAATTTATATGGGGACAGTTTTGTTTTTTTTTTTTTTTTTTTTGGC
      CCCACCCGTTTCAGGGAATCCAAGTGTTTCGTTTTGATCGATCAAGATTTTTTGGAGAGCGGAGGAGTTGCTGCCAGTCA
      TGGATTGATTTATTTATTGTTGATGCGATTCATTCATTATTATTTAATTAAGCCGCAAATGAGTTTTGTGATTGAAATGA
      ATTCGCTGTGAATTTTAATTCGTTTTTGATTGGCTGGAAGAGGAAAGATTATCCGACTGCAATAAATACTCAACAGCTTC
      CAATCAAGCGATCTCAATGGAAAGCTATGAAACGCCTTTAAGTAGAATTCTCCCATGACTTCTGCAAACAAACCAACAAA
      ATCTATCTTCTTCACAGCCCAATGAAAAGAAAACACACAAAGCGAAAACAATTTCCACCTAGACCAGCCCCTACTAAAAG
      AAAAATGAACTTAAAGATACGTTTTAGGCAGACAAAAGGAGAGATACAAATGCGAGGCCATAATCAGAGTCACTCAAAGT
      TGGAGCGGGAGCCATTTGTATCCTGTTTAGTTGATAGCCAAGAACTACAATTAAAGAAGCGCTGCTCTTGGAGCCCCTTG
      GAAATTGTGTGCGAAAAGGCGATGCAGTAGAAACGCTTTCCAGATGCGTATTAAATGATAAGGCCACAAAAAGGTTGTGG
      GGGCCACCATCCCAGACCGCAGACAAAGTTGCGATGCGGATTGCCGACTCTCCGGCAAATAATTGCAAGTTGCAAACCAT
      TTTTGATACGATTTAAAACACAGACGCAAGGCCAAAAGGAGGCCCCAAATTAATACCACGTGCAAATTTTTAACCCCAGC
      ACCCGTAATTATTTTCCATCTTGCTCTCTCTCTCTCTCTTCCTCTCGTCCATTTGATTTATGCTATCAAATGTTGAACAG
      TCGATCCTATAGCCTCCTCTATGTGTAGGAAGGGCATCCGCGGGGGAAACAGGTAATAGCACAATCCGCAGAGAATGCAT
      TTCCGAATCACTGGCAAAAGTTACAGCAAAATGAGCTGGAGCGACTACCAGTCGGACGGACAATTCTAGATGAAGCTGCA
      GATCTGGCTAGAGATGGCTCCATAAACCTGAAGATGGTTATCAGTAATTGCCGTGAGAGATGGTAGATGTAAGTACTAAA
      AGATAACTGATATCGAATTAAACTCATGTTGTAAATTAGATTTTTTAGTTTCCATTTGCCATTTCATGATACTAATCCTA
      GAACTGCACTTATGGGAACAATTTCAAAATTATATTCTAAATAACGTTCCAATCACGAGCACATCTCTGAAAGCTGCAGT
      CATCCAGGCGAATGTGTGGCGCTGGTCAAGAGGATTCGTTCAGAGGCAGTTTGGGAGGAAAGGGAAAATACTGCCACACA
      GTGCCACACTTCGAAACCGAAACCAAAGCCTGAGCTAAAAACGTTGCCTGCCCCGTTGGCTGCGTGAGAAACACACCTGC
      CCGAGTGCCCTTCCACTTGCCCTCTACCCCTGCACCTGTATCTGTATCTTGAAGATACGTTTATACTGCTTTTGCCCCCG
      GGGGAACTGGGTGTTTGCACACGCATCGCTGGCGCTGTTGCTACTTCTACTCAGGATGTTCAGTCCGATTCTCTGTCTGA
      ATCCGAATCTGGTTTGGGCTTTGGGCATTTTTGCGCTGCTGCGTAGCTGATTAACCGAAAGGGTTCGCTCAAACGACTGG
      AACCTGGTTAACGGGCATGCCCGACTTGGCTAATGCCACTTGACACCCGTTTGAAATGACAAAAAGGCGGCCAAGAGGTT
      AAGCCTAAGCCTCTAACGTGTCGGGAATTTATGCAAATTTAAATAAATAAATCAAAAAAAGTGTATATACATTATAAAAT
      TATTACTTTTTTTATTTTCTATATCTCTATTTATATTTTAATTAAAATAAAATTATTTCACCATGTTCATTTTCTGCACA
      TTCACATTTTAAAAATACATATTTACCACTATTGAAAAATTAAGTCATTTCTAATCCCATTAGTTGGATCTTCCAATTTC
      CCTCCGTTCCTAATTTAACTACAAATTGGTTTTACGGAAAGTTTCACAGATCAACAGTGGACCACTTCCTCTGTTTTAAC
      GTCCAACTCCATAAATTCTCCTCGAAATATTCCACATATCTTCGATTTGTAACTGAAACCTTCGTGAAATAAAGATAGAT
      GATCTTTAATGTTGACCACTTTGCATGCGATCTGGATGGTTAACTCATCTCTGACAGGTTGAAGAACTCACTTTCTTTGC
      AGCACAGTTCCGCCCATATCGAATCGGTCAAAATCTCCATCTGAGCATCTATAGCCCACACTTTTGATTTCCCCGAAATG
      TGACTCAGAAGATTCAAAGACACACGGAAAAACAAACTTAGATTTCCAAAACGATTAGGTAAACTTGCTGGGGGTTCGTA
      CCGCAGTCGAAGGTATTTTGGGAAACCATTTGGGGCGATTCCAGGGAAATGGAAAAAAAGTGAGGCGCCAGTTGAACATG
      GATTTTCGAACGAAATCTTTAACCACAGGAGAGCGGCTGCCCCAAATAATTACCTCAAGAGCTGGCTTTCAATTAATAAA
      TGACGTTAACATGCTGTCAAAATACAAATGTGAAATGCCTGATGATCTGTGCACCAGCCAGCATGTGTATCGAATGTATC
      TCACAGGTCTATGGAGACACGCCGAAGTGCAAGTCCAGACTTCATAAATTATAATTTGCCCGGGCCATAAATAGCCGCCA
      GCAGTCTTGGACACTTTGACTACCGATTATAATCAATCTTAGAGATGGATTTTGCCCAGACAACGAATGAATGTGGCATG
      CCACGGCCGAAATGATAGACGCACAAAGCTTTGGTAATTTAAAACGCGCTGCACTTCGGTTCGACTAGGTCTATGTCTGT
      GCATTTTCCTAGGACAGGGAGCGATCACGCAATGGATACCCAGATCTTCAAGCTGGGTCTTGGCTAGTAGCTGTGAACTC
      TCCACTAACATGTGTCCATGTCCATGTCCAGTCTTTTCCAGTGGCTGTTGCTCCTGCAGCAAGATGAATTTGCACGGTGA
      TCGGTGCACTGAGAAATGTTAACGTTAATATAACAATAAAAAATATAAAAATTTATTTCTTCTTCAACAAATAGATATCA
      TCTATCAACAAATAATAAAATAGGCTGGAATAGAAATCTTTATTATGTTTATGCTTCCTTGTGATATACAACATTTAAAT
      TATATTATTAGGAACAACAGTTAGTAACTGTTTAAAATAATATAAAAACGTCTTTTGTTTAGCCAGAATTTTTAAGAATT
      C
      
      Library Information (1)
      Library: RPCI-98_BAC
      Description

      A BAC library containing genomic DNA fragments with average size of 163 kb. Generated for physical mapping of the Drosophila genome.

      Sample preparation
      Protocol

      DNA was isolated from adult fly tissue and embedded in agarose blocks. DNA was partially digested with EcoRI and EcoRI methylase, size fractionated and cloned into the pBACe3.6 vector.

      Comment

      A total of 17,540 recombinant clones were initially generated with an average insert size of 163kb (24-fold coverage of the euchromatic portion of the genome)

      Reported As
      Symbol Synonyms
      BACR
      BDGP BAC library
      RPCI-98_BAC
      References (2)
      Research paper (1)
      Hoskins et al., 2000, Science 287(5461): 2271--2274
      A BAC-based physical map of the major autosomes of Drosophila melanogaster. [FBrf0127123]
      Personal communication to FlyBase (1)
      Venken et al., 2012.4.25, Large retrofitted and site-specifically integrated duplications for the Bloomington Drosophila Stock Center collection.
      Large retrofitted and site-specifically integrated duplications for the Bloomington Drosophila Stock Center collection. [FBrf0218451]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)