AGGCGGAGCGTANGACGGCGACCTCCAGGCCTTCAACCACCGATCCCTGGCCAGATTGAAACACAAATTTGTTGTCCCGC AGC
Cloned cDNAs prepared from polyadenylated RNA isolated from fat bodies of immunologically challenged third instar larvae. The strain used was not the iso-1 sequenced strain.
The fat body was dissected from third instar larva challenged with gram positive and gram negative bacteria.
RNA was isolated from fat body from 3rd instar larva challenged with gram+/- bacteria; cDNA was oligo(dT) primed.
The Exelixis ESTs were submitted to GenBank by the BDGP on behalf of Exelixis.