Open Close
General Information
Symbol
Dmel\IP03328
Species
D. melanogaster
Name
IP03328
FlyBase ID
FBcl0303644
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
  • suspect
Library
IP_cDNA
  • IP cDNA library of D. melanogaster, isolated by an inverse-PCR screen (SLIP) from other cDNA libraries.
Strain
    Vector
    Tissue Source
    Stage
    Tissue/Position (including subcellular localization)
    Reference
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    3,338
    NCBI
    Full Length sequence dataSequence Downloader
    TATGGATCCACGTGAAATCACCCACACGGTCGAGATACTCGTGCCGCCGAGGATTCATCACATTAGCACCGGTGGACATT
    TGCAAGTCAAGAAGGGCTCGTCGGTGCGCATCGAGTGCTCGGCCACTGGTAATCCAATGCCGAATGTGACTTGGAGCCGC
    AAGAATAATATTTTGCCCAACGGCGAGGAGAAGCTCCACTCGCACGTCCTCTCCATCGAGAATGTGGATCGGCACAAGGG
    CGGCGTCTACATATGCACGGCCAACAATCGCGTGGGCCAGCCCGCTTCCAGCCAGGTCGTGCTCCATGTCCTGTTTTCGC
    CGGAAATCTCCGTGGAGCGTCCTGTGGTCTTCTCCGGCGAAGGGCACGAGGCCACGCTGGTCTGCATCGTCCACGGCGAA
    ACACAGCCTGAGGTAATTTGGTTCAAAGACACCATGCAATTGGATACCACGGAGCGGCACATCATGGAGACGCGGGGATC
    AAGGCACACGCTGATTATACGCAAAGTGCATCCGCAGGACTTTGGCAACTACTCCTGTGTGGCGGAAAATCAGCTGGGAA
    AGGCACGCAAGACCCTCCAGTTGAGCGGAAAACCGAAGTGGCCGTTTTTAATTCACCGCCAATCAGTCAGTACAAGGACA
    GGTAAGATTTCGATTGCAAGTGGCCATGGATGGGAATCGAGTTTGGGCCACGTGCCAACTTGGACAATGCTTCGGGTCGC
    CAGGTGGGTTGGCTAATTGCGACTACGGCAGTGCCACGACTTTGTAATTGAGCATAAAATGCAAAATCCGTTGGAAATGT
    CAGGTGCTCCGGCCTGATTGGACATTAGACACTGCCCCTAGATGTGGCTGATGACGATGATGATGATGATGATGATGCAC
    GGAGTAACTTTATTAGATTAATTTCGTTGACTGACATGGCAACCGAATTACGGACAGCTGGACGGACGGACAACTCTCCG
    AGCCGCCAGTGAGCAAACGTAAACGTAACGTATGAAACTTTTAATTGGATTAGCTGTCATCAAACACACGCACACATAAG
    GGGGCACAGGCAGACAAAGGCGGATGGATATGGAGGGGGCGTTGGTGGCAAAGTGCGGGGATAGTCAGCCAAGCGACAAA
    CAAGCTCACATCTCACGTCACACCACTCGAACGAAATGGCAGAAGAAATAGACACAGATAGACCGACAGCTAGATAGCTT
    TGCAGCGTGTTTTTTGTTTGTTTTTTTTTTTTGTTTTTGCACAAAACGATGTCGGCCAGGTTACACCTTTCAATAATTCA
    AACCAAATGAAATCCAATAATCTGCTGCAAAAAGGTCAAAGCGGGCCAAAACGTCAGCTGTAATTGCGAGCATAGCAGCC
    ATATTGCGCATACGCCATACGCAGCCATATTAACGCAACTTTGCAAAAAGCAACTAACCGAACATTTTGGCCATGTCAAC
    TTTGGCGCTGATTTCATTTCGTTTCATTTGCTTTGATTCCCTGCCGCCGGAAACTGCTGCCGGCAATTAAGCTACCAAAA
    AGCCCGAATCGAGCATACAAAGTACGCAAAAGCGCCTTTTCCTTCTTTTTTTTCCGGTCCCTTCTCAGCCGTCTGGCGCC
    AGTCGCCGGCTCTTCAATTGTTAATAATCATTTTTATTGCTTGCGTTAGTTTTATGCTATATGCGAAAAGTTTCCTGATT
    GGCGTTTTATGTTTTTATTGTGCCCAGGACTTGAAGTTATTAGTTCGCATGGCCTAATAATCATACAGAATACATTCGAG
    GGCAAAACAAATGATGGGCCGTGCCGACACAAACAGGATGCCAAAGGACTTTCGTCCTCTATGCCATCAGCATCCCAATG
    CTGATTAACATTCAAATTGTGTGCCGACTTTATCGCAAAGCAATGAACTTGCGCCTTTTGTAATGGCGTATTGCGACATC
    CCAGGACGAAGTGGGGCATCCGTAATTAGTTGTTGTTTACTTGAGCAGCTCCATTGGAGTGTGGCCATAAATAACTTTGT
    CCATCGTCTGCCGGCTAATGAGCTGTTCCGACTTTAAAGAACGGCATTGCCCCAACCTTTAAGCCAACCGTGGGGCAATG
    GCCAAAAATGCAGTTTCAAGTTTCACCCACCTCCACTTGGCTTCCTAATCGCGGTACAATGCACCCAGCTGAAGGAGTCG
    GGGTCGGTCATATAACTTCATTTACACTTGAGATGAGAATGTGGCAGGACTGTTGGCTTTTCGGTTGAATGGACGCATTG
    TGCGAGCAGTTTCAGTTACCCAGGAACCAAGCACTGAGATGCGAGCAGCCAATAACAATGGCGAGGGCGGGCATTATGTT
    AAGACTGCAGCAACAGCAAACGACGGACGACGAACCTCGAAGCCCGAGCTCCTCAACCCCGGGATCCCTTACTCCCGATC
    CCGATTCCCGGACAACAAAGCGGCTGGCTGCTGGCTCATACGCAGTATCTTAACCCAGCCATTGTCGTCAGCCATTGATT
    ACGTTGTTGTTGTCACTCTGGAGGTCCCTATTCCCAACCTCCTGCCCCGATGCCCTTCCAGCATCTTGACGTGACTGCCG
    GCTGCGTGTTGGCCTTAACTGCAGTGGCTGAAGCTCTCAATGGAGAATTTAACAATTACATATTGATTGCCAGCGCCTCG
    GAATAAATCCCCCGCCAACTGTTGCACGCGAAAAACTTTGCGATAACCAAGCTACTCACTCACTCGCTCACTCACTCACT
    GACTCACTCCGTCCTCCATTTTCAGATACAACATCTCCTGGGCCGTCGACTCGCACTCTCCCATCGAGGAGTACAAGCTG
    TCCTTCCGCAAGTTGCCGCAAGGACACGAGGTCGTTGGCAATGCCATCGACTCGTCCTCCTCCTCCTCGTCGATGTCCTC
    CTCCTCGTCCCAGATGTACGGCTCTGGGCTACATGCGCATCGGATTGGCAGCAACATGGGCGGACTGTCCGGACTGTCTG
    GCAGCGGCAGCTACTCCGGCTACGGCAACGTGATTCACTGGGGCCACAACGACTGGCGCAACGTCGTCCTGCCGGCAGTT
    CCCGTTTCGCACCACTACGCCCAGGGCATGAGCTACATGGTACGCGGCCTGGATCCCGATCAGCATTACGAGGCCACCGT
    GCAGTCCAGGTTAGTCGGATGGTGTCAGATTATAAGAGCAAAACTTTACGGCGCACTGTAGGGAGTTTTAAGCCGCACAG
    TGGAGCTGGGAGCCGAGATTAAGTTATGAGATTAGTTAGATGGGATATTGTTCTATGAAATAGATTGACGGAGTGGAGTA
    ATATGCAGTTTTGAGCCCACGGTTCGCTGCAAGTGAGCCAACCTGGCTAATTTGACCA
    
    Library Information (1)
    Library: IP_cDNA
    Description

    Clones isolated by an inverse-PCR screen (SLIP) using a mixture of the GH, LD, LP, and SD cDNA libraries.

    Sample preparation

    Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.

    Protocol

    These clones have been isolated a directed screening process called SLIP (Self-Ligation of Inverse PCR Products). Clones isolated from this screen have been PCR-amplified using a mixture of 4 different plasmid cDNA libraries as template. These include the GH, LD, LP, and SD cDNA libraries.

    Comment
    Reported As
    Symbol Synonyms
    IP
    IP_cDNA
    References (1)
    FlyBase analysis (1)
    FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
    Curation of large dataset metadata by FlyBase. [FBrf0232540]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)