Open Close
General Information
Symbol
Dmel\IP17226
Species
D. melanogaster
Name
IP17226
FlyBase ID
FBcl0304002
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
    Library
    IP_cDNA
    • IP cDNA library of D. melanogaster, isolated by an inverse-PCR screen (SLIP) from other cDNA libraries.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      1,706
      NCBI
      Full Length sequence dataSequence Downloader
      AAGCAGTATTGCGGCTGCCGCACTTGCATAATTCTAGGTGTAAATACAGTTTTTAATATGTTACAGGCTATAAAGACGCT
      CCGCTGGACACAGCCAATGCGGGCTCTGTCCACGGTAAACACCAGTTCCGGCGTACAAGGCAATCTTTCACCTGCGGCAC
      CTGCTCCGGAACCGGATAAACTCTACAGCAAGCTGGAGATTGAGCTGCGGGGTATTGATCCGGCAGTTCTGAAGAGCTAC
      ACCTGGTTTGCTACTACTGCTGCCGAGCATTTGGGCATTGAAAAGGGAAAATGTTGGTCACCTCGCAAGGCGCACCACGA
      GCGGATGACGCTCCTGAAGTCGGTGCATATCTACAAGAAACATCGCGTACAGTACGAGGTGCGAACCCACTTCCGCTATA
      TGAACTTCCACAAGTTGACGGGCTCCACGCTAGATACATTTCTAGAGTATATTGAACGTAATCTGCCCGAGGGCGTAGCG
      CTGCAGGCTTCCAGGACTGAGCTGCAGGAGATCCCAGAGCACTTGCGCCAGCCGCCGGAGCAAGTTTAGCCGAAGCCAAT
      ACTACAGTAGACCTTAGTTATTAAAAGTTCAGTATGAGCTTAGATTGCACCAGCAATCCGCACGGTAATCGGCCGTACTC
      GGGCCCCGTCCGCGATTAGCAAAGATAAGTTTTTGGCAGAATATTGAAATAAAAGTCGTATCTTGACACACACGATGGGA
      TCCACTTGAAAAGTAAGCAAACAAAATCAGGGCGGGCGAACGCTGGCATACCAGTAGCTACTCCAAACCGAACGGAAGCG
      AATCAATCAGCAGAATGCAGCGGGCAAAACTCACTTCACAGGTCCTGCTGGCCACAGCCATTCTCTACGCATGCCTGTCG
      CCCGCTGCCTGCGTTTACGAGGCGAAAATCTTGGCGTTCCTTCAGGAGTTCCGTATGCGCATGTGCCACCCAATCCCGAA
      TCTAGGCCTGCCCGCATTGGACCCACTGCAGTTGGGGCCTGCTGAAACAGAACTGAACAACAAATACCTCGTGGACTTCA
      CTGGGTCCATTGACAACTTTCAGTTGCACGGATTGTCCGATTTTGATGTGCCTGCGCTCAGCTTATCCCCGGTGCCCGGT
      TTGAAGAACACCATTAACGTTACCTTGCCACTCACGTACTTCAAATCCTTATACACCGCCAAAGGATCCTTGGCCTATAT
      CCTCAACTTGGCCGGTGATGGCAATGCCGAAACCTCCATTACAAACTTTTCAATCCTCATTTCGTTTCGATTGAGATCGG
      TGTCTCCCCTGGCCATATCTTCATTACAGATTGAGCTGCGTTTGGGAGGACTATGGATTAACTTTGATAACTTGATGGAA
      GAGGATCGCATCAATGATTTCATCCATGCTTTGGTGAACGAAATGGGAGTGGAGCTGCTTGGCGACGTCTGGGATTATGA
      ACAGGGCACAGTGGTCTCCAAAGTCCAAGCGGCCGTTAACAACTTTTTGGGTCAGTACTCTCTGTCGGATATAATTCAAA
      TAATAATTGGTGGCGACGGAGAAGGAGAGAGTGCGCCCATATTTGATGGGGTGGAACCGGATTGCAAGCCGGATGCTACC
      ACGACCCCGCAAGACTGACTATCTAAATTCTTTTAAACTAATATAAGCCACTACTTTAAATTACCATAATAAATATATGT
      ACGTTTTTAAAAAAAAAAAAAAAAAA
      
      Library Information (1)
      Library: IP_cDNA
      Description

      Clones isolated by an inverse-PCR screen (SLIP) using a mixture of the GH, LD, LP, and SD cDNA libraries.

      Sample preparation

      Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.

      Protocol

      These clones have been isolated a directed screening process called SLIP (Self-Ligation of Inverse PCR Products). Clones isolated from this screen have been PCR-amplified using a mixture of 4 different plasmid cDNA libraries as template. These include the GH, LD, LP, and SD cDNA libraries.

      Comment
      Reported As
      Symbol Synonyms
      IP
      IP_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)