Open Close
General Information
Symbol
Dmel\bs58b03
Species
D. melanogaster
Name
bs58b03
FlyBase ID
FBcl0352208
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    BS_cDNA
    • BS cDNA library of D. melanogaster, adult male, testis including ejaculatory duct and seminal vesicle.
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      517
      NCBI
      5' sequence dataSequence Downloader
      GCACGAGGATTTCTGCTCCCTGGCCGACTACGTGTCGCGCATGAAGGATAACCAGAAGCACGTGTACTTCATCACTGGCG
      AGTCCAAGGACCAGGTCAGCAACTCTGCCTTCGTGGAGCGCGTCAAGGCCCGTGGCTTCGAGGTGGTCTACATGACCGAG
      CCCATCGATGAGTACGTTATCCAGCACTTGAAGGAGTACAAGGGCAAGCAGCTGGTCTCTGTCACCAAGGAGGGTCTGGA
      GCTGCCTGAGGATGAGAGCGAGAAGAAGAAGCGCGAGGAGGACAAGGCCAAGTTCGAGAGCCTGTGCAAGCTGATGAAGT
      CCATCCTGGACAACAAGGTCGAGAAGGTGGTGGTGTCCAACCGCCTGGTGGATTCGCCCTGCTGCATTGTCACTTCGCAG
      TTCGGCTGGTCCGCTAACATGGAGCGCATCATGAAGGCCCAGGCTCTGCGTGATACCGCCACAATGGGCTACATGGCCGG
      CAAGAAGCAGCTGGAGATCAACCCCGATCACCCAATT
      
      Library Information (1)
      Library: BS_cDNA
      Description
      Cloned cDNAs prepared from polyadenylated RNA isolated from young adult male testes, seminal vesicles, and ejaculatory ducts.
      Sample preparation
      Adult male testes were dissected from 1-5 day old y[1] w[67c1] Drosophila melanogaster flies, after removal of the paragonia and inclusion of the ejaculatory ducts and seminal vesicles.
      Protocol
      Poly(A)+ RNA was purified from dissected testis. The size fractionated cDNA (1-6kb) was directionally cloned in the Stratagene Uni-Zap XR vector using EcoRI and XhoI restriction sites. pBluescript SK (-) is produced after excision. The host strain is E.coli SOLR.
      Comment
      Reported As
      Symbol Synonyms
      BS
      BS_cDNA
      References (1)
      Research paper (1)
      Andrews et al., 2000, Genome Res. 10(12): 2030--2043
      Gene discovery using computational and microarray analysis of transcription in the Drosophila melanogaster testis. [FBrf0132348]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)