Open Close
General Information
Symbol
Dmel\RC0-DP0003-150700-021-H08
Species
D. melanogaster
Name
RC0-DP0003-150700-021-H08
FlyBase ID
FBcl0360707
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    DP-ORESTES_cDNA
    • cDNA library of D. melanogaster,mixed stages.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      457
      NCBI
      Partial sequence dataSequence Downloader
      GATCTGGGTCAACGAGATTCAGATAGGTCCACTGGTAGATGGTGCGTACTTAAAGGCCAATCCAGATCCATGCCCGTGAC
      TCAGGCCGTGACTGATTCCATGACTGATCCCGTGACCGATTCCATGTCCATGTCCCTGACCATGGTAGTTGTGACCGGAA
      CTCGAGCCGCCACTTGTTTGAACGATGTAGGTTTCGATTTTAGGAACTCCACTACCGCTGTAATGATGGGGCCTTCCATG
      GCCACTGGAACTGGCGTAGCCGTGGCTTCCGGAGTGTCCGTGTGCGAAGTGGTGTCCGTAACTGCTCTCGCCCTTGAAGT
      GACTGGGGTAATCGGAATAACCAGCCGAGCTTCCATGGAAACTGTCGAGGTTAAGGTGACTCTCATAGGCGGGCGGCAGA
      TATTTGTGAGAAGGGCCGTGATAGCTGGATATTCCTCCGAAACTTAGGCCAGCATCT
      
      Library Information (1)
      Library: DP-ORESTES_cDNA
      Description

      Cloned cDNAs prepared from RNA isolated from mixed stages, embryonic through adult.

      Sample preparation
      Protocol

      A minilibrary was made by cloning products derived from ORESTES PCR (U.S.Letters Patent application No. 196,716 - Ludwig Institute for Cancer Research) profiles into the pUC18 vector. Reverse transcription of whole animal mRNA and cDNA amplification were performed under low stringency conditions.

      Comment
      Reported As
      Symbol Synonyms
      DP-ORESTES
      DP-ORESTES_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)