Open Close
General Information
Symbol
Dmel\DMG2-chrX.9.053.a
Species
D. melanogaster
Name
DMG2-chrX.9.053.a
FlyBase ID
FBcl0360995
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    MODENCODE_DM_A_cDNA
    • cDNA sequences of D. melanogaster, iso-1 strain, adult.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      545
      NCBI
      Partial sequence dataSequence Downloader
      TTTTGTTTGGCCCATTGGCCATCGCCGCCACGCCGCTGGTGAGCGCTAACTATGGTCCCGCTGGCGGACACGGACACGGA
      CATGGACATGGACAGTACCTGTCCGGTCCCAATGCCGGACTCGAGGAGTACGTGAATGTGGCGTCTGGTGGCAACCAGCA
      GGCTGCCAATCAGATCGCCTCACAGGCCGAGATCCAGCCCACGCCGGAGGAGGCCCGTCGTTTGGGTCGCGTCCAGGCCC
      AACTTCAGGCCCTCAATGCCGATCCCAACTACCAGAAGCTGAAGAACTCCGAGGATATTGCCGAATCTCTGGCCGAGACC
      AATCTGGCCAGCAATATCCGTCAGGGCAAGATCAAGGTGGTGTCGCCACAGTTCGTTGACCAGCATCTGTTCCGCTCCCT
      GTTGGTGCCATCGGGCCACAACAATCACCAGGTGATCGCCACCCAGCCCCTGCCACCAATCATTGTCCACCAGCCTGGTG
      CACCACCAGCCCATGTGAACAGCGGCCCACCGACTGTGGTGCGCGGCATCCGTGAAAACCTACAA
      
      Library Information (1)
      Description
      Sequence of PCR products from first-strand cDNA made from polyadenylated RNA.
      Sample preparation
      Protocol
      All products were PCRed from first-strand cDNA made from mRNA.
      Comment
      Reported As
      Symbol Synonyms
      MODENCODE_DM_A
      MODENCODE_DM_A_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)