Open Close
General Information
Symbol
Dmel\RC0-DE0001-140700-015-C06
Species
D. melanogaster
Name
RC0-DE0001-140700-015-C06
FlyBase ID
FBcl0361680
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    DE-ORESTES_cDNA
    • cDNA library of D. melanogaster, embryo.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      291
      NCBI
      Partial sequence dataSequence Downloader
      TCTTCTCCGAAAGGCACATCGCATTGGCATGGAAGCACTTATCCACAATTGTCGAGTATCAGCTCGTCGGAGCTGTGGAT
      CCGCGGGGTCACCGCGTTCTCGATGGCAGCACCGGACACGGATGTGGAGGCCACCAGCAGCAGCGCACAACCGAACGCGA
      GCAAGGACGTGGAGCGGAAAGCCATTGTGTTTCCAATCGAAAAAGATACAACTAGATATTACTGACACTACCAGAGCGCG
      TAGTGTTCACTGTGGAGTCGATGCGGCGACAATGTTGCCTTTCGGAGAAGA
      
      Library Information (1)
      Library: DE-ORESTES_cDNA
      Description

      Cloned cDNAs prepared from RNA isolated from embryos.

      Sample preparation
      Protocol

      A minilibrary was made by cloning products derived from ORESTES PCR (U.S.Letters Patent application No. 196,716 - Ludwig Institute for Cancer Research) profiles into the pUC18 vector. Reverse transcription of whole animal mRNA and cDNA amplification were performed under low stringency conditions.

      Comment
      Reported As
      Symbol Synonyms
      DE-ORESTES
      DE-ORESTES_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)