Open Close
General Information
Symbol
Dmel\Dmel_dig_002344_0603_3602
Species
D. melanogaster
Name
Dmel_dig_002344_0603_3602
FlyBase ID
FBcl0366184
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    TTT_DIG_cDNA
    • RNA-Seq of D. melanogaster, iso-1 strain, adult virgin female, 3' ends of polyadenylated transcripts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      3' Sequence
      Total bases
      78
      NCBI
      3' sequence dataSequence Downloader
      ACGTTCATTCAGAAAACAAACGACGATGAATGTTCACAAAGTTACGCGAAATAAAATGATTGATACATAATAAATTTT
      
      Library Information (1)
      Library: TTT_DIG_cDNA
      Description
      Sequence of 3' ends of cDNAs prepared from total RNA from adult females.
      Sample preparation
      Protocol
      Total RNA was isolated and double-stranded cDNA was prepared using an oligo-dT primer for first-strand synthesis. Preparations were digested separately with Mbo I, Nla III and Tai I, and 3' fragments recovered. The 3' fragments produced by each restriction enzyme were pooled before sequencing.
      Comment
      Reported As
      Symbol Synonyms
      TTT_DIG_cDNA
      References (1)
      Research paper (1)
      Torres et al., 2008, Genome Res. 18(1): 172--177
      Gene expression profiling by massively parallel sequencing. [FBrf0202153]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)