Open Close
General Information
Symbol
Dmel\Dmel_neb_010602_0439_2806
Species
D. melanogaster
Name
Dmel_neb_010602_0439_2806
FlyBase ID
FBcl0370219
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    TTT_NEB_cDNA
    • RNA-Seq of D. melanogaster, iso-1 strain, adult virgin female, 3' ends of polyadenylated transcripts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      3' Sequence
      Total bases
      106
      NCBI
      3' sequence dataSequence Downloader
      GTTCGGTCCAGCAACAAATAGCTGTGCAATAGAAATTAATTAGAAAATATTTCGCGTAACACAGCAGCAATTTAGTCAAG
      GGGAAAGCGCACAAAAGTGCGCTACA
      
      Library Information (1)
      Library: TTT_NEB_cDNA
      Description
      Sequence of 3' ends of cDNAs prepared from total RNA from adult females.
      Sample preparation
      Protocol
      Total RNA was isolated and double-stranded cDNA was prepared using an oligo-dT primer for first-strand synthesis. Preparations were nebulized, 3' fragments recovered, and sequenced.
      Comment
      Reported As
      Symbol Synonyms
      TTT_NEB_cDNA
      References (1)
      Research paper (1)
      Torres et al., 2008, Genome Res. 18(1): 172--177
      Gene expression profiling by massively parallel sequencing. [FBrf0202153]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)