Open Close
General Information
Symbol
Dmel\RM07192
Species
D. melanogaster
Name
RM07192
FlyBase ID
FBcl0381821
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    RM_cDNA
    • cDNA sequences of D. melanogaster, iso-1 strain, embryo, 5' ends of capped transcripts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      187
      NCBI
      5' sequence dataSequence Downloader
      ATCTTCATTTACAAACAATTGTGGAGTTTGCAAACTTTTGTAAAAATGGACTACGATTTCAAGATGAAAACGCAGATAGA
      GCGTACGAAAGTGGAGGACCTATTCAACTACGAGGGCTGTAAGGTGGGACGCGGAACATACGGCCACGTCTACAAGGCGA
      AATGGAAGGAGACAAGCGATGGCAAAG
      
      Library Information (1)
      Library: RM_cDNA
      Description
      RACE-generated partial cDNA clones (not preserved as library); represent 5' ends.
      Sample preparation
      Protocol
      Total RNA was isolated. Gene-specific 5' RLM-RACE (RNA Ligase Mediated Rapid Amplification of cDNA End) products were generated using the FirstChoice RLM-RACE procedure (Ambion). Vector sequences were removed and the RNA adapter sequence was used to determine the orientation of the clone and was removed from the sequence. Each sequence represents a potential transcription start site and is oriented along the direction of transcription.
      Comment
      Clones were not preserved and are not available for distribution.
      Reported As
      Symbol Synonyms
      RM
      RM_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)