Open Close
General Information
Symbol
Dmel\FGM306E08
Species
D. melanogaster
Name
FGM306E08
FlyBase ID
FBcl0392545
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    EG_pGEMT_cDNA
    • EG cDNA library of D. melanogaster, embryonic gonadal cells purified by virture of EGFP-vas expression, pGEMT-Easy vector.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      672
      NCBI
      5' sequence dataSequence Downloader
      AACATCGGACGGCACTGAGAAGGGTGGCTATATCTGCGACGTCTGCGGAAACTTTTACGAAAAGCGTGGCCGGATGATGG
      AGCATCGCAGACGCCATGACGGCATCTGCCAATATGCATGCGAACTATGCGATGCCAAGTTCCAGGTGCGCGAGCAACTG
      AGGAAGCACATGTACTCCCACACGGGCAGCAAACCCTATAAGTGCAGCTTCTGCAGTCGTCAATTCTTCTACGAAAGTGT
      TCTCAAGTCTCATGAAAATGTTCACCGTGGCATCAAGCCCTACGTGTGCAAGGTGTGCGACAAAGCGTTTGCCTACGCTC
      ACTCCCTGACCAAGCACGAGCTCATCCACTCGGACATCAAACTGTACCGCTGCGATTATTGCAACAAGGACTTCCGTCTG
      CTGCATCACATGCGCCAGCACGAGGAGACCAAACTGCATCAGAACGCCGTAATGCTGGCCGAGAGCATGAAGGTGGAAAT
      GGTGGCCGAGCAGGGGGGCGGGAACGAGATCCGAATTCAAGCTCACTGACGCAATCAAATTCAGTAGAGTATACTGTCTT
      ATTTCCAGATATAATCCCTTATAATCAGTAATACTAGCTTAAACGCTAATGGATAGCGTATTCATAGTTGTAAGAATGAA
      CTTCATACGTAAATAAAGGTTATTTTTGCAAA
      
      3' Sequence
      Total bases
      326
      NCBI
      3' sequence dataSequence Downloader
      TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAAAAATAACCTTTATTTACGTATGAAGTTCATTCTTACAACTATGAAT
      ACGCTATCCATTAGCGGTTAAGCTAGTATTACTGATTATAAGGGATTTTTTTTGGAAATGAGACAGGATACTCTACTGAA
      TTTGATTGCGTGAGTGAGCTTGAATTCGGATCTCGGTCCCGCCCCCCTGCTCGGCCACCATTTCCACCTTGATGCTCTAG
      GCCAGCATTAGGGCGTTCTGATGCAATTTGGTCTCCTCGAGCTGGCCCAAGTGATGCAGCAGACGGAAATCCTTGTTGCA
      ATAATC
      
      Library Information (1)
      Library: EG_pGEMT_cDNA
      Description
      Sample preparation
      Fly gonads were isolated from embryos carrying EGFP-vasa transgene that express GFP only in pole cells by using fluorescence-activated cell sorting (FACS).
      Protocol
      Total RNA was extracted from the isolated gonads at embryonic stages 13-16 by using RNeasy Mini kit (QIAGEN). Poly(A)+ RNA was purified Oligotex dT30 (TaKaRa) from the total RNA. cDNA was synthesized and amplified by Long-Distance PCR using SMART technology (Clontech) and cloned into pGEMT-Easy Easy vector (Promega). cDNA inserts are flanked by linker sequences 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' (5' linker: SMART IV Oligonucleotide, Clontech) and 5'-NBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATGTCGGCCGCCTCGGCCTCTAGAAT-3' (3' linker: CDSIII/3' PCR Primer, Clontech).
      Comment
      Reported As
      Symbol Synonyms
      References (1)
      Research paper (1)
      Shigenobu et al., 2006, Proc. Natl. Acad. Sci. U.S.A. 103(37): 13728--13733
      Molecular characterization of embryonic gonads by gene expression profiling in Drosophila melanogaster. [FBrf0193273]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)