Open Close
General Information
Symbol
Dmel\Elena_26_H03
Species
D. melanogaster
Name
Elena_26_H03
FlyBase ID
FBcl0394314
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    CHQ_cDNA
    • cDNA library of D. melanogaster, Canton-S strain, embryo (gastrula).
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      894
      NCBI
      Partial sequence dataSequence Downloader
      TAGCGTGCTCGCGGCCGAGGTACTTTTTTTTTTTTTTTTTTTTTTTTTTCGATTCGATGTCCAATTCTCCGGCATCGCCA
      GTCTGGACCCCCGTCCCCTGAGCTTTTCCTGCCGCCTCGGGTGAACTAAAGTCGGCCGGATCGCAGGAAACAGAGGCTGA
      GACTTGTGCGTCATTTTTATTCATTTTAGGATCTGATGTATTTGCCAATTCAGGAGTTGCTGATAATGCGTCCTGCTGGG
      CGACCGACACATCCAAATCGCTGCCTTTGCCCGGCAAGACTTCGGATTTGTATGAGGATTCGGAAACGGTTGTGGCATCA
      TTTTCGCTTCCCGTTTTGTCGTTGCCGCCGCTAGCATTTTCACTGCTACTCTTACCAAACGAACTGGGACGCTCCGGGTC
      GAGAAGCGAGTCCTTGTTATCGCCCCCGGTGAGTTTGGTAAAGTCAAAGTCTTTGGTCGTTGTAGTTCCGTCATCGTCCA
      CCTCGTCACCATCATCGTGCTTCGAATTAGCATCGTCTTCGTTTATCGGCAAACTCGTGACAGCCAGATCGTCACCGGCC
      GCACCGGCGCCCACATGGGTGACAAAGCACAGATTGGGATCGGCGCGCATTTGACGATACATTTCACAGCCATGCTTGTG
      GGTTCCCACCAACAGGCTCTTATCACAACAAATGGGATTCCACCATGAAGATGGCACTTGATCTGGCGTTGGCGGCGGGC
      GAATGGGGAGTTCGCTGATAGGCGTGTTGTCCTTTATCTGCTGAACAAAGTCGCCAATAACCTCATGTTGAATATAATAG
      AGCATCCTCACGCGCAGCAAAACCTTATTGGCGTGTCTGCCTAAATGCTTCTTGTAGGCGCCTTCCAAGTACCTGCCCGG
      GCGGCCGCTCGAAA
      
      Library Information (1)
      Library: CHQ_cDNA
      Description
      Sample preparation
      Protocol
      Comment
      Reported As
      Symbol Synonyms
      CHQ
      CHQ_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)