Open Close
General Information
Symbol
Dmel\CK01.108A.C7
Species
D. melanogaster
Name
CK01.108A.C7
FlyBase ID
FBcl0430477
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    EK_EP_cDNA
    • Exelexis EK-EP cDNA library of D. melanogaster, iso-1 strain, mixed stages.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      382
      NCBI
      Partial sequence dataSequence Downloader
      GATCAAAGTGTTAATTCCCCTGTAAATATAATATATATTATAATATAAAGATATACATTTAAAAAGAAAATGTATTTAAA
      CTATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAACGGAATCGCTAGAATCTGT
      ATTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTTTATAACACACTTGTTTTT
      CAAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACCTGCTTTCTTGAAATGAGT
      TGTTCTGTTGTTCTGCCCAAATACCATAAGAGAATTTATAGTTCTCTATTAGGAAAAGATGA
      
      Partial Sequence
      Total bases
      379
      NCBI
      Partial sequence dataSequence Downloader
      GATCAAAGTGTTAATTCCCCTGGAAATATAATATATATTATAATATAAATATATACATTTAAAAAGAAAATGTATTTAAA
      CTATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAACGGAATCGCTAGAATCTGT
      ATTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTTTATAACACACTTGTTTTT
      CAAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACCTGCTTTCTTGAAATGAGT
      TGTTCTGTTGTTCTGCCCAAATACCATAAGAGGATTTATAAGTTCTCTATTAGGAAAAG
      
      Partial Sequence
      Total bases
      467
      NCBI
      Partial sequence dataSequence Downloader
      GATCAAAGTGTTAATTCCCCTGGTAATATAATATATATTATAATATAAAGGTATACATTTAAAAAGAAAATGTATTTAAA
      CTATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAACGGAATCGCTAGAATCTGT
      ATTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTTTATAACACACTTGTTTTT
      CAAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACCTGCTTTCTTGAAATGAGT
      TGTTCTGTTGTTCTGCCCAAATACCATAAGAGAATTTATAGTTCTCTATTAGGAAAAGATGATTTGAGTGTATGGCAACC
      CCCGCGAGTGAATATAAGAGCCGAAGATCGCTCTGCATGAGCCCAAAACTAATCCAATTAAAAAACA
      
      Partial Sequence
      Total bases
      325
      NCBI
      Partial sequence dataSequence Downloader
      ATCAAAGTGTTAATTCCCCTGGAAATATAATATATATTATAATATAAATATATACATTTAAAAAGAAAATGTATTTAAAC
      TATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAACGGAATCGCTAGAATCTGTA
      TTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTTTATAACACACTTGTTTTTC
      AAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACCTGCTTTCTTGAAATGAGTT
      GTTCT
      
      Partial Sequence
      Total bases
      456
      NCBI
      Partial sequence dataSequence Downloader
      ATCAAAGTGTTAATTCCCCTGGAAATATAATATATATTATAATATAGATATATACATTTAAAAAGAAAATGTATTTAAAC
      TATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAACGGAATCGCTAGAATCTGTA
      TTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTTTATAACACACTTGTTTTTC
      AAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACCTGCTTTCTTGAAATGAGTT
      GTTCTGTTGTTCTGCCCAAATACCATAAGAGAATTTATAGTTCTCTATTAGGAAAAGATGATTTGAGTGTATGGCAACCC
      CCGCGAGTGAATATAAGAGCCGAAGATCGCTCTGCATGAGCCCAAAACTAATCCAA
      
      Partial Sequence
      Total bases
      356
      NCBI
      Partial sequence dataSequence Downloader
      GATCAAAGTGTTAATTCCCCTGGAAATATAATATATATTATAATATAAATATATACATTTAAAAAGAAAATGTATTTAAA
      CTATTAAAGAATTAGAATTATAAAGATTTAATTTATGCCCATTATTGTATAAAATTTAAAACGGAATCGCTAGAATCTGT
      ATTTAAAAAAATACTATCAAAAATTATCAGTGATTTTAAAAATTGTTATTTTTAAAAATGTTTATAACACACTTGTTTTT
      CAAGCTCAAGATCCTGATGCCGAGCTAATAAAGAATATTTGAAAATTTGAGACAAGCAGACCTGCTTTCTTGAAATGAGT
      TGTTCATGTTGTTCTGCCCAAATACCATAAGAGAAT
      
      Library Information (1)
      Library: EK_EP_cDNA
      Description

      Cloned random-primed cDNAs isolated from mixed stage embryos, imaginal disks, and adult heads. The strain used was not the iso-1 sequenced strain.

      Sample preparation

      Mixed stage embryos, imaginal disks, and adult heads were used as a source for RNA.

      Protocol

      All clones are from a random primed, normalized library from mixed stage embryos, imaginal disks, and adult heads.

      Comment

      The Exelixis ESTs were submitted to GenBank by the BDGP on behalf of Exelixis.

      Reported As
      Symbol Synonyms
      CK01 (EK)
      CK02 (EP)
      EK_EP
      EK_EP_cDNA
      References (3)
      Personal communication to FlyBase (1)
      Carlson, 2005.9.12, FlyTag EST project.
      FlyTag EST project. [FBrf0188689]
      Unpublished (2)
      Platt et al., 2005, FlyTag CK02 EST Project.
      FlyTag CK02 EST Project. [FBrf0186301]
      Kopczynski et al., 2004, FlyTag CK01 EST Project.
      FlyTag CK01 EST Project. [FBrf0185710]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)