Open Close
General Information
Symbol
Dmel\524708
Species
D. melanogaster
Name
524708
FlyBase ID
FBcl0467088
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    EN_cDNA
    • Exelexis EN cDNA library of LPS-stimulated, D. melanogaster, mbn2 cells.
    Strain
      Tissue Source
      Sequence Data of the Insert
      Partial Sequence
      Total bases
      467
      NCBI
      Partial sequence dataSequence Downloader
      GCACGAGAGCTGATGACCTCACCGCGTCATGCCCTCAGCTTTGATCGAGTGGCCGGCGGACTAGACACCCTGCCTCCGTA
      CCTGCCGCAACTGGAAGCCGTTGCTACGATGGGCTGAGGTGCAGCCGAATAGTATAATTAGCTTTAGTCAGCGAGAGACC
      ACATTCGCATAGAGTAGATTTCGGTTCTGAGTCACTGCTGCTAAGAGAAAACATCACTTCATTTCGATTTTAGATGAGTT
      CACTTTCAGTGTTCTGAAGAGAAAATAATTTGTTTTAGAATTTACACATTGATTTAATAAAGCTCATAAATTGTTATTAT
      CCATATAATATTAGAAGTGAGCATTTATGAAACACAATTCGATGTTTATTGTTAATACGCACAAACTTTCTACAAATAAA
      AGAGTGTTCTATGCCAGAGCTTATCAGATCTAAAAAAAAAAAAAAAAAAACTCGAGGGGGGGCCCGG
      
      Library Information (1)
      Library: EN_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from immunologically challenged mbn2 cell line; cell line used was not derived the iso-1 sequenced strain.

      Sample preparation

      The mbn2 cell line was LPS-induced.

      Protocol

      RNA isolated from LPS-induced mbn2 cell line; oligo(dT) primed.

      Comment

      The Exelixis ESTs were submitted to GenBank by the BDGP on behalf of Exelixis.

      Reported As
      Symbol Synonyms
      EN
      EN_cDNA
      MN08
      References (2)
      Personal communication to FlyBase (1)
      Carlson, 2005.9.12, FlyTag EST project.
      FlyTag EST project. [FBrf0188689]
      Unpublished (1)
      Nakanishi et al., 2005, FlyTag MN08 EST Project.
      FlyTag MN08 EST Project. [FBrf0186108]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)