Open Close
General Information
Symbol
Dmel\FI03949
Species
D. melanogaster
Name
FI03949
FlyBase ID
FBcl0474962
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
  • This corrected cDNA clone replaces GH02340
Library
FI_cDNA
  • FI cDNA library of D. melanogaster, corrected clones from various cDNA libraries.
Strain
    Vector
    Tissue Source
    Sequence Data of the Insert
    Full Length Sequence
    Total bases
    2,372
    NCBI
    Full Length sequence dataSequence Downloader
    TCGCTTTAAAATCGGCTGCACAAATTGTTTAGAATCTTACCATTTTCAAGACGCGGTCGAATCCATTGGACCCGCTGGCG
    TACTCGGACATCTGCTTCACAAAGTCCTTTGAAAAGAAAGAACTTCAGTTATCTACTCAACAAGTTACATGGTGCTCTAA
    CCATTCCCAGTTTCTTGGCCGCCATTCCGGTGGATTTGGATTCCTGAACTGAGCACGACGAAATGACGAAAGTTACTGAG
    GGAGAAATTTCACATGGCGTTCAAGATGTCGGGAAATATTATCTGGATTTTCACCTTCTAGCCAAAGGATTCGTCCGCCA
    GGACTCGGTACACGACTTTGTAAACAGCGATTCCGATGGAGACTTTATAGCACTGAGCGGCTCCAAATCGGAAGTGATCA
    CTCTGGAATTGAGCAGCAAGTTCATGGTCGTGGATCCCTTTCCGTATTTTGTGGCCATTTATGATTCCAACGCTGCGGAA
    ACACGACCTCTGGACGTTTTGGCCAACAAAGTGGATCTGGTTGCCATATACGACAGCTGCGATGTCCTGGAGGCACAGCA
    CTTGGCCCTGGACCCGGCATACACGGCTGTGTGCTCCGTTGCCGTGCCACCAGCCAGACTAACAGCTGTTAAGCGAGCAC
    CCAAGCTGGCAGCTAATGGAAATCTCCTCCTGGGCTCCCTCAACACTTATGGATCCTTGAGCCTAATAAACAAGTCCGCT
    GAGTACAATCGTTGGAACCCTGTGGAAGGACTAAATATCGCTGAAACTCTGAGGGACACTCTGCTGCCTGAAGTGGACAT
    CGCCAAGATAAAAGACTTTAAGAGCTATCAAGAATATATTAATCCCGCCTGGATCACTATGTTTGCTTGGTTACCTGATG
    ATGCAGATGCCACTGGCCAGCATGTTTTGGTTCTGGGAACAGCCGCAGGAAGTTTGTGGTTGCTCACACTAAGCGCCGAT
    GTCAAAACTCTTTTAAGTCATCAAGAAACGAAAACCTCAATGGGTCGTATCTGCCATATACAAGCTTTCAAGGACCTTCT
    ACTGGTGGGCGATAGCAACGGACTCATTCACCTGTACCAATTGCCAGCTAAGGGAAATACAGCTCTCGCCTTAGTGAAGC
    CCTTGTGGGAGAAAGCCGATCGCATGGGTCTGCAAATGGCAGTGATCACTGAATGTCCCAGAATGGATTGCTATTATATA
    ACCTGCTGCAAGGCGGCGCACCTGCTGACCTGGAGCATGCCAAGAACGGGGAGCACAGACTGCCTGCAAGCTCGGATCTA
    TGTCGGCGGAATGAAGATCACCGCTCTCTGCAGCCTGGAGAACAGTAGCTACGTTGCAGGAACCGCTGGAAGCTGTTTGT
    CTTGCGTACAAATTATCCACGAGAATAATCAGCTTAGCCTGCAGATGCAATCGATAGCCATGGGTGTCCTTCAGGATTTC
    CAGGTGATGGGACTGTGCACCAGTAGGCACAAGAACTTAATGACCCTGTTACTCTACCGCAACAAGGAATATCTAAATGA
    AACTGTATCTCAAAAGAACCAGTTGGTTATGCAAGTGCTCAAGGTGGGGAATCAGGATCCACTTGATCAGCTTGTCAGGC
    ATCTGGAATCCAATAAGCCCATGAATCACTATACCGATTTATTAGCTGGACTACGTCTGCACGTTTTTGCCGAGGAGAAT
    TGGCAAAAATTTATGGACTTTTGTCCATTAGATTCCATTGAATTTGCCGATACCGCCACTGAAGGTCAGCTGCAGCAGCT
    GCAAATTAAATTTCATGTTCTTCAAAACGTGATTCGCCTGCAATCGAGCCACCTCCAGCTGACAGTTCACATCCAAAAGT
    CCCGGGATGAACTGCAGCTGCTCCTTGCGATGCTGAATATCACACACATAAGACTGAGGCTCCAGTTTATTGGGTCATTA
    AGTAAGAGATCACCATTCCAGGAGCAGGCGATAAAATGTATGTTCGAGGAGGCCCACAGACTGATAAATAAACTCAATGA
    CGACTTCACGGAAAACCATGCCCTAGGATCCACAGCAAGGACATTCGTTGAACAAATGGGCAACCATATTCAGCACTTGC
    ACGAGATGCTAGGTATACCTGTGATATCTAATCCCCAGAAGCAACTTCATCGATGCAGTGTGTCCTTTGTGGAGATCTCC
    CTCAGCTTGGAGCGACGCTACTGCAGCCTCTGCAACCGCCAAATCCTATTCGAGCTGGACAATCTGCAAGAACTCTACGA
    GTCGGGGAGACATCTGACATGTCCCGTTTGCCATGGAAGCTTTGCCACGGAAATGTTTAATGCATAAACGTTAAATTTAT
    TCTCAATCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    
    Library Information (1)
    Library: FI_cDNA
    Description

    Corrected cDNA clones.

    Sample preparation
    Protocol
    Comment

    BDGP corrected cDNA clones; vector and tissue/stage source are the same as the progenitor clone.

    A file listing all FI clones submitted as of April 2014 and their source cDNA clones may be downloaded from the FlyBase ftp site (link above).

    Reported As
    Symbol Synonyms
    FI
    FI_cDNA
    References (1)
    Personal communication to FlyBase (1)
    Wan and Celniker, 2014.4.22, FI clones and source cDNAs.
    FI clones and source cDNAs. [FBrf0226489]
    External Crossreferences and Linkouts ( 1 )
    Linkouts
    DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
    Synonyms and Secondary IDs (0)
    Reported As
    Symbol Synonym
    Secondary FlyBase IDs
      References (0)