Open Close
General Information
Symbol
Dmel\AM04054
Species
D. melanogaster
Name
AM04054
FlyBase ID
FBcl0481709
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      5' Sequence
      Total bases
      73
      NCBI
      5' sequence dataSequence Downloader
      GGTGCCAGAACTAACTGCATTACGAGGATGGTGGTATTTTCGCCTCACGGATCCTGTTGGAGAATGAAATGTT
      
      3' Sequence
      Total bases
      101
      NCBI
      3' sequence dataSequence Downloader
      CCTCGTAATGCAGTTAGTTCTGGCACCGGAATGCTTGACAGCCAGGTAGTTACTAGTATTGGCATGTTGCATATAGGTAT
      TGTATTCGTTGTGTTTGGAGT
      
      Library Information (0)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
      • FBgn0082852
      References (1)