Clone Dmel\RP003492546
| General Information | |||
|---|---|---|---|
| Symbol | Dmel\RP003492546 | Species | D. melanogaster |
| Name | RP003492546 | FlyBase ID | FBcl0656784 |
| Feature type | cDNA_clone | Computed gene(s) | Dmel\Indy |
| Collection Status | N/A | ||
| Known Problems | none | ||
| Library |
|
||
| Strain | |||
| Stage |
|
||
| Tissue Source |
|
||
| Vector | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Sequence Data of the Insert
|
|||
| 5' Sequence | |||
| Total bases | 209 | ||
| GenBank | GH790893 | ||
| 5' sequence data | AGTCGCGCATTTCACCGTTTCCGAATCGGACGAACCGGGCGTGCTTGCTC TCCTGCTGCTTTCGAGATCGGAGTCCCGATAAGGATATAACTACAACCTA AAGAGGAATCCAAGCCTCCTCCTGCCGCTAGTTTCGAAAAATCTACACGC CACCGCCACTGGACATCAAAATGGAAATTGAAATTGGCGAACAACCCCAG CTGAGACAC |
||
External Crossreferences & Linkouts
|
|||
| Linkouts | |||
Synonyms & Secondary IDs
( 0 )
|
|||
| Reported As | |||
| Symbol Synonym | |||
| Secondary FlyBase IDs | |||
References
( 2 )
|
|||
| Research paper |
|
||
| Supplementary material |
|
||
Recent Updates