Open Close
General Information
Symbol
Dmel\RP003244912
Species
D. melanogaster
Name
RP003244912
FlyBase ID
FBcl0676296
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    RP_cDNA
    • RNA-Seq of D. melanogaster, iso-1 strain, embryo, 5' ends of capped transcripts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      223
      NCBI
      5' sequence dataSequence Downloader
      CCAGATCCACCAAGACATGAGCAACAAGGAGAATCCGGGCATTAAGATTCCGGCCGGAGTGAAGAACACCAAGCAGCCGC
      TGGCCGTAATTGGGGGAAAAGCGGAGAAAAATGCGCTTGCGCCGCGGGCCAATTTCGCCGTGCTCAATGGCAACAACAAT
      GTGCCGCGTCCGGCCGGGAAAGTTGTCTTCCGTGACGTCAGAAATCTTAATGTTGATGAGAAT
      
      Library Information (1)
      Library: RP_cDNA
      Description
      Sample preparation
      Protocol
      Total RNA was isolated. Gene-specific 5' RLM-RACE products were generated using the FirstChoice RLM-RACE procedure (Ambion). Primers were designed to target all FlyBase release 5.12 (October 2008) transcript models that overlap 5' ESTs from the RE (FBrf0152058) and LD (FBrf0127297) cDNA libraries. Transcripts of genes expressed in the embryo based on whole-mount RNA in situ hybridization (FBrf0205271) and literature surveys were also targeted. In all, 8570 distinct primer pairs representing 7742 genes were designed. For 1453 RACE reactions that lacked detectable product, second-round PCR conditions were used that including 5 extra amplification cycles.
      Comment
      Clones were not preserved and are not available for distribution.
      Reported As
      Symbol Synonyms
      References (2)
      Research paper (1)
      Hoskins et al., 2011, Genome Res. 21(2): 182--192
      Genome-wide analysis of promoter architecture in Drosophila melanogaster. [FBrf0213090]
      Supplementary material (1)
      Hoskins et al., 2011, Genome Res. 21(2):
      Supplemental Material. [FBrf0213251]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)