Open Close
General Information
Symbol
Dmel\MB6-CG31668-RB
Species
D. melanogaster
Name
MB6-CG31668-RB
FlyBase ID
FBcl0704077
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    MODENCODE_DM_A_cDNA
    • cDNA sequences of D. melanogaster, iso-1 strain, adult.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      3' Sequence
      Total bases
      413
      NCBI
      3' sequence dataSequence Downloader
      CAAGCTGACTTTCTTGAAGGTCTTGTGCGCGGAGGTCGTCTGATATTTAGCGAGACCAATCCCTCGCCCTTTGCTCGTCA
      CACCGTTTGTAGCGTTGTCATCGGCAACACCTTCTACTGGACCTCACTGAATGCGGTGCACCAGACCGTGGTTCATCGGT
      ATATGTCCTTGCCCACTCTGAAGATGGCACGAGCCTCCATCGCCTTCCTTGTAGTTGGAGCTGCCTTCTTTATTTCACTT
      CTCTGCTATTTGGGGTTACTCATATTCCATGCCTACAGGGATTGCGATCCGTTGAGTGCGGGATTGATCATGAACTATAA
      TCGACTGGTGCCCCTCTTCTCGGACTACAGCTTACGTCATGTCTATGAAATGCCTGATCTATTTATTGCCCACATAGTGG
      TCNACAGCTTAAG
      
      Library Information (1)
      Description
      Sequence of PCR products from first-strand cDNA made from polyadenylated RNA.
      Sample preparation
      Protocol
      All products were PCRed from first-strand cDNA made from mRNA.
      Comment
      Reported As
      Symbol Synonyms
      MODENCODE_DM_A
      MODENCODE_DM_A_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)