Open Close
General Information
Symbol
Dmel\RT03134
Species
D. melanogaster
Name
RT03134
FlyBase ID
FBcl0718719
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    RT_pCR2_cDNA
    • RT cDNA library of D. melanogaster, pCR2.1 vector.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      1,361
      NCBI
      Full Length sequence dataSequence Downloader
      ATGGGCAAGAAAAAGGTGCCCGTTGAGGACCTGGTGGTTCCACCGCAGGACACGCGAATATGCGGCACCATATGCATCTG
      CCAGATGACCCTGGTGCTCAGCTCGGTGGCTCTCGTCTACCTCACGGTGGCCATATATATGCCCTCAACCAGGGCCTTCA
      AAAGTGGCATCGATCCCACGCCGGTGATGTGCACCACCACGCGGGCGGTGAACAAGGACAACTGCGAGTGGGGCAGTTGT
      GGCGAGTGGTGTCTGAGCAAGACTTCCGGAGCCTGCATCCAGATCTATGTGAATCTGCGCAGCAATGGCAGCAATCTCAT
      ATTCCAGAACTGCACCAACTCGGCCAATAAAACGTGCTACGGGATCGACCAGGATCGCGCGGACAAGGCCAGGTGCATCA
      ATGATGAGTGCAAGAATCTCACGGGCACCTTCAATTGCACCGCTGGCCAGTGTCTGAACATCACGGATGCCTTCGAGTGC
      ATCTTCCACAACAGTGATGCACCAGTCAAGTGTTCCGGCAGGCGGGGAAAGATCAACTGCATGGACATCAGCGGGCTGTA
      CTCCTGCAGTCGAGGAACGTGCCGGAAGATCCGTACTCCCTATAACTGTGACCGAAGGTGCGTGGACATCCCAACACGGA
      ACAAGAACGTGGTGGTCCTCAGCGGGGACAAGGTCTACCTGTCGCAGTGCCAGAATGCCATCAATGCCGAAACTCTGGAG
      GAGGTGTGGAACGAGTCAAGCGAAAATGTAGCAATGACATCGTGTTACTTCATCAGGCACACCTCGGACCAGGTGGATGC
      GGTGGACTGCATCAATGGCTCCACGCTGGAGACCAATATGCTCAGCGATCTGACCAACTTCACATATCTGAGCCACCTGC
      ACGTGTCGGTGGCCACTCCAGTGCCGGAAATAGCACCACCCGATGTGGACCTCACCATTTCCAACGAGTCCAAGCTGATG
      ATCAATCTGGAGGGGTGTGTGAACACTCTGATGGACGAGTGCAAGGAGTTCCTCAAGGACTTCGGACGCGATGGCAGCGA
      CCACAATGCCCGGGCCCGCTTCCCGTGCTTCTATTCGCCCGGAAAGAAGGACGTGGTGGTGGCCCGATTCGACCTGGAGG
      TCACCTATCGCCAGTTTGTGTTCGCCTCGGTAGTGCCATCGGTTCTGTTCGTGGTCTCGTGTTCCATCCTGATCATGTGC
      CAGACCACCGTCTACGTGGGCGACGATGCCAAGATGCGCTTCAAAGGATGTGTGGACACGGAGACGGTCCTGAATAAGAA
      CAACGTGGGCGCACCCACCAACGGCGACATGGGCGGGGGCGGCGGCGATGAGGTTATGGCCCTATGACACTTCTATAGTG
      T
      
      Library Information (1)
      Library: RT_pCR2_cDNA
      Description
      Sample preparation
      Protocol
      Comment

      Tissue source described as "D melanogaster pooled RNA".

      Reported As
      Symbol Synonyms
      RT
      RT_cDNA
      RT_pCR2_cDNA
      References (0)
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)