Open Close
General Information
Symbol
Dmel\TA01985
Species
D. melanogaster
Name
TA01985
FlyBase ID
FBcl0723597
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    TA_cDNA
    • cDNA library of D. melanogaster, iso-1 strain, adult.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      552
      NCBI
      Full Length sequence dataSequence Downloader
      AGTACATTCAAGCAGCTCAATCGAAATGGACGGTCACAGCTGGCTTCACTTCAGCAACGGAGCAATCCCCCAGGCAGCCG
      TTGTGGCTGGTCACGATTCCGATGGCGACACCATCTTCATTGGCCGCGCCTTCTACTGCAACGACATGCTGCCGGCCAAG
      ATTATCCCCAACAAGGGCAAGGCCTACGTGGCGTATGCCAACCAGGAGGTGGAGCTGGAGAACTACGAGGTACTCAGCGG
      CTTCAACTACGAGTGGCTGCCGGCCGAGAACGGAGAGGTGCCTCCCGGCGCCGTCAAGGTCGGCCAGAATGTCGACGGAG
      AGACCTTGTACGCCGGAAGGGGCTACCATGCCGGCAGTTTGACCGTGGGCAAGGTGCATCCGTCCCACGGCTGCCTGTAC
      ATTCCCTACGATTCCGAGGAGGTTAAGATATTCGCCTACGAGGTTCTGTCCCGTCGCTTGGAGGCGAGATAGGTGATCCA
      TTTTCAGTTATTGCCTGTTAATCACAAATAAATTCGACACTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
      
      Library Information (1)
      Library: TA_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from adults of both sexes.

      Sample preparation

      The TA (Total Adult) cDNA library was made by Mark Stapleton and Charles Yu from mixed male and female adults of the isogenic y; cn bw sp (iso-1) strain.

      Protocol

      Total RNA was processed with CIP and TAP in order to ligate an RNA adapter (RLM oligo: GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA) to decapped mRNA using T4 RNA ligase. This processing step is similar to the preparation of RNAfor 5' RACE. Components of the FirstChoice RLM-RACE Kit (Ambion) were used in this processing step. mRNA was then isolated using the PolyAPurist Mag isolation system (Ambion). First strand synthesis was carried out using PowerScript Reverse Transcriptase and an oligo dT primer adapter (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30VN-3') from the Creator cDNA Library Construction kit (Clontech). Second Strand synthesis was carried out with Advantage 2 enzyme using 5 cycles of PCR with the first strand primer and a primer that anneals within the RLM oligo (AGTCGGCCTTGTCGGCCCTGCGTTTGCTGGCTTTGATG). Double-stranded cDNA was digested with SfiI and ds-cDNA > 200bp was purified using the Gene Clean Gel Extraction Kit (BioRad). Purified cDNA was then directionally ligated into the DraIII digested pOTB7D vector. cDNAs were transformed into DH5-alpha.

      Comment
      Reported As
      Symbol Synonyms
      TA
      TA_cDNA
      References (1)
      FlyBase analysis (1)
      FlyBase Curators, 2016-, Curation of large dataset metadata by FlyBase.
      Curation of large dataset metadata by FlyBase. [FBrf0232540]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)