Open Close
General Information
Symbol
Dmel\DPiM_LD32008
Species
D. melanogaster
Name
DPiM_LD32008
FlyBase ID
FBcl0739353
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    DPiM_cDNA_bait_cDNA
    • Cell line expression plasmids encoding full-length open reading frames with C-terminal FLAG-HA tags under control of the metallothionein promoter.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      3,358
      NCBI
      Full Length sequence dataSequence Downloader
      AAAAATTCGCATATTATTCACACTTTACCGGTGTTTCTTGACAGAAAATGATAAGTTTTCGTTAACCGAATTCTCAGAAA
      GTAAGTGCTTGGAAAGTTTTTCCAAGAAAAAGTGCCCAATAGGGAAACCAAACCTGAAACCAAATAATTTTCCACGATAA
      GCGCAACAACGCGATATTAGATTGGCCAGCCCTGCGTTTGCGGTTTTTTTTTTGTTTTTTTATTTCCTGTATTTTTTTTG
      GGGGGGAAAAATTGCAGTTCCACGGAAAGCGAAAAGTTTTCCACCAAAATAAACGGTTGAAGCATGGACGCCGACAAGCA
      GCTGGAAAGGCAGCTGGAGAAGGAGCTGGACGAGATGCCGGCAGAGGATTTGGACGACGATGCGTATGACGAGTATGATC
      TGATCGTGATACCCGATCAGGGCAAGGGCTCGCCGCAGCAGGGGCACAGTGAGTCGCCGCAGCAGGAGGAGGAGCACAAG
      TCGGAGGAGCTGCGCCAACGATCGCGCCCAACCTGGCCACCGTCGTCCGCCGGCGGGGATATGACCACCATTGAGTTGAT
      CTCATCGGACGACGAGCCGTCAGTGGAGGAGACTGAGGGAGGCAATGCCGCTGGCCGTGGCAGAGCGCGCAATGATTCCA
      GCAGCAGTAGCGATGATGTGGGCGTGATCGAAGGCTCGGAATTGGAATCGAACAGTGAGGTGTCCAGTGACAGTGACAGT
      GATAGCGACAACGCTGGCGGCGGAAATCAGCTAGAGCGCTCGTATCAGGAGCTGAATGCGTTGCCCAGCAAAAAGTTTGC
      CCAAATGGTCTCGCTCATTGGAATCGCATTCAAACTGAATGATCTGGAAAAGATCGAGTCATCGGTGCTGGAGCTGCAAA
      ATTTGGCCACTGTGCCGGCTCACGTGTGGCTGAAGTATCTAAAGGCCCGCCTGGTCGTCACCCAAACGGACGAGGAGCGC
      AAGGCATTCGAGGAGCAGTGTGCCAAAGCGTTGGGCTACTACTACAGCATACCGCTGTCCGAATACGTTGTCAACTACCT
      GGTGGATCAGGGCAACGTACAGAACCATGTGCTGTGGGCCAAACTGCTGGCGGACTACGACGTGGAGCGTCCAGACTTTG
      GCGACAAGCTGCGTTCGCTGATATCGACAATTACGGACGAAAATGAGGCTGCCGCCTTTGTGGAAATGCTGCAAAAGCAC
      TGCGTCACCTGGACGTGCAACGTGGAGCAGCGGCAGATGATCAAGTCCGTTGTGGACAAGTTTAAGCAACATCTGGACGA
      GACAACGCGTGGTTGGGATTGGTCTGAGCAACACAAGGCTCATGTCTACGATGTGGAGACATTATCCCTTGACGATGACC
      TCAAAAACGCTGTGATCCGTTTCATATTCGAACGCTCGGTGGCCAAGTTTCCCATTGTCGATGTGCTCTGGTTATCCTAC
      ATTGAGTTCATTCAGTTCGAAGGCGTCACTGTGCCGGAGAATGAGGATGAGAATGAGGTAACCGCCGAAATGGTAGCCAA
      ACGGGCCAAACGCTTGGGCAAAGGTTTTCTGCGCAACACGGAACTCGATTTGGCCAATCGTGGTGTGCGCAGTCATCCCA
      GTGTACAATTGAATCATCGTTTCCTCGACCTAATGGAGCGCTCGGACTTTGAGTTGGCGGAAGTGGATGAAGAGATACGT
      CTCATATTGCAGCGCATTGTGACCGACATGGATATGACCGTGGAGCTGCATCTGGACTATCTGGCCTATCGTATTCGCAA
      CACCAATGCCAGCGATGAGCAGCAGGTCGCCAGTCTGCGTGCCGCCTTCAATCATGCTTGGGAGGAGCTAACCGTGCTCT
      ACGGCGACCAGGCGGACACCAGGTACGAGGTGCTGCAGTTGTGGGCCCAAGTTGAGTACACGCAACTGGGGAGTCCGGAC
      AATGGCCGTGAGATTTGGCGCCAAATAATGGGCTATCCGGGCAGCTCGATACGCGGCCTGCTCTGGCTGAACTTTGCCCA
      GATGGAAAGCGAATACAATGGTGGCCACGGCACACGCGATGTCCTTCGCAAAGCTCTCTCGCAGCCCGTCCTCGAGAATG
      GCCTTATGGTGCAGGAGTTTTTTCGCCGCTATGAACGTTGCTATGGCACCTACGAGTCCATTGCCGCCTGCCAGGCCCTC
      GATCTGCCTGTCGAGTATGTGAAGCCGCGTTCCCGCATTAAGCCCAACTCACAGTCGGCTTATCCTCGCCAGCAGAAGCT
      TAAGCCGCGCCAGCAGCAGCAACAAACGAATCGTGAGCCACTGAATCGCGAGCAGCGACGTCGCCAGGCGCATGAGCAAC
      AACAGCAACAGCAGCAGCAGCAGAAGCATGGCATTAAGAAGTCCAGAACCGAGCCATCTGGTGGAGCTACGTCACCGCCA
      TCGAAAGTCAAGGGGCCAGCGAATGCAGAGGCCAAGGAATCGAACTTTAAGTATTCGCCCAACATGGAAATCAATAAGAT
      CTTTGTAAGAAATCTGCATCCCGCTTGCAGCAAGGAGGAGCTGCACGAACTCTTCTCGCCTTTCGGCACCATCAAAGATG
      TGCGCCTGGTGCACAAGCTAAACAAGCAGTTCAAGGGCATTGCATACGTTGAGTTCGAGAAGCCGGGCGAGGCGCAACGA
      GCAGTGGCTGGACGAGATGGTTGTCTATTCAAGGGCATGAATATCTCTGTGGCCATTTCAAACCCACCGCCGAGGGGCAC
      ATCAGCTGTCAAGCCAAGTGTGGCGCCCAAGCGACGTGTGCCCACCTCGCTTATACCCACGACTCTGGTGCGCCAAGAGG
      TGGCTGCCAAGAAGCTGCGCTTGCTTCTGCCCGAGCCGGGGGACATATCATCCACTTCGGCATCCGTCGACGTGGCCATC
      AAGCGCGAGGCTAATGGAGAGGAGCAAAAAGGAGATGTTCAAGAACGAGATGAGCAAAAAGGAGAGGAGCAAAAAGGAGA
      GGAGCAAAAAGGAGAGGAGCCAAAAGGAGAGGAGCAAAAAGGAGATGATCAAATAGGAGAGGAGCAAAGTGGAGTGGAGC
      AAAAGGGAGATGAGAAAAAAGAAGAGGAGATGCCAGCTGCTGTGCCCAAGTCAAACGATGACTTTCGCAAGCTATTTCTC
      AAGGATTAGGCGACAAATGCCGGCGGCTGAGCCCGGTGCCAGCGGCCATGGTTTAGTTTGTAAGACGAAGACGAAGATTT
      GGAGCATATATTTTTTTAGATTTAAGGCAACCTAAACAGACAAGGTTGGAGAACACTGTACAAAGAGAAAAACTGTTGTA
      AGACAATGATTTTTGTTTCGACTCATATAAATTGGTTTCTTGATGAACCAAGTGAAGAAAAAAAAAAAAAAAAAAAAA
      
      Library Information (1)
      Description

      Full-length open reading frame fused to a carboxyl-terminal FLAG-HA tag cassette under the control of a metallothionein promoter.

      Sample preparation
      Protocol

      A cDNA sequence encoding each bait molecule was cloned into the pMK33-C-TAP-FLAG-HA-BD vector as a full-length open reading frame, fused to a carboxyl-terminal FLAG-HA tag cassette under the control of a metallothionein promoter. cDNA sequences are derived from previously characterized and publicly available clones created by the Berkeley Drosophila Genome Project; all inserts are full-length sequence-validated.

      Comment
      Reported As
      Symbol Synonyms
      DPiM_cDNA_bait
      DPiM_cDNA_bait_cDNA
      References (3)
      Research paper (2)
      Rhee et al., 2014, Cell Rep. 8(6): 2031--2043
      Transcription Factor Networks in Drosophila melanogaster. [FBrf0226298]
      Guruharsha et al., 2011, Cell 147(3): 690--703
      A Protein Complex Network of Drosophila melanogaster. [FBrf0216491]
      Personal communication to FlyBase (1)
      Mintseris et al., 2009.11.23, DPiM: the Drosophila Protein Interaction Mapping project
      DPiM: the Drosophila Protein Interaction Mapping project [FBrf0209452]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)