Open Close
General Information
Symbol
Dmel\RT12724
Species
D. melanogaster
Name
RT12724
FlyBase ID
FBcl0743438
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    RT_pCR2_cDNA
    • RT cDNA library of D. melanogaster, pCR2.1 vector.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      1,702
      NCBI
      Full Length sequence dataSequence Downloader
      GCCGGTCAGTCGAGCGTTCTCCAGTCGGTTCGAAATACGATCTAATACATAATATAGAAAATATCTCTAGTCATTGACCC
      GAGGGCCAAGACCAAAGTGAAGAGCGAAAAGACTGAAAAAACGCCCGAAGACATCTGATTATGCAAATGCCGGTGGTTTT
      TAGTGTTTTGTGGCTGCTTCAGCTGTTTCTGCTGGTGGAATCCGTTGCTGGAGCTAATTTCGCCAGGGGAGAGGAGCAAC
      TGCAGGCTCTGCTAGACACCGAAACGCAGCTCATCGATGGGTTGCGTGATTATATCGAGCGATTGGAGCGTCAGCTGGAG
      GAGATCCGAAGGGAGACCTCGGCCATCGAGGAGATCCACAGTCAAGTGGATAGTGTGGAGGAGTACATGGGTAATCCATT
      AAATGTCTTTGGTATTCTCAAGAGGTTCGAGAGTGTATGGCCCGGATTGGAGCAGAAGGCGAATGCCACTCTGGAGATGG
      TGTTCGGAGAACGATTGTCCGACAGGCAGTTAACCCTTCCCAGCGAGGAGGACTACGAGGAGTCCCTGAATCATCTGCTA
      CATCTGCAATCCGTCTACGAATTGGACTCGAATAGCCTCTCCTTGGGCGTGGTGAATGGATTTAAGCTGGGCTCCTCCAT
      GTCCTGGGGCGACTGCCTGGAAGTGGCTCGCAAGTCGGACTTTCCTGTGGCCAGGTTCTGGCTAGAATCTGCTTTAGAGA
      AGCTGCCCTCCGCCTCAGAAAACTCCACGGAATCGCAGAGGGAACGGGAAAGCGGACGTGTGCACATCCTGGAGGCAACT
      CTCAACATTGAATACCGCGCTGGGGAGCTTTCCCGAGCCCTGGCAACTGCCGAGGAGCTCCTACTGCTGCTACCAATGAA
      CCAAGGCATTCAAAAAGCCAAAAGAAAGATTGAAAAAGCCATGGCCAAGAAGGAATTGCCCAAGGGAAGGGGCCAAAAGT
      CGAAGGCAAAGAAACAAATATCCAAGTCCACGGAGCAGCTGCTCATTGAGGAGATTTGTCGCGGAGCAAAACAGCAAGTC
      ACAACAGGAAGCCGCTTCAACCACTGCCAGTTGGATGGAAGTTCGCCCTGGTTGCTCCTCCAGCCCTCCAGATTGGAGCC
      TGTCAGTTCAGATCCATATATAGTTTTGCATCACGATGTATTGACGCCGAAGGAATCCAATGAATTGCTGCAACTTATAG
      ATGAGGAGGAGGATACAAAAGGAGTTAGCTATCAATCGCTGAGGCTATCCAAACTGGCACAAAAGAAGCTTGGAAGGATT
      AGTCGTCTCCTGGGACTTGAGATTTTAGAACTAGATCCCTGGACCGGACGTCGCCATGGTCACGAGCACATCACCAAGTT
      GGAGCATAGCTCGGAGCTGAAGCATGTGGCACGTCTCATGTTGAACTTGCAGGCACCCGGAATGGGAGGAGCAGTGGTGT
      TTCCGCAGCTAGAGCTCGCCGTGAATGTCCCACGTGGCTCGCTGCTCCACTGGCGCACACGATTCGCCGGGGGCTCGTCA
      TCCGAGTGGGACTACCGCAGTGGCCAGGCCATCTGTCCCGTGCTCCTGGGCGTCCAGTTGTCCGCGTGGACAGGACTCAA
      TTGACGTGGGCAGCGAGGCCTGATGGGTTTTCATGGTTTCCCGATCCCCGCGACATGTGCATTAATTGCCAGCTGGGGAA
      TCAAATAAAGTTGACCTTGGCA
      
      Library Information (1)
      Library: RT_pCR2_cDNA
      Description
      Sample preparation
      Protocol
      Comment

      Tissue source described as "D melanogaster pooled RNA".

      Reported As
      Symbol Synonyms
      RT
      RT_cDNA
      RT_pCR2_cDNA
      References (0)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)