Open Close
General Information
Symbol
Dmel\FI22774
Species
D. melanogaster
Name
FI22774
FlyBase ID
FBcl0743556
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    FI_cDNA
    • FI cDNA library of D. melanogaster, corrected clones from various cDNA libraries.
    Strain
      Vector
      Tissue Source
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      1,473
      NCBI
      Full Length sequence dataSequence Downloader
      AATAATAGCAATAAAAACAATATCAATTAAGTATAAAACATGAATAAGGCATCCCGAATTTTCTGTCCAGCCTTGATCAC
      ACCCAAAAATGCGGTGGTCAAGCAAACGGAGCAACTGTCGCGCAGCCAAAAGCTGCTGACAGAACTTGGCTTGGTTAAAT
      CGGGCAGCAATGGCACCTACCAAATAATGCCCATGGCCCAGCGATCGGTAGACAAGTGCATTGACTTGGTCCAAAGCAAC
      ATGCAACAGGCTGGTGGGCAGAAGATCACCCTGCCCATCCTGACGCCCACAGGACTTTGGAAGAAGACGGGGCGACTGGA
      CGGCGATATATCCGAGTTCTACATGGTGCGGGATCGCAGCGGCAAGCAGTTCCTCATGAGTCCAACCCACGAGGAGGCAG
      TGACTGCCATGCTGGCCACCACCTCACCTATTTCCTATCGGCAGCTGCCCTTGAGACTCTTCCAAATCGGTCCCAAGTTC
      AGGGATGAGCTTAAGACTCGATTTGGTTTGATGCGAGCCAAGGAATTCCTAATGAAGGACATGTATTCCTTTGATGTCAG
      CGAAGAAACAGCCATGGAAACTTACACACTAGTTAATGCTGCATACGATAGGTTGTTCAAACAGCTGGAGGTTCCTTTCG
      TTAAGGTGAATGCCGCCACTGGCATAATGGGTGGCAGTGTATCCCACGAATACCATTATGTATCGCCCGTGGGCGAGGAC
      AACCTACTGCAGTGCAGTTCCTGCGGCTTTGCTGGCAACTCTGAGGTTGTAAAGGCCCCAGCTAGCTGCCCGAGCTGTAA
      CAGCTCGGATTTGAAAGAAGTTCGAGGAGTTGAGGTGGCCCACACCTTCCTGTTGGGGGACAAGTACTCCAAACCCTTGG
      GCGCCACATTTCTCAACACCACTGGGAAGCCGCAATCGTTGGTCATGGGATGTTATGGCATTGGCATCACTAGGGTTATT
      GCTGCCGCTCTGGAAGTCCTCTCCTCCGACCACGAACTCCGTTGGCCAAAGCTCCTAGCACCCTACGATGTGTGTTTAAT
      AGGACCCAAGCAAGGAAGCAAGGAACAGCCGGAAGCGGAAGTGATAGAGAATGAACTTCTTCTGAATGTAGGAGAGATTT
      GCGGCCACCAGGAGTTGTTGCACGATGATCGCAAGGAGCTGACTATCGGCAAACGTTTGCTGGAAGCCAAGCGTCTCGGA
      CATCCGCTTACCATTGTAGTGGGAGCCAAGTCAGCCCGTCTGGATTCCCCCAAGCTGGAAGTGCACACCAGCAAAGGAGA
      AACATATGAGCTCGATTTCAGTGAAACCCTGAAACTGGTGGCAGAACATAGCCAGCACAAAAAGAGTCTAGAACGAGGAT
      GTTTTCAGAGTGAAACTGAAGAAAGTAAAAGTCGATCGGTTGGCCATCAGCTTTAGCTTTATGCAATAAAGGTAACAATA
      ACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
      
      Library Information (1)
      Library: FI_cDNA
      Description

      Corrected cDNA clones.

      Sample preparation
      Protocol
      Comment

      BDGP corrected cDNA clones; vector and tissue/stage source are the same as the progenitor clone.

      A file listing all FI clones submitted as of April 2014 and their source cDNA clones may be downloaded from the FlyBase ftp site (link above).

      Reported As
      Symbol Synonyms
      FI
      FI_cDNA
      References (1)
      Personal communication to FlyBase (1)
      Wan and Celniker, 2014.4.22, FI clones and source cDNAs.
      FI clones and source cDNAs. [FBrf0226489]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)