Open Close
General Information
Symbol
Dmel\CH322-176K5
Species
D. melanogaster
Name
CH322-176K5
FlyBase ID
FBcl0775024
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    CHORI-322_BAC
    • Pacman genomic clone collection for D. melanogaster, iso-1 strain, adult, 21kb inserts.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Genomic Location
      3R:13,384,962..13,406,963 [+]
      Total bases
      22,002
      NCBI
      Full Length sequence dataSequence Downloader
      Left End Sequence
      Total bases
      641
      NCBI
      Left End sequence data
      GATCTAAAGTTATTTCATGCAAGCTACGATATTTAGGTATAAATCAAAGAAACTTATCAGATATATGCACTATGTCTATA
      ACGCGTGGTTGTTTGTAAACCAACATTTTTCTTTATGTTTATGTTGCGTTGGATTGTCAAAGAATCGAAAACGGAAACTG
      AAACTAAACTAAACTGAAATTGAAATTAGCCGCCACTAGAACCGTATCTAAAGTCCGCGCCAGCGAACACGTCTAGGAAC
      AAGTTTAAGTTATTTAATTCCAGCATAAATAAAAGCGTTAGTTTAAACGGATATAACAAATAAATAATTAATACACAATT
      TCAACCCAAATGCTGTATATTCTTCTTCCCATAGTTCCAGTATCACTTGCCTTCCTCCGGCTATCTATTGATTCCATAAT
      CGCTGCATAGTCACCCGCAGGTGTGAATCATTCGAATAATGCCAATTGGAGATATCAGGCATATGGCAGTAGTTTCGTCT
      TGAGTACATTATTTAAAATGCTATCTGGGATAAGTAAAAGATAAAAAGAAAGATAAGGATAGTTTGGGATATATATGGTA
      ATGCCATTAAATCGTTAAGGATATAATGAGGGATTTTGTAGTTGTTGAGGATTATAAAGCATCCTATAAATGAATCTGCG
      G
      
      Right End Sequence
      Total bases
      715
      NCBI
      Right End sequence data
      GATCTCTCATCGTGCCAAAAACCGCTTAAAATGTATAACATTAAACCACCAAAAAGTTGACAAAACTCAGTGATAACAAT
      TATATTTCCTTCAAGGCTTATTCTAGCCCTTGTTGTGTGGCTCGCTTACCCAAATCTTTGCTTGGCCCAGTACCACCTTA
      ATCCTCCCAAGACCATCTTTCCGGACTTCAAGTTTCCCTCGGATTATAGGGATACACCCATAGTTTTTGAATGGAAGAAT
      CTGCAGTACGGCTTCCCCAGTGAACAGGAACGCGATCAGGTGCTCCGGAATGGTCGCTATAATCCGGATAGTCCCATACC
      CATAGACATCGATGTTTATTATCCACGTAAGCATCACAAAGAAGTATTGCAGGAATAACCAAAATATTGATTTTTTACAA
      TGAATAATTAATAAGCTCATAGTATGTGAAAAAATTGTTGCTTTACGATTGATTAGTAACATTTAATTTGCATTTCGAAA
      ATGGGTATATAACCTGACAAGTCTATTACTGAACTGGGAATAAATTCCCAGTAAATATGTTTTCTGTAAAATAATACTTT
      AATAATCCTTGTACTCTAAATACTCTTCACCTTATTTTCCAGCTAATGGCGGTCCACCTAGACACTTTGTGACATCGCCT
      CGCTTCGGACAGGGAGTTCCCTTTTCCCTGGGCTATGTGACCAATGTGCAGCGGGAGAACGGAAGTGAAATCCAG
      
      Library Information (1)
      Library: CHORI-322_BAC
      Description

      A BAC library containing genomic DNA fragments (average size of 21 kb) in the attB-P[acman]-CmR-BW vector for efficient transgenesis.

      Sample preparation
      Protocol

      DNA isolated from adult fly tissue was prepared in agarose blocks and partially digested with MboI. 20-25 kb fragments were size-selected by contour-clamped homogeneous electric field (CHEF) gel electrophoresis, and ligated into the BamHi site of the attB-P[acman]-CmR-BW vector, a special adaptation of the P[acman] vector. Libraries were transformed into the E.coli strain "EPI300-T1R".

      Comment

      A total of 73,728 clones were generated.

      Reported As
      Symbol Synonyms
      CHORI-322_BAC
      References (3)
      Research paper (2)
      Venken et al., 2010, Genetics 186(4): 1111--1125
      A molecularly defined duplication set for the X chromosome of Drosophila melanogaster. [FBrf0212670]
      Venken et al., 2009, Nat. Methods 6(6): 431--434
      Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. [FBrf0209231]
      Personal communication to FlyBase (1)
      GenetiVision Corporation, 2016-, A collection of transgenic flies carrying duplications that tile the autosomal portion of the Drosophila melanogaster genome.
      A collection of transgenic flies carrying duplications that tile the autosomal portion of the Drosophila melanogaster genome. [FBrf0232631]
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      PACMANFLY - The source for information and resources of tools for the Drosophila community using the P[acman] recombineering technique.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CH322-176K5
      Secondary FlyBase IDs
        References (1)