Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000095232
Interaction Network
Interactions Browser links
snf network
snRNA:U1:82Eb network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0138511-4.coIP.NB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
snf 

snf

bait

U1

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Bait protein endogenous to extract.

Prey RNA endogenous to extract.

FBrf0211144-15.coIP.PCR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
snf 

SNF

bait

U1snRNA

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was ovaries of wild-type fly line; bait produced from endogenous gene; prey produced from endogenous gene.

FBrf0239188-2.XC
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
snf 

dSNF

neutral component
snf 

dSNF

neutral component
snf 
snf 

dSNF

neutral component
snf 

dU1

neutral component

dU1

neutral component

dU1

neutral component
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
snf 
RRM domain
sufficient binding region
aa 1-96
SLI domain
sufficient binding region
GGCCGCAUUGCACCUCGCGGCC
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; protein produced as a recombinant fusion protein in bacterial system; RNA chemically synthesized.

The snf-U1 snRNA interaction was curated to the products of all 5 identical or nearly identical U1 snRNA genes.

FBrf0239188-21.ITC
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

dU1

bait
snf 

dSNF

prey
snf 
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
snf 
RRM domain
sufficient binding region
aa 1-96
SLI domain
sufficient binding region
GGCCGCAUUGCACCUCGCGGCC
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; proteins produced as a recombinant fusion protein in bacterial system.

Kd = 34nM. The snf-U1 snRNA interaction is stronger when snf is prebound to U2A, lowering the Kd to 16.5nM. The snf-U1 snRNA interaction was curated to the products of all 5 identical or nearly identical U1 snRNA genes.

FBrf0239188-7.NMR
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
snf 

dSNF

neutral component
snf 

dSNF

neutral component
snf 
snf 

dSNF

neutral component
snf 

dU1

neutral component

dU1

neutral component

dU1

neutral component
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
snf 
RRM domain
sufficient binding region
aa 1-101
SLI domain
sufficient binding region
GGCCGCAUUGCACCUCGCGGCC
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; protein produced as a recombinant fusion protein in bacterial system; RNA chemically synthesized.

The snf-U1 snRNA interaction was curated to the products of all 5 identical or nearly identical U1 snRNA genes.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (3)