Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
Interaction Network
Interactions Browser links
Elba2 network
Elba3 network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
physical association
Cell line used
Corresponds to
Reported as


neutral component


neutral component


neutral component


neutral component


neutral component


neutral component
Experimental entities
Corresponds to
Subregions with role in interaction
Corresponds to
Isoform-specific participants
Corresponds to
Comments concerning this interaction

Interaction in vitro; bait produced by in vitro translation; prey produced by in vitro translation.

Bsg25A (Elba1), Elba2 and Elba3 bind DNA only as a heterotrimeric complex.

The interaction of Bsg25A, Elba2 and Elba3 was assayed by the formation of a complex with a radiolabelled DNA fragment of the Fab-7 boundary element (TGCAGCGCCCAATAAGCAAATGGCAGC). The presence of each subunit was then confirmed by antibody supershift of the protein:DNA complex.

External Crossreferences and Linkouts ( 1 )
MIST - An integrated Molecular Interaction Database
References (1)