Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000097052
Interaction Network
Interactions Browser links
Bsg25A network
Elba3 network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0221291-2.EMSA.A
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

Elba1

neutral component

Elba1

neutral component

Elba1

neutral component

Elba3

neutral component

Elba3

neutral component

Elba3

neutral component
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; bait produced by in vitro translation; prey produced by in vitro translation.

Bsg25A (Elba1), Elba2 and Elba3 bind DNA only as a heterotrimeric complex.

The interaction of Bsg25A, Elba2 and Elba3 was assayed by the formation of a complex with a radiolabelled DNA fragment of the Fab-7 boundary element (TGCAGCGCCCAATAAGCAAATGGCAGC). The presence of each subunit was then confirmed by antibody supershift of the protein:DNA complex.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (1)